Aetiology

That is truly amazing.

Why are these people like this? What is wrong with their brains?

Posted by: Jeb, FCD | September 19, 2007 8:26 AM

Wow, that just seems... over the top. Is it fear of the disease itself that causes that kind of denialist, angry reaction?

Posted by: Jim | September 19, 2007 9:17 AM

This just in, being a moron causes AIDS!

Posted by: apyy | September 19, 2007 10:03 AM

No, you idiots! Loneliness doesnt cause AIDS.. It's a factor to an early death. Death by prescriptiona and indocrination into the death and dying club simply for nothing other than a measurement of non-specific antibodies.

Posted by: Carter | September 19, 2007 10:26 AM

Hello Tara and all of you HIV promoting Terrorists

Let's do the math...

Are gay men and Africans terrorized by HIV/AIDS? Yes.

Do Tara and her goon squad promote and support the HIV/AIDS belief system? Yes.

Looks like Michael's on the mark with this one.

Posted by: Dan | September 19, 2007 11:17 AM

test

Posted by: Manu | September 19, 2007 12:32 PM

Strangely, folks, I'm going to have to defend Michael Geiger on this one.

Well, maybe not "defend," but at least point out that the studies he cites are not complete nonsense like most of what he says.

It is entirely plausible that stress, including stress caused by "loneliness," involves physiological factors that include transcriptional changes, as Cole and colleagues suggest. Depending on what these changes are, they could theoretically lead to increased susceptibility to viral infection and disease progression.

Of course, Michael Geiger goes too far (as usual). In the absence of HIV, "loneliness" can't cause AIDS. Loneliness also will not have a "molecular signature" of HIV (i.e. lonely people won't test false positive for the infection).

It is an interesting study he brings up, though, and I'll try to remind myself that "rethinkers" aren't always completely wrong...just upwards of 99% of the time.

Posted by: ElkMountainMan | September 19, 2007 12:52 PM

It only took 2 hours and 26 minutes for whackjob Carter to show up.

Posted by: SLC | September 19, 2007 1:12 PM

they could theoretically lead to increased susceptibility to viral infection and disease progression.

I thought germ theory was a lie pushed by big pharma to sell more drugs?

Read up on Bechamp, will blow your mind!

Posted by: apy | September 19, 2007 2:49 PM

I watch these posts almost 24/7 so I can be reminded how completely and utterly insane the HIV/AIDS camp is

Well at least we now know why your research has come so far and you've published so many papers on the true nature of HIV/AIDS.

Posted by: apy | September 19, 2007 2:52 PM

This is a straw man argument Dr. Smith. I think what micheal was referring to is catastrosphic long term stress that accompanies an hiv positive test, nevertheless this "lonliness" argument does not represent the rethinker movement.

The main reason many credible scientists doubt hiv is
1) the lack of a relaible animal model, tons of chimps/mice were injected and they dont die of aids even after 20 years.
2) The lack of a carefully controlled study that would be designed to see if if hiv positive people with no other possible risk factors get AIDS, risk factors that include the cell killing chemotherapy drug AZT, coinfections w/ mycoplasma incognitus, catastrophic stress, intense drug abuse etc.

all the studies so far assume hiv is the cause of Aids, so they didnt do much to test gallo's claim, if you want to prove me wrong please provide me with a study done by honest scientists that dont view dissidents as nazis that clearly states in the study aims " a study to follow hiv positive people with no other risk factors to see if Gallo's hypothesis is correct."

3) the low amount of blood tcell infection, which is around 1/1000 t cells

4) The very low rates of transmission, the Padian study followed serodiscordant couples for years and who had all kinds of unprotected sex and there were 0 seroconversions!

Many more reasons. Lurkers should do a google search and see a film called hiv fact or fraud that explains the positions well, its free.

scientists that have doubted the hiv hypothesis at one time or another

Peter duesberg phd retroviral expert, California scientist of the year.

kary mullis phd Nobel prize winner, inventor of the PCR

Shyh ching lo md phd cheif of the infectious unit of the armed forces of pathology

Richard Strohman ucb mcb professor

Harry rubin ucb mcb professor

Walter gilbert nobel prize winner Harvard mcb professor

Lynn Margulis phd national academy of sciences member

many more...........

I would suggest people read a book called Project Day Lily, this microbe called mycoplasma incognitus killed every animal injected (Dr. Lo injected mice primates and they all died) a riveting book by garth and nancy nicolson phds found out how it was part of the biowarfare program, found in some AIDs cases and in CFS etc, google it and read a chapter for free.

Posted by: cooler | September 19, 2007 3:16 PM

Also most viruses cause the most havok before antibodies, thats why we get vaccines, if there ever was an hiv vaccine wed all test positive........sound strange!?

yes i know there are exceptions but exceptions are not the rules, this is just one of the many strange anomolies that needs to be further investigated about the hiv hypothesis.

see hiv fact or fraud.
http://www.archive.org/details/aids_scam
Read project day lily.
http://www.projectdaylily.com/

Posted by: cooler | September 19, 2007 3:27 PM

The Rethinker movement is simple, we dont know whether or not hiv is the cause of AIDS or not, it could be other things, more studies are needed by honest scientists.

Just because it was announced at a press conference, a barely detectable no animal model microbe by gallo before the publishing of any evidence and the disbarring of dissent from that day on does not make the hypothesis true.

Posted by: cooler | September 19, 2007 3:36 PM

It's Cuz there ain't no movement
says ELISA

right after Ron Paul boy said
The Rethinker movement is simple

Try again guys?

Posted by: Adele | September 19, 2007 4:48 PM

Adele, aka kathy bates from the movie misery,
Ron Paul voted against the patriot act and the Iraq war, unlike your fairy godmother hillary.

the movement does not need to be defined to an exact stance.....do all people who support Obama or for gun control have to have the same views exactly? and if they don't that nullifies evertything they say?........some of you people need to take to critical thinking classes

Posted by: cooler | September 19, 2007 5:03 PM

cooler you do know you have to be 18 to vote for Ron Paul don't you.

ELISA I just remembered you havn'et been around last few weeks so maybe you'll be the ONE person whose got a answer about those Duesberg flaws from the other thread.

So much talk from you people about how we're all scared of Duesberg and we can't find anything wrong with his crap.

Then so many examples from us of where Duesberg lied or messed around with the truth.

Then so much silence from your not existing movement!!

Maybe you got some answers well read LISA from your nice greek mythology. Why did Duesberg lie? Is it ok he lied? Since like most of your not existing movement just copies off Duesberg isn't that not a problem its lies??

If you give us a good answer maybe i'll even call you a rethinker.

Posted by: Adele | September 19, 2007 5:13 PM

. . . Although I would have to admit there are pretty convincing refutations of Duesberg's scientific arguments posted on ADIStruthy. This one from Stephen Martin, Ph.D. Immunology, University of California, Berkeley is a real haymaker, which I have never seen countered satisfactorily:

When the lights dimmed and the projector was turned on, Peter always moved close to the projector light beam so he could make hand puppets that projected on the screen. The students laughed, but the lecturers and most faculty members hated him.

Posted by: Epidemiology-LISA | September 19, 2007 5:43 PM

Oh now I understand what you are referring to. It's these words by Tara in her latest variation over her one note

One way to brush off novel evidence is to attempt to discredit the scientists carrying out the studies

http://aidstruth.org/fanaticism.php

I liked this one too:

Scientists must engage more with the public or the HIV/Aids deniers will gain credibility (...) It is up to us to explain the science to the public

When will it go up next to this one?

We will not engage in any public or private debate with AIDS denialists or respond to requests from journalists who overtly support AIDS denialist causes

Posted by: Epidemiology-LISA | September 19, 2007 5:59 PM

Adso, you may think this is a laughing matter to me, but do you remember what the very serious secret was that the Benedictines were ready to kill for to keep from the public?
http://www.ruinedendings.com/film3979plot

By the Way, have you read the latest article by one famous epidemiologist revealing more denialist immorality? Here's the headline and a relevant part of it:

Dr. Smearah Tit exposes the Deadly Denial Virus.

(...)

Dr. Tit first realized something was afoot when she heard from fellow science fictionist Beanne A. Jergman that Christine Maggiore was not HIV positive.

"I was outraged! Up until then we knew that denialism could be a co-factor in the development of AIDS. Prominent studies by Prof. J.P. Macaque and his Virus Veritas team had revealed multiple correlations between denialism and risk of premature death, or at least loss of job and funding. But with Maggiore our assumptions were clearly challenged by a case of HIV free slander. I was still outraged at this woman's cheek, testing positive then negative just to make science look bad, but I was also intrigued: Was this a unique case of shameless dissembling or were there more people like Christine Maggiore out there? The more I thought about it the more evident it became that our firmly established HIV/AIDS hypothesis was in need of another ad hoc addition. Then, while I was reading an unusually inspiring scientific article about Maggiore's despicable denialism, it struck me: Denialism itself must be caused by a transmissible virus, a Deadly Denial Virus"

http://medicine.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pmed.0040256

Posted by: Epidemiology-LISA | September 19, 2007 6:32 PM

Adso you mule, the answer to the culture question was a comedy by Aristophanes. Now why were the Bendictines so afraid of Aristophanes?

As for the interview, I'll have you know that, unlike so many others, Dr. Tit not only talks about talking about the science; she really explains it. See this snippet for instance:

"Like HIV, Deadly Denial Virus (DDV) can kill independently although they are most effective together", Dr Tit explains. "But in that case it's mostly remote controlled suicide in ethnically challenged bystanders via unexplained transduction of hypothetical signals traversing mysterious biochemical byways yet to be discovered by science. As is readily apparent, we have made enormous progress in understanding the fanaticism behind this disease although it may all seem a bit diffuse to the layperson. This is why I feel it's my duty to stoop and explain the science on my blog, faeciology.com, and other fine outlets. But as with most cutting edge science, it can really only be expressed via mathematical modelling. The by far most popular one with retrovirologists is the "tap and drain" model of DDV funding, essentially similar to the one used with HIV".

http://www.scientificblogging.com/hank/the_least_known_war_in_science_does_hiv_cause_aids

http://aidstruth.org/fanaticism.php

Posted by: Epidemiology-LISA | September 19, 2007 7:17 PM

Bar them! you must want to abolish the first amendment like your hero mark wainberg.......

Posted by: cooler | September 19, 2007 7:32 PM

cooler confuses Tara Smith's Aetiology blog with the United States government...but similar mistakes are common amongst supporters of conspiracy theorist Rupaul.

As a refresher for those, like cooler, who have forgotten their junior high school civics class, the First Amendment to the Constitution prohibits the federal legislature ("Congress") from, among other things, passing laws abridging the freedom of speech.

Perhaps cooler would like to tell us how Tara Smith's decisions about who and what to permit on her own private blog have anything to do with the Congress. (To make it easier, look up "Pruneyard"...but you're still going to need to explain the connection of the several states to the Congress and address the relationship of the internet and "public property.")

In any case, Tara has permitted dissenting views on this blog far in excess of anything I have ever witnessed on "rethinker" sites, including Liversidge's site, the rethinker message boards (which censor everything), and especially the jackbooted bozo Bialy's boring blog.

Posted by: ElkMountainMan | September 19, 2007 7:54 PM

WTF does Ron Paul's laudable stance on Iraq and the Patriot act have to do with the validity or otherwise of his stance on HIV? A person can be right on one issue and wrong on another.

Posted by: Obdulantist | September 20, 2007 1:25 AM

cooler -

Show me the statement, I will happily condemn it. I have absolutely no tolerance for anyone who argues against free speech, regardless of other agreed upon positions.

All that said, if this were my blog, ELISA would have been banned a long time ago. Actually, one of the reasons that I do very little posting on this topic, is that I have no tolerance for woo that kills, such as yours. Your own comments would likely be deleted out of hand. This is not because I have a problem with dissenting views, I have guest posts that I disagree with on my front page. It's just that yours are so vile and repugnant, that I have absolutely no interest in giving them any platform from which to be voiced.

I would still, without question, fight with everything in me, with everything that I am, for your right to say what you believe. Anyone who suggests that it should be a crime to say nearly anything, is just plain wrong. Honestly, I find the suggestion of legal restrictions on speech, outside of extremely narrow parameters to be almost as repugnant as the bile you so regularly spew.

Posted by: DuWayne | September 20, 2007 1:54 AM

If ELISA can pull herself out of the gutter for a few minutes she can respond to this post.

Does drug use cause AIDS

Posted by: Chris Noble | September 20, 2007 3:01 AM

Wow. Just... wow.

Denialists are nuts. They're all nuts. Seriously, are there any sane ones?

Why do you even bother to argue with them? I've got a better chance of convincing my neighbour that passing cars are NOT using lasers to mess up his tv reception.

Posted by: SmellyTerror | September 20, 2007 3:45 AM

Dr. Smith, a study should be performed on HIV+'s and AIDS person who do not take the meds and are healthy. However, some would not like the outcome. We would be proof enough that the current hypothesis is flawed and for the most part, this is just hype and a money-maker.

Posted by: noreen | September 20, 2007 7:06 AM

noreen said:

Dr. Smith, a study should be performed on HIV+'s and AIDS person who do not take the meds and are healthy. However, some would not like the outcome. We would be proof enough that the current hypothesis is flawed and for the most part, this is just hype and a money-maker.

Uhh, like the ones that already are being performed?

http://www.mgh.harvard.edu/aids/hiv_elite_controllers.asp

Do you actually look up anything on your own?

Posted by: apy | September 20, 2007 10:03 AM

You mean like...ohh I don't know..the first hit on pubmed?

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17720999&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

Again, do you actually look up anything on your own?

Posted by: apy | September 20, 2007 12:03 PM

Elisa,
calling people names like Dr tit etc kind of makes us look bad, duesberg, shyh ching lo scientists that have questioned the hiv hypothesis would never talk like that.

Wouldnt be suprised if aids inc is so desperate that they are hiring disinfo agents to make the "dissidents" look bad........

Posted by: cooler | September 20, 2007 1:45 PM

DuWayne,

I agree with you on the Constitution, but I also have a difficult time finding Wainberg "repugnant." I suspect that he has looked at all of the restrictions of speech in the United States (many of them involving comparatively trivial infractions) and wondered why denialism that results in deaths is not also restricted.

Consider all of the many, many ways in which the freedom of speech has been abridged in the United States. Consider, too, the many times when such restrictions have been upheld by the courts.

If I defame you, DuWayne, and you can prove harm, I will be forced to pay. That is a very real restriction of my free speech. Yet, what harm has been done? I have hurt your feelings, perhaps, and if you are in business and I've dissuaded clients from dealing with you, I've also damaged your business. But no one is dead.

Obscenity, too, is not fatal. Child pornography is usually not fatal. When anti-choice activists try to picket a doctor's private residence, they are not usually engaging in violence. Yet the law has ruled against all of these forms of speech.

A government employee who makes controversial statements about, say, religion, can be silenced constitutionally. The place and time of protected speech can be restricted constitutionally. But, again, no one would die or be harmed in any bodily way if these restrictions were not applied.

Commercial speech is highly regulated: false advertising is prohibited. Advertising cigarettes within a certain distance of schools is prohibited. The airwaves are under strict control.

If all of these restrictions were lifted tomorrow, I doubt that many people would die. Sadly, speech that has killed people--non-MDs giving medical advice to AIDS patients, amateur "experts" giving false information about a virus they know nothing about--is fully protected. If I walk down the street screaming obscenities, creating nothing more than a nuisance, I will be arrested. But Duesberg convinces a mother that all retroviruses are harmless, she surrounds herself with doctors who refuse to ask questions, and her child dies...and no one suffers a serious consequence.

That is what irked Wainberg. Truth be told, even if I disagree with his conclusion (involving the Constitution), it irks me, too.

DuWayne, why should obscenity be banned but my "right" to dupe my neighbor into stopping his meds and dying be protected?

Posted by: ElkMountainMan | September 20, 2007 2:20 PM

nope, tara you guys cant even provide us with the first scientific paper that hiv causes AIDS. In 1983 only a small group of idiotic scientists thought hiv might caused by a retrovirus (Gallo, essex, levy) , coming off thier failed retrovirus causes cancer program (how dumb can these people be, cancer isnt contagious!) they now told us their cancer virus was now the AIDS virus!

In 1985 everybody in the world thought hiv was the cause of AIDS.

Can you please provide me with this scientific paper printed in between these years that proved hiv caused AIDS, or was this ubiquitious consensus caused by politics and not science........................?

Please dont tell of the 20 years of confirmatory evidence that confirmed Gallo's partial correlation, barely detectable, 1/1000 blood tcells no animal model hypothesis, they all assumed hiv was the cause of aids, you cant confirm things you already beleive to be true, and design studies with that mindset, studies that would have been truly designed to test for verifying gallo's claim would have been designed totally differently (control for confounding factors)

Instead they kept extending the window period when no one got sick, made hiv species specific when mice/primates didnt get aids when inoculated..........talk about extending the goalposts to save a hypothesis!

See hiv fact or fraud. google it.

Read Project day lily. google it.
mycoplasma biowarfare program/ this microbe found in some aids cases/CFS kills every animal injected, most amazing book ever by two phd's scientists who uncovered a massive coverup.

Posted by: cooler | September 20, 2007 3:45 PM

Dear ElkMountainMan

Are you really sharing Wainberg idea ?

What about people living outside the US, would you also consider that they should not be allowed to propagate/ read/discuss "denialist" ** ideas ?

I was thinking not only the EU/Australia/Canada etc...but about people in China/India and mainly about Africa, where the majority of HIV+ people are presently living.

What about people who don't want to use ARV's for cultural reasons, for example many Chinese that I have spoken with, think that chronic diseases (not only AIDS) are better treated using traditional Chinese medicine than occidental medicine. They therefore would not accept such prohibition...

I also know that in Africa many persons go first to so-called traditional doctors. . This is likely to continue, and this may be the most important reason of the lack of use of ARV's in Africa, not, as some may be thinking, due to the existence of internet based "denialists" movements in the US/EU.

Both Chinese Traditional Medicine, Ayurvedic medicine and African traditional doctors use mainly herbal drugs, and it may be possible that some herbal drugs would have similar effect than LDN that Noreen reported, and may at least also prolong AIDS sufferers life as ARV's does, without ARV's secondary effects that Noreen reported.

It is unlikely that any internet prohibition in the US would have any major effect in these populations.

So dear ElkMountainMan do you think that people that living in the US/Canada should be allowed to have less information, and therefore less opportunities to solve their problems than the non-Americans/ non-Canadians?

As you look quite articulate in explaining your ideas, I am curious to read what you have to say.

----------------------------------

** I understand that part of the so called "denialist" ideology is proposing non-ARV's treatments for AIDS sufferers.

Posted by: Braganza | September 20, 2007 4:25 PM

Dear Braganza,

I appreciate your questions, and I would like to say that this is a very difficult legal question, one that I can't claim to address well for the United States, much less for the rest of the world. I'll do my best to give you my thoughts, though.

I do not share Mark Wainberg's idea, but I sympathize with his frustration. A large group of relatively harmless types of speech are banned in the United States--and their banning has been upheld by the courts, the arbiters of the Constitution--while medical lies that have led to deaths are protected free speech.

In my view, this is inconsistent. If libertarians in the United States wish to criticize Mark Wainberg's (free) speech on this, they act inconsistently with their principles unless they also oppose other restrictions of speech, such as laws against obscenity, child pornography, defamation, commercial speech, and...well, I gave a list in my previous comment. Many libertarians do oppose such restrictions. While I disagree with them, I cannot call them hypocrites.

In my view, Wainberg has the right to comment on the apparent hypocrisy under the law, and, in my view, this is an important issue, worth a serious conversation about whether enhanced legal protections are needed for vulnerable individuals. I, frankly, do not know the answer, but I do not think the Constitution needs to be changed. I think that the legal system can deal with medical lies on its own, and it usually does.

It's important to define what I mean by "medical lies," and I suspect "lies" is too narrow a term for what I mean. I would not classify the examples you give, Braganza--of traditional healers and herbal remedies--as being "medical lies" in the places where they predominate. But what about a traditional healer operating in an immigrant community in North Carolina? I'll throw up my hands on that one. I don't know; this is why we have courts...to decide difficult cases. To me, a medical lie is when an unqualified person poses as a health professional and gives out advice, or when a qualified doctor knowingly lies or does not adhere to a standard of treatment. Cases like these can be found in the courts every day, and that's why I don't favor changing the Constitution.

I don't speak for Mark Wainberg, but I get the impression that the behavior he opposes is restricted to just a few individuals in the "denialist" community: people such as Peter Duesberg who have the training and should have the common sense to understand what they are doing is wrong.

If a given individual has dispensed medical advice to AIDS patients who have followed that advice and died, that person could be sued. I don't know how successful such a case would be. I have corresponded with one person who was persuaded to stop HAART by a "dissident" with no medical training. There are many others. The success of a lawsuit in any case would depend partly on the fake "doctor's" knowledge.

Many "dissidents" are surprisingly uneducated about the topic they build their lives around, and so can hardly be accused of "lying." They believe what they say. But some dissidents are so well-versed in the literature, yet insist so strongly on lying about it knowingly, that their deception would be obvious in court.

I'm probably wrong on some of this, and it could well be that laws (not the Constitution) would need some changing before any hope of a successful lawsuit against the more malicious, knowing "denialists."

To conclude, I hope that some of you can agree with me on the following example:

Cigarette companies have been prohibited from advertising over the airwaves in the United States. In some countries, all tobacco advertisement is banned. The purpose is to protect public health. I'm not opposed to this, but it's worth noting that it is a restriction on "free speech," and much more widespread than what Mark Wainberg has proposed.

Which is closer to a "clear and present danger"--cigarette ads or AIDS denialism?
Cigarette ads encourage behavior that may kill in decades.
AIDS denialism encourages behavior that may kill in months or years, depending on the patient.

Which is more deceptive--cigarette ads or AIDS denialism?
At least in the last few decades of their runs, cigarette ads could not imply health benefits from smoking.
AIDS denialism, in contrast, not only states that going off ARVs is healthy, it says that ARVs are the cause of AIDS, and does so by knowingly ignoring the many studies showing the benefits of ARVs, in some cases actually distorting and lying about those studies.

Which has a more captive audience?
Cigarette ads were targeted broadly.
AIDS denialism is targeted at affected individuals, often people who are sick and understandably desperate for answers, vulnerable.

Which can be restricted under the current commercial speech laws in the USA?
Cigarette ads, obviously.
AIDS denialism--in many cases, in my opinion should be. "Rethinkers" make money from the vulnerable people they exploit; their propaganda could be, but often is not, restricted under commercial speech regulations.

I think there is room for improvement in protecting vulnerable patients in the United States from the predatory practices of the AIDS denialists, but I think this can be done within the existing system.

There's a legal doctrine, I can't remember the name of it right now, about imposing the least harmful way to achieve the desired effect. Better education of the public (or individuals) by science educators is certainly less harmful than lawsuits. If legal action ever happens, and I doubt it will, it should focus on the knowing lies of the denialists, not on restricting free speech.

Posted by: ElkMountainMan | September 20, 2007 6:59 PM

Funny, I must have missed the scientific discussion in your latest articles Dr. Smith.

I'm still waiting for any rational response to my earlier post.

Does drug use cause AIDS

In all the whingeing and whining about censorship you seem to forget that the collective response from the "dissidents" has been "Everyone knows that Ascher was Tony Fauci's well paid buttboy and pet lapdog..."

Nobody is censoring you here and yet the best you can come up with is calling people names like "Dr. Smearah Tit".

Accompanying every right is a responsibility.

Posted by: Chris Noble | September 20, 2007 8:03 PM

This free speech issue is crazy, its about personal responsibility. If Duesberg or any other scientist advocated drinking gasoline and an adult did it, the person dumb enough to follow that advice is to most to blame.

Of course the person drinking the gasoline has reposibility for his own actions but if Duesberg tells people that drinking gasoline is not only safe but beneficial then he is also partly responsible.

Duesberg told Raphael Lombardo that if he didn't take recreational drugs or antiretrovirals that he wouldn't get AIDS. Raphael didn't take recreational drugs and he didn't take antiretrovirals and yet he still got AIDS. To make matters worse Duesberg accused Raphael of lying after he was already dead and not able to defend himself. Duesberg is personally responsible for the eventual outcomes of his actions.

Professional Responsibilities of biomedical scientists in public discourse

Posted by: Chris Noble | September 20, 2007 8:54 PM

ElkMountainMan -

Actually, it is very, very hard to actually sue for defamation, thanks in large part to Larry Flynt. As for obscenity laws, they are being struck down left and right, something that I strongly support. The right to protest, has unfortunately suffered in very large ways over the last few decades, something that I find horribly disturbing.

Child porn is a whole different ball of wax. There is real harm being perpetrated in the production and to an extent with the dissemination of such materials. While it usually isn't fatal, it is nothing short of rape, something that is definitely illegal and bloody well should be. It is not speech, it's an act of violence, rape and degradation.

I should be clear, that I am not saying that Wainberg is himself repugnant, I have not heard enough of his views to really judge that. But what he says about speech most certainly is. Just because there are unacceptable laws restricting speech in the U.S., does not justify more restrictions.

Posted by: DuWayne | September 20, 2007 10:15 PM

Chris, you piece of shit liar, you act as if Duesberg had somehow led this guy around by the nose. Lombardo had decided NOT to take AIDS drugs 10 YEARS before he ever heard of Duesberg. Lombardo HIMSELF chose not to accept standard treatment. Lombardo HIMSELF witnessed the deaths of those he knew who took AZT.

And as for his death, Chris, please take note of all of the emotional pain and INTENSE STRESS AND LONELINESS that Ralph endured.

For being gay. (shamed and guilted)
For being gay in the military. (shamed and guilted)
For being diagnosed as HIV poz.(stressed, panicked, rejected, shamed and guilted)
For NOT taking meds.(stressed, with projections of death put on him regularly)
For losing those close to him.(major grief)
For not having a lover.(loneliness)

And a thousand other reasons that you, Chris, know nothing about. You do not know what he went through, and you do not know what he suffered emotionally.

Ralph was another gay man, who had an intensely stressed and intensely emotional difficult life.

And YOU CHRIS NOBLE, are nothing but a simple minded ass-wipe know-it-all who knows nothing about anything!

Posted by: Michael | September 20, 2007 10:43 PM

In the words of Ralph Lombardo himself: "Remember, this was 1985, a time when HIV was called the HTLV III virus and anything and everyone associated with it meant complete and utter doom (physically, spiritually, societally, politically, etc...."

Yes Ralph, that was 1985, and ten years later nothing had changed, and even now 20 years later little has changed as the world continues to heap upon us death, and disease, both physical, spiritual, societal, and political.

I dedicate my own efforts in this very thread, to wake the world up from its own self perpetuating and self creating disasters, to the late Raphael Lombardo, who succumbed nearly 10 years ago of the stress and pain that was heaped upon him as a gay man, and as someone diagnosed as HIV positive, who was simply struggling to live and to love and to serve and to be free in a world that projected nothing upon him but rejection, shame, guilt, grief, fear, sickness and projections of inevitable death.

Posted by: Michael | September 20, 2007 11:38 PM

Those last four comments were awesome. And by awesome I mean drop-dead hilarious. Thanks for the entertainment, Michael.

Posted by: Tyler DiPietro | September 21, 2007 12:25 AM

Unbeknownst to any of you, the reality is that she died from AZT poisoning:

Of course it is unknown to me because it is not true.

Bergalis meanwhile sought medical care at the University of Miami, where she was treated with an unidentified "experimental" method. Certainly this was the appropriate place for such therapies. Margaret Fischl, the head of the Phase II AZT trial, worked at that medical center, which had served as one of the twelve facilities sponsored by Burroughs Wellcome for the study. So Bergalis was prescribed AZT.

Suddenly she started a precipitous decline in health. ...

I've already been through this several times.

Bergalis had systemic candidiasis, severe weight loss, PCP and a CD4+ count of less than 50 before she was diagnosed with HIV infection let alone prescribed AZT.

Bergalis perfectly healthy before AZT?

You've fallen for another one of Duesberg's lies.

How does AZT travel backwards in time to cause AIDS before it was taken? Bergalis would probably never have been tested for HIV infection if she hadn't been extremely ill in the first place. So the diagnosis cannot have been the cause of the illness.

Raphael Lombardo's letter says the same thing:

My personal suspicion is that these individuals were not aware of their HIV status until they started experiencing physical complications.

The same thing is still true today. A large proportion of people are only diagnosed with HIV infection when they turn up in hospital with AIDS.

Posted by: Chris Noble | September 21, 2007 12:44 AM

From the virusmyth webpage that Michael cited.

In London HIV­ positive male homosexuals ar risk for AIDS formed a survivor group called "Continuum." In August 1993 there was no mortality during 1.25 years in all 918 members of that group who had "avoided the experimental medications on offer" and chose to "abstain from or significantly reduce their use of recreational drugs, including alcohol." (105) Assuming an average ten­year latent period from HIV to AIDS, the virus ­AIDS hypothesis would have predicted at least 58 (half of 918/10 x 1.25) AIDS cases among 918 HIV­ positives over 1.25 years. Indeed, the absence of mortality in this group over 1.25 years corresponds to a minimal latent period from HIV to AIDS of more than 1,148 (918 x 1.25) years. As of July 1, 1994, there was still not one single AIDS case in this group of 918 HIV ­positive homosexuals. (106)

Apart from the shocking maths (where's Darin Brown when you need a mathematician?) something else should stand out. What happened to the editorial staff of Continuum? They all died of AIDS! Huw Christie. Jodie Wells. Is Duesberg going to rethink his position? No they all must have been liars.

Why do you guys worship Duesberg? You should realise by now that if you are HIV+ and you follow his advice and don't take antiretrovirals or recreational drugs and yet still progress to AIDS and die then Duesberg is going to lie about you when you're dead.

The man deserves nothing less than contempt.

Posted by: Chris Noble | September 21, 2007 1:12 AM

"The man deserves nothing less than contempt."

The only one that deserves contempt here, Chris, is YOU!

The only things you have EVER PRESENTED to us in the last few years, Chris, are rants, screeds, easily picked apart and easily exposed as lacking any substance, very circumstantial, very flimsy, very third hand, very he said-she said, very conflict of interest filled and are also full of nothing but your own projections of your own hatred, homophobia, rascism, germaphobia, paranoia of aids and the projection at others of your own hypochondriacal illness.

Go fuck yourself.

Posted by: Michael | September 21, 2007 1:42 AM

"Yes, emotional pain and iatrogenic illness and societal projections of sickness and death are quite humorous, now aren't they?"

When I can numb the empathy enough, hell yeah!

But on the other hand, no, that's not what I intended. I was thinking more along the lines of hysterical cranks tossing around borderline accusations of murder to an online community.

Posted by: Tyler DiPietro | September 21, 2007 1:48 AM

"Duesberg's claim that she was perfectly healthy before taking AZT is a complete lie."

Strange Chris, but I have never seen where Duesberg claimed she was "perfectly healthy" before taking AZT. Perhaps you will show us the quote, and where exactly it is to be found, other than in the dark recesses of your own imagination.

On the other hand, the now verified "truth" is, that Chris Nobles's claim that Kim Bergalis had a low CD4 count of 50 before being diagnosed as HIV positive, is absolutely, as you yourself even just admitted, was a complete lie.

Hmmmm. Who should I believe more, Chris or Dr. Duesberg? Hmmmm.....

Posted by: Michael | September 21, 2007 2:28 AM

And Chris, you lying piece of shit. You lie and said before she was HIV diagnosed that she had wasting, PCP, systemic candidiasis, Low CD4 counts (when nobody EVER took her count before being diagnosed as HIV!)

Have you read the article? She had candidiasis, weight loss, hair loss and PCP before she was diagnosed with AIDS or tested for HIV.
The pneumonia wasn't just any pneumonia it was PCP. Duesberg lies about Bergalis in "Inventing the AIDS virus". Duesberg claims she was perfectly healthy before taking AZT. All of the symptoms that Duesberg ascribes to "AZT posioning" occurred before she took the drug.

Only when the crisis passed and tests revealed that she had pneumocystis pneumonia, typical of AIDS patients, did the doctors treating her suggest she be tested for HIV infection.

If you are going to accuse me of lying then try to get your facts straight.

Posted by: Chris Noble | September 21, 2007 2:53 AM

Actually, the virus theory of cancer goes farther back to Royal Rife and a collegue of his, Virginia Livingston, who publicly acknowledged the first cancer virus. I think that Gallo and others may have been on the right track but with their closed minds in other areas such as pleomorphism were not able to duplicate results that had already been proven.

Yes, no one wants to give up the gravy train so they all play the game and assume that HIV causes AIDS. If AIDS went away so would their funding. They may be unethical but not stupid. In the interim, the patient suffers from the grade four events, side effects from the long-term use of the meds. Thank you Tara as you are helping the world to see the truth!

Posted by: noreen | September 21, 2007 6:07 AM

Chris, do you think that the mere suggestion implanted into Kim's psyche that she had several years to live could manifest itself into several illnesses such those ones she complained about?

Your timeline seems a bit skewed here carter. Are you suggesting that stress can travel back in time and make someone sick (with fairly classic AIDS diseases) which then causes the diagnosis of stress that caused the diseases which then goes back in time and make someone sick ...?

Are you saying that she was not sick prior to being diagnosed as HIV+ and with AIDS?

If you went into a hospital with a runny nose, cough, and phlegm and were diagnosed with a cold, would you then conclude that the diagnosis of a cold was the reason you originally felt sick?

Posted by: apy | September 21, 2007 9:34 AM

If you went into a hospital with a runny nose, cough, and phlegm and were diagnosed with a cold, would you then conclude that the diagnosis of a cold was the reason you originally felt sick?

No, stupid. Now, have a strong coffee, wake up and think. If one goes into a hospital with a running nose, is diagnosed with AIDS and falls severly ill, after the shock of the diagnosis and the life-saving killer-drugs, then one may reasonably presume that something else than "The initial running nose caused a severe disease".

But I guess you'll never understand that because you simply don't want things to be like that. Thus it's not stupidity but something else that keeps you looking away from where you should look. Sorry for the No, stupid. It makes no sense. Sorry.

Posted by: jspreen | September 21, 2007 10:20 AM

No, stupid. Now, have a strong coffee, wake up and think. If one goes into a hospital with a running nose, is diagnosed with AIDS and falls severly ill, after the shock of the diagnosis and the life-saving killer-drugs, then one may reasonably presume that something else than "The initial running nose caused a severe disease".

This goes a whole lot faster if you actually pay attention to the thread jspreen. The use of a runny nose was what people in the English speaking world refer to as an "analogy". The claim is not that someone came in with a runny nose and was diagnosed with AIDS and then all the AIDS symptoms came up magically after that diagnosis. No, it is that they came in with symptoms that suggest AIDS (such as PCP), and was then tested and determined to have low CD4+ count and HIV+ with high viral load. This means that the AIDS like symptoms came before the diagnosis of AIDS, which makes them rather difficult to attribute to the diagnosis.

The question is if this is the timeline that actually happened, which there appears to be some dispute about but as usual AIDS rethinkers try to push the conversation in a new direction without answering questions.

Posted by: apy | September 21, 2007 10:29 AM

Yes, in a certain way it's exactly that. But if you wish you can replace runny nose with anything you want, it doesn't matter.

No, it's completely different. One is saying someone comes in with an illness, gets diagnosed with another illness and comes down with the symptoms of the other illness. The other is saying someone comes in with the symptoms of an illness, and is diagnosed with it.

Telling a person has Aids is just arbitrary.

No, it is based on a series of tests that give specific results and these results are then used to determine if someone has a particular disease. You can disagree with the tests if you desire, but the diagnosis is based off these tests, not arbitrary.

Posted by: apy | September 21, 2007 10:56 AM

Diseases have not changed, what you call "AIDS symptoms" is nothing new but before nobody called them "AIDS symptoms".

So it is your belief that all diseases have come to their final resting point in terms of what they do and how?

Is it fair to come to the conclusion that you do not believe in evolution as well?

Posted by: apy | September 21, 2007 11:27 AM

So it is your belief that all diseases have come to their final resting point in terms of what they do and how?

Of course. But if you introduce new elements in the system you may have the impression that something has changed. Like car accidents were quite rare in the middle ages. But the broken bones are the same, whether you were hit by a horse, an axe or a car. Today people see things they never saw before, with a electronic microscope for instance. But what they see is not new.
Isn't it remarkable, the virus-shit hitting the fan just now we can have a closer look to microbes? Millions of years have past by but HIV waited for modern techiques and chose 1981. Of course. Like no TV stars before the 2Oth century.

Posted by: jspreen | September 21, 2007 11:40 AM

I guess it is of no use whatsoever to point out to the denialist crowd a nice review article that came out recently in Immunity, about HIV Controllers, and mechanisms of durable virus control in the absence of antiretroviral therapy (Immunity, Volume 27, Issue 3, 21 September 2007, Pages 406-416 by Steven G. Deeks and Bruce D. Walker). The denialists and crazy conspiracy theorists won't be convinced by any rational argument anyway, but long-term survivors like Noreen may understand better that they happen to belong to a small, but extremely fortunate, subset of HIV infected people, in whom in vivo attenuation of the virus, host genetics and innate immunity - singly or in combination - may provide the benefit of long-term survival, even without anti-retrovirals. It is a pity that Noreen has decided to join the throng of the denialists, but in reality, studying people like her - the so-called HIV controllers - offers an excellent and exciting opportunity to understand the nuances of the physiological defences and therapeutic options against HIV infection and AIDS.

Posted by: Kausik Datta | September 21, 2007 1:24 PM

Ben,

Nobody is ignoring Kimberly Bergalis's treatment with AZT. The only ones ignoring the facts are the Denialists, who continue to ignore that Bergalis had a severe immune deficiency with Pneumocystis pneumonia prior to being diagnosed with AIDS and prior to being treated with AZT.

You are so lacking in compassion and ignorant of the facts that as you mock her you claim Bergalis's case was unique:

Little Kimberly -- the only person in the world to allegedly get HIV from a dentist(!) was a nice, little casualty that helped scare small-town America (everyone is at risk!) and grease the wheels of government funding.

To you AIDS victims are objects of scorn simply because their deaths are the inconvenient reality that you are so desperately trying to deny. The facts mean nothing to you:

The Associated Press, Sat, 17 Dec 94

Dentist AIDS Victim Dies

STUART, Fla. (AP) -- The fourth of six people infected with the AIDS virus by a dentist died Saturday. Barbara Webb, 68, slipped into a semi-coma earlier in the week, according to Hospice of Martin. She died on her 45th wedding anniversary to her husband, Robert. "She was never bitter about her death," said hospice counselor Pam Jett. "She didn't dwell on the future, she lived in the present." Two years ago, a federal study concluded that six of Dr. David Acer's patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus. Acer, of Jensen Beach, Fla., died in 1990. He is the only health professional ever known to have transmitted HIV to his patients. Among those infected was Kimberly Bergalis, who waged a crusade for mandatory testing of health care workers before she died in December 1991. Webb, a former high school English teacher and grandmother of eight, gave dozens of speeches nationwide about living with AIDS. She was the teacher of the year in 1986-87 at Martin County High School. Webb is survived by her husband and three grown children.

Posted by: Franklin | September 21, 2007 2:56 PM

Franklin, please do EXPLAIN to us, just how a dentist transferred his own strain of your beloved HIV to six of his patients.

Two years ago, a federal study concluded that six of Dr. David Acer's patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus.

Baffled? BAFFLED???? STILL FREAKING BAFFLED?????? Only the simplest of minds could yet be baffled by this.

What is so baffling about scaring six people plus the dentist into taking and dying of high dosage AZT monotherapy iatrogenic poisoning in the late 80s?

Poor baffled and conflict of interest laden Franklin, please unbaffle us so we can rejoin you and the rest of the the faithful believers in HIV.

Franklin, you must explain this great mystery of life to us.

Now tell us. How did the naughty disgusting HIV infected bad ole boogeyman dentist transfer HIS OWN STRAIN OF HIV to his patients?

Did he have anal sex with his patients including the grandma?

Did he have his dental instruments up his ass just before cleaning their teeth?

Did he drool blood into their mouths?

Did he fail to sterilize his bloody instruments that he must have just used on himself to have transmitted his own supposed virus to the patients?

Until you explain how Acer transmitted the virus to 6 of his patients over a vast period of time, you are to be considered nothing but a cornflake swirling through the clouds of a still mass hysteria driven false belief system.

The indisputable fact is that HIV fails every scientific test to be called the cause of AIDS, including Koch's Postulates, Farr's Law, the first epidemiological law of viral and microbial diseases, cluster formations, and
even the definition of the word 'infectious' itself - tried and true criteria that have been in use in medical research for decades, but are now discarded to support the theory that HIV=AIDS.

Posted by: Michael | September 21, 2007 3:20 PM

Franklin, please do EXPLAIN to us, just how a dentist transferred his own strain of your beloved HIV to six of his patients.

Two years ago, a federal study concluded that six of Dr. David Acer's patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus.

Baffled? BAFFLED???? STILL FREAKING BAFFLED?????? Only the simplest of minds could yet be baffled by this.

What is so baffling about scaring six people plus the dentist into taking and dying of high dosage AZT monotherapy iatrogenic poisoning in the late 80s?

Poor baffled and conflict of interest laden Franklin, please unbaffle us so we can rejoin you and the rest of the the faithful believers in HIV.

Franklin, you must explain this great mystery of life to us.

Now tell us. How did the naughty disgusting HIV infected bad ole boogeyman dentist transfer HIS OWN STRAIN OF HIV to his patients?

Did he have anal sex with his patients including the grandma?

Did he have his dental instruments up his ass just before cleaning their teeth?

Did he drool blood into their mouths?

Did he fail to sterilize his bloody instruments that he must have just used on himself to have transmitted his own supposed virus to the patients?

Until you explain how Acer transmitted the virus to 6 of his patients over a vast period of time, you are to be considered nothing but a cornflake swirling through the clouds of a still mass hysteria driven false belief system.

The indisputable fact is that HIV fails every scientific test to be called the cause of AIDS, including Koch's Postulates, Farr's Law, the first epidemiological law of viral and microbial diseases, cluster formations, and
even the definition of the word 'infectious' itself - tried and true criteria that have been in use in medical research for decades, but are now discarded to support the theory that HIV=AIDS.

Posted by: Michael | September 21, 2007 3:26 PM

Hey Elk. Same question to you as well?

How did the evil dentist transfer his own strain of HIV to 6 patients?

It is obvious to all but the deluded, upon looking at this very case, that only a hysteric and panicked mind could rationalize itself into believing or making anything sensible out of this.

Hey Elk, ever consider that in believing such nonsense yourself, that your overactive imagination is simply trapped by its own living nightmares that upon anyt rational inspection are obviously composed of completely irrational nonsense?

If you were deluded, how would you even know?

Certainly looks to be the case to me.

Until you figure it out, please do explain, along with Franklin, just how the doctor, over quite a period of time, gave six of his patients, including the Grandma Franklin presented above, his very own genetic strain of HIV?

Personally, I think the buttf**k option is the most intriguing and rational choice to me! But then again, I am gay!

Posted by: Michael | September 21, 2007 3:53 PM

Michael,

Let's start with what we know about Bergalis. We know that Kimberly Bergalis was infected with HIV and died of AIDS.

How did Bergalis contract HIV? That, we don't know. I don't know, and neither do you. The CDC report found similarities between the virus recovered from Bergalis and other infected dental patients and HIV from the dentist, David Acer. These similarities were not found in other HIV+ persons in the surrounding community. Later reports disputed these findings. Acer's insurance company and the referring insurance company both found the evidence for transmission convincing and settled suits with Bergalis.

But that's not proof. I'm not sure if we will ever know how Acer's patients were infected. Some have alleged that Bergalis herself was not a virgin, that she may have been infected during sex but refused to admit it for religious and family reasons. Maybe they're right.

A motive for intentional infection by the dentist has also been suggested. James Dawes reports in Narrating Disease: AIDS, Consent, and the Ethics of Representation (Social Text, 43, 27-44) the concerns of Acer's friend Edward Parsons. According to Parsons, Acer was frustrated with the public perception of AIDS as a "gay disease" and the resulting inaction on the part of the government. Acer once said something would only be done "when it starts affecting grandmothers and younger people." Grandmothers like Ms. Webb, who died at 68? Younger people like Bergalis, who was allegedly infected at 19? If Acer indeed transmitted HIV to his patients, it was no accident.

I'll agree with you on that, Michael. There's no conceivable way for a dentist following proper procedures to infect a patient...other than injecting her with infected blood (or having sex with her, which the investigators ruled out...but who knows?). The motive appears to be present: Acer wanted to force a more effective government response to the spreading AIDS pandemic. But of course that doesn't mean he really did it.

However Bergalis got infected, it's a matter of public record that she developed several AIDS-defining illnesses before being tested, and that she died despite (not because of) subsequent medical treatment.

Here's something you might be able to help me with, Michael: did Dr. Acer commit suicide? Media reports state that he died of AIDS, but word on the rethinker street (especially in the Chicago area) is that he killed himself, hounded by the media and government. Is this true? Are there any records? Thanks.

Posted by: ElkMountainMan | September 21, 2007 4:18 PM

Michael,

You continue to heap scorn on the dead who are unable to defend themselves.

How that makes you feel better about the gravity of your situation is beyond me.

But as you said:

You know it has oft been said that "the truth hurts". Sometimes the truth hurts so much that people, or at least their egos, go right into escapism, denial, anger, humor, and a lot of other interesting but quite human egoic responses

"Interesting" wouldn't be my first choice to describe your "egoic response," but then again psychopathology has never been a primary interest of mine. You are just a sad case.

Here is a serious discussion of the case of the Forida dentist, for any who are ineterested.

Posted by: franklin | September 21, 2007 4:26 PM

Elk. You said:

"Let's start with what we know about Bergalis."

Good idea. That means we empty our minds of all preconceived beliefs and start back at the beginning, and ADMIT, that in reality, we KNOW NOTHING FOR SURE.

Then you said:

"We know that Kimberly Bergalis was infected with HIV and died of AIDS."

No Elk, you are jumping the gun here. You are putting the cart before the horse. In reality we DON"T KNOW such. You only "believe" such, and "presume" such to be true.

But your ego fails to allow you to view anything from such a perspective. See Elk, I really do understand you and how your mind operates.

Further down you even ADMIT that you do not know.

Then you go on to suspect the victim had sex with someone who just so happened to have HIV. Yet heterosexual sex is quite verified by Nancy Padian to result in HIV transference in less than 1 out of a thousand episodes. And for all we know, it is 0 out of a thousand, cause Padian noted zero transfer in sero-opposite heteros.

Then you want to jump, like a Mexican jumping bean, to accusing the dentist of intentionally giving people HIV. No proof, just your bit about someone said that someone said that Acer had motive to intentionally infect someone.

Yet, the simplest explanation, and by far the most rational, is that you sir, unbeknownst even to your own self, are seemingly quite delusional.

And if Acer did commit suicide, certainly it would be no surprise that he was driven to such, by those such as even your very own self, and others such as Franklin, and all those who pursue their "witch hunt" of unverified, unsubstantiated, unproven, and irrational accusations.

So which was it, Elk, was Kim a hooker, a drug addict, a slut,

or was she simply an emotionally overwrought stressed young women, as she herself admitted, who was already susceptible to illness, and perhaps even further susceptible to suggestion of death, and sickened by her own negative focus on what she believed was to be an inevitable death by AIDS.

Was the dentist really an evil heartless killer, or was he too falsely accused and driven to sickness or death, or even to suicide by being caught up in the frenzy of the witchhunt and frenzy of mass public hysteria at that time?

Now Elk, be sure to also carefully explain to us how HIV caused grandma to slip into a coma. Cause I swear, that the HIV retrovirus is so cunning, it can undoubtably jump through flaming hoola hoops while dancing, singing, and drinking a martini and all the while being actively involved in the cell by cell cellular destruction taking place in ones mind.

Posted by: Michael | September 21, 2007 4:50 PM

Apy, are you HIV+ or have you had AIDS? I would not be so fast to throw stones at others. I had AIDS so therefore I do have some experience in the matter. You believe studies yet some of you will not listen to those of us who have the disease. I have lived almost two years without the antiretrovirals and haven't had one opportunistic infection. Therefore, I don't need either side to convince me of anything as I am living proof that it can be done. So both sides can argue this until hell freezes over and I will not change sometime that is working quite well for me!

Posted by: noreen | September 21, 2007 5:01 PM

Elkmountainman,

You write:

Let's start with what we know about Bergalis. We know that Kimberly Bergalis was infected with HIV and died of AIDS.

You are so fucking stupid it boggles the mind! Do you understand what the word "know" means? You don't "know" either of those 2 things, for chrissake!

Here's what "we" (I hate to lump myself in with you) know:

1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV

3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

4. Kimberly Bergalis died.

That's what we know, Einstein. Now, you can begin your analysis.

I swear, Elkmountainman and Franklin have to be 2 of the dumbest bastards on planet earth.

Posted by: Ben Gorman | September 21, 2007 5:29 PM

jspreen:

The guy just realized that a person like Noreen is one of the pillars of the Aids rethinkers movement so now he smears honey all around to attract her over into his camp.

Most other denialists here are hopeless. Elkmountainman, you are wasting your breath. None of them understand the concept of AIDS defining illnesses; an example is Ben Gorman's illogical post. All he had to do is put his (2) before (1), which would have represented the actual course of events. But no, that would upset his apple-cart, wouldn't it?

I have worked with scores of patients of PCP, cryptococcosis, cryptosporidial diarrhoea, MA complex, recurrent salmonella septicemia, among others (all of which have come under WHO's AIDS defining illnesses), and as a matter of routine, testing for HIV was recommended. Almost all of them turned out to be HIV+. Initiation of anti-retroviral therapy, along with supplemental anti-microbial therapy as necessary, saved the lives of many, many of these patients. HAART has changed the spectrum of our fight against AIDS across developed and developing nations, helping millions of people to live their lives despite HIV infection.

And I am expected to believe the ill-informed, misguided (often fraught with outright lies) denialist bullsh*t from a few crazy crackpots? They can live in their corner and wallow in their conspiracy theories for all I care. But that does not change the reality, the benefits of proper anti-retroviral therapy that can truly make a difference in people's lives.

Posted by: Kausik Datta | September 21, 2007 6:17 PM

Noreen, no one (particularly the much-maligned HIV researchers) has denied the effect of psychological status on health. The paper that Michael Geiger cited with great flourish simply says that certain psychological conditions, including depression, can suppress the overall immunity of the body. Studies like these have been around for quite some time, ever since the interface between psychology and sociology began to be explored better. Positive attitude and good, clean living (though I am not sure exactly what you mean by 'good, clean' living) are attributes which predispose one towards good health. But if you have an infection, just like any other infection, it needs to be treated - particularly an infection like HIV, which shanghaies body's own defence mechanism.

By your own admission, you are a long-term survivor not on meds. Rather than using crackpot ideas to bolster an illogical hypothesis built on foundations of lies, wouldn't you rather try to find out more about how exactly your body managed to ward off the virus? Doesn't that prospect excite you at all?

Posted by: Kausik Datta | September 21, 2007 6:26 PM

Antiretrovirals can help when one is being attacked by many diseases as I had many of the AIDS defining diseases. I have been on both sides of the fence. The problem that I have with them is the long-term use or for the rest of one's life use of them. Ideally, they would be used when the patient has symptoms, which may not respond to traditional treatments, then stopped when the patient has managed to restore health thus eliminating all the nasty side effects of these drugs.

Posted by: noreen | September 21, 2007 6:30 PM

Ben,

Are you a solipsist? That would explain how we don't really "know" anything. Truthfully, I never met Kimberly Bergalis, so I don't really "know" she existed. I never met David Acer, so I don't "know" that he existed. I have never observed the solar system from somewhere in the Kuiper Belt, so I don't really "know" that the earth goes around the sun. I have never been to Alaska, so I don't "know" that Alaska is real.

But back to reality...you claim that,

1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

Actually, Kimberly Bergalis tested positive for both nucleic acid sequences that are unique to HIV AND for antibodies to HIV-specific proteins. As you may or may not know, HIV proteins are encoded by those HIV-specific sequences, which are found only in HIV-infected people.

2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV

Actually, Kimberly Bergalis developed several conditions that, taken together, are only found in severely immunocompromised individuals. Before being diagnosed with HIV, she almost died of PCP, a condition that was almost unheard-of outside of chemically immunosuppressed patients before the AIDS era. The challenge to you, Mr. Gorman, is to find a single person who is not a drug addict, a cancer patient, or a transplant recipient, but who displays all of Bergalis' symptoms in the absence of HIV. Perhaps someone could even put up a $50,000 prize as an incentive for you!

3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

Your wording is vague, so I'm not sure what you're getting at. AZT can cause anemia, depletion of neutrophils, and myopathy. These are not, by themselves, AIDS-defining conditions.

4. Kimberly Bergalis died.

Right. More specifically, she died of AIDS. Or are you perhaps a qualified pathologist who has reviewed her autopsy report and wishes to issue a "differential diagnosis?"

Posted by: ElkMountainMan | September 21, 2007 6:35 PM

No Noreen, you are slightly mistaken here. The symptoms that you mention (for example, the ones you had) are often related largely to the underlying super-infection. People have mentioned PCP and candidosis here. But there are many others. When HIV infection undermines the body's immunity, it basically becomes a petriplate for diverse organisms (some which are normally avirulent) to grow and cause disease. Which is why it is also important to treat HIV infection at source, and currently anti-retrovirals (ART) are the best options we have for that purpose.

But I also agree with you that many individuals react adversely to ART, if not immediately, over a period of time. Not only ART, all pharmacological substances that one takes are processed by the liver, and pass through kidney. Therefore, these are the major organs that are always involved in drug metabolism. So, patients on ART need to be monitored from time to time for dysfunctions occurring in any of the major organs. Think about what happens in chemotherapy or radiotherapy; it also has certain side-effects, but they are mostly reversible.

However, the risk-benefit ratio analysis shows that since secondary symptoms of physical discomfort can be treated separately, it is much better to start an HIV+ person on ART than not. The point that you raise is a valid one, that researchers need to find out about further modifications (newer generations) of ARTs that may be more targeted, or interact less non-specifically, thereby causing less side-effects. But till scientific research (yes, the same research that is the bane of denialists' existence) finds out a better alternative, the current therapies are our best available option.

The tapering off of dosages etc, that you mention are routinely done for many medications, including ARTs.

Posted by: Kausik Datta | September 21, 2007 6:45 PM

My own doctors do not "taper" off of medicines as you put it but it would seem to make more sense. I would disagree that radiation side effects are reversible as I have had that too. Think about this, we would never give radiation
and chemotherapy long term, yet we give chemotherapy to HIV persons this long term. This is what I have heartburn with, especially since there are better options out there such as, Low dose naltrexone. Don't hold your breath on the drug companies pushing this harmless and effective drug though because the patent has long expired and much more money is made selling antiretroviral medication.

Lastly, I don't believe that HIV is capable of all that it is given credit for especially since too few can be found in the patient in the first place.

Posted by: noreen | September 21, 2007 6:57 PM

The reason that I am extremely healthy is that I eat right, exercise, normal weight, positive attitude, take supplements and LDN, which is the secret to warding off the horrible opportunistic diseases, which causes harm to AIDS persons. Stopping or curing AIDS is no great secret. Anyone can do it with a little work on their part.

Posted by: noreen | September 21, 2007 7:02 PM

I have yet to have HIV isolated from my body. Having antibodies is not the same as having an active virus. Those of you who believe in HIV, surely you should look into low dose naltrexone, which has been successfully used to treat AIDS persons. Even if it has been isolated from the body that in itself does not prove that it causes AIDS.

Posted by: noreen | September 21, 2007 7:26 PM

So I am irrational because of my beliefs and because I am healthy. You folks are irrational and cannot get beyond HIV and antiretrovirals. Duhh, LDN works to PREVENT the infections, of course if one has them then they would need to be addressed. There again, practice what you preach and do some reading about LDN before you condemn it.

Posted by: noreen | September 21, 2007 7:34 PM

So, it the same old argument, HIV causes AIDS, HIV cause AIDS, HIV causes AIDS. What if it doesn't then what are you folks going to say? Did you know that Merck dropped its vaccination program for AIDS. Why hasn't one been effective? Could it be that AIDS is basically a life-style, cumulative medical issues, environmental issues, etc.? It's very possible and probable. That's why more and more are dropping the meds and are living normal lives. If HIV was so deadly, then we could not do this.

Posted by: noreen | September 21, 2007 7:42 PM

No, Noreen, one major problem in failure of vaccination programs is HIV's ability to mutate rapidly, and thereby change the target against which vaccination is going to work. If it had been a larger organism, say a fungus, bacteria or parasite, it would have been easier since there would be a number of targets to look for; if one did not work, possibly another would. But that is not the same with a relatively structurally simple (yet profoundly functionally complex) organism such as HIV.

What of Merck... Did you know that vaccines effective against HIV strains prevalent in the United States did not work as effectively against HIV strains prevalent in some parts of Southeast Asia? The virus's functional complexity is amazing, and therefore, vaccination efforts are not going to be so easy to direct against HIV.

But wait, aren't there people of your ilk who say vaccination of any sort is injurious to health?

Posted by: Kausik Datta | September 21, 2007 7:55 PM

Are you a solipsist? That would explain how we don't really "know" anything.

No. I didn't claim "we don't really 'know' anything." I claimed that YOU didn't know the 2 things you asserted.


1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

Actually, Kimberly Bergalis tested positive for both nucleic acid sequences that are unique to HIV AND for antibodies to HIV-specific proteins.

She died in 1991. PCR was not widely used until Ho's paper in 1993. So, I doubt they did PCR analysis before she died. HIV has only 9,000 base pairs. The human cell as 3 billion base pairs, about 8% of which is retroviral genes, long dormant.

You're guessing here. My statement is correct.


2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV


Actually, Kimberly Bergalis developed several conditions that, taken together, are only found in severely immunocompromised individuals.

Do you read English? She had clinical symptoms that are not unique to HIV. That is a fact. I didn't mention immunocompromised individuals. She may have been immunocompromised. I don't dispute that. Do you not understand the difference between "effect" and "cause"?

Before being diagnosed with HIV,

Do you not understand the distinction between virus and anti-bodies? Being diagnosed with anti-bodies, doesn't equate with HIV infection. There's no evidence they cultured the virus from her. So, you, again, are sloppy and inaccurate.

The challenge to you, Mr. Gorman, is to find a single person who is not a drug addict, a cancer patient, or a transplant recipient, but who displays all of Bergalis' symptoms in the absence of HIV. Perhaps someone could even put up a $50,000 prize as an incentive for you!

Easy. (NEJM, 1993) Please send the 50K to your Momma.

3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

Your wording is vague, so I'm not sure what you're getting at. AZT can cause anemia, depletion of neutrophils, and myopathy. These are not, by themselves, AIDS-defining conditions.

The second clause may be a bit vague, so I'll just repeat what Kimberly said about AZT.

"I have lived through the torturous acne that infested my face and neck, brought on by AZT. I have endured trips twice a week to Miami for three months only to receive painful IV injections. I've had blood transfusions. I've had a bone marrow biopsy. I cried my heart out from the pain." (Lauritsen, AIDS War, Page 324.)

Also, your list of AZT side effects is deliberately under-inclusive, which makes you dishonest. Here's the current package BLACK BOX WARNING from AZT.

"WARNING: Retrovir (Zidovudine) has been associated with hematologic toxicity including neutropenia and severe anemia particularly in patients with HIV disease. Prolonged use of Retrovir has been associated with symptomatic myopathy. Lactic acidosis and severe Hepatomegaly with steatosis, including fatal cases have been reported with the use of nucleoside analogues, alone or in combination."

4. Kimberly Bergalis died.
Right. More specifically, she died of AIDS.

Have you heard of "affirming the consequent." She died. We agree. Idiotic scientists and politicians, however, ignored the terrible, fatal effects of AZT that killed her, and instead blamed her death on AIDS.

Posted by: Ben Gorman | September 21, 2007 8:32 PM

Antiretrovirals can help when one is being attacked by many diseases as I had many of the AIDS defining diseases.

noreen, could you please explain to us your specific belief system here? Does HIV exist? Does it cause AIDS? Are ARV's a good treatment?

Also, are you aware of how ARV's work? You realize that the ARV's are not attacking the PCP or the Karposi Sarcoma right? They are meant to attack the HIV, which makes your statement somewhat confusing.

Posted by: apy | September 21, 2007 9:31 PM

Ben,

Your utter disregard for the truth and for any standards of scholarship lead to the many fallacies sprinkled through your comments.

With respect to Kimberly Bergalis you state:

She died in 1991. PCR was not widely used until Ho's paper in 1993. So, I doubt they did PCR analysis before she died.

You doubt? You doubt therfore you draw a conclusion?

What is the name for this logical fallacy? Is this the "ostrich fallacy" where the speaker makes up his mind and buries his head in the sand lest he uncover evidence that conflicts with his "doubts".

Did you ever consider reading the actual papers that describe the evidence?

Ou CY, et al. (1992). Molecular epidemiology of HIV transmission in a dental practice. Science 256:1165-71.

Abstract: Human immunodeficiency virus type 1 (HIV-1) transmission from infected patients to health-care workers has been well documented, but transmission from an infected health-care worker to a patient has not been reported. After identification of an acquired immunodeficiency syndrome (AIDS) patient who had no known risk factors for HIV infection but who had undergone an invasive procedure performed by a dentist with AIDS, six other patients of this dentist were found to be HIV-infected. Molecular biologic studies were conducted to complement the epidemiologic investigation. Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and sequenced. Three separate comparative genetic analyses--genetic distance measurements, phylogenetic tree analysis, and amino acid signature pattern analysis--showed that the viruses from the dentist and five dental patients were closely related. These data, together with the epidemiologic investigation, indicated that these patients became infected with HIV while receiving care from a dentist with AIDS.

Posted by: Franklin | September 21, 2007 11:39 PM

Carter sayeth:

How the hell do they know? Truth is they don't! Can anyone remind these morons of the huge disparity in numbers of whats reported as to how many are supposedly carrying the dreaded almighty virus VS the numbers under anti-HIV treaments?

Oh, wait! It is all a grand conspiracy, right? Ah, well...

Posted by: Kausik Datta | September 22, 2007 1:40 AM

RARE? So you nit wits think LTNP, controllers, whatever are rare? like I said before thats bull shit!

The CDC estimates that 1.1 million Americans are HIV+, with 40,000 new cases and a little less than 20,000 deaths each year. This accounts for a quite stable figure, and in spite of varying definitions, there have been about 1 million HIV+ Americans for well over ten years now. Yet, only 250,000 take meds and of these it is said that it's hard to keep them taking the meds. This leaves 750,000 HIV+ Americans who haven't been taking meds in any given year, yet there is no upsurge in the number of 'AIDS' cases, which remains pretty steady at 250,000, and there have been fewer than 200,000 deaths in the past ten years. So we can pretty well accept that the figure is around 75% - yes, 75% - and the other 25% are indeterminate, because they're on the meds.

Posted by: carter | September 22, 2007 3:23 AM

Carter Says:

"Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and sequenced."
Criticial thinking? The above is science gone wild to the side of science fiction.

No actual criticism of the methodology, results, or interpretation. No discussion of the actual evidence. Just a blanket statement that this is "science fiction".

The ostrich buries her head in the sand.

On the other hand, for the umptheenth time Cooler direct us to "Project Day Lily":

I would suggest people read a book called Project Day Lily, this microbe called mycoplasma incognitus killed every animal injected (Dr. Lo injected mice primates and they all died) a riveting book by garth and nancy nicolson phds found out how it was part of the biowarfare program, found in some AIDs cases and in CFS etc, google it and read a chapter for free.

Now, "Project Day Lily," that is science fiction.

What does it say that the denialists prefer to base their arguments on science fiction over actual scientific papers? What do you think, Noreen? Would you like your health care providers to base your treatment plan on a science fiction book?

Perhaps this preference for fictionalization explains why Professor Maniotis's fictitious "quotes" that he attributes to scientific papers have appeared on Denialist web sites for years--and continue to appear--without any of the regular users complaining about his fraud.

Posted by: franklin | September 22, 2007 9:46 AM

When one's immune system is basically non-existant and one is being attached by numerous viruses, such as hepatitis, Epstein Barr, etc. then to me it does make good sense to use these to try and save the patient's life. We can go on the "first do no harm" premise but if we did then many more would die. Sometimes drastic situations call for drastic measures.

Posted by: noreen | September 22, 2007 10:03 AM

Apy, all you know is what you read. You did not answer my question if you are HIV+ or have AIDS so why should anyone listen to your two cents? Antriretroviral drugs are not just specific to HIV and have other uses. In fact, I recently read where they may have some benefit for treating cancer. Whether I believe HIV causes AIDS or not is not the point in whether there is any benefit of these drugs. Where you don't get it is when I state that they, along with other chemotherapy drugs, should not be a long-term fix.

Posted by: noreen | September 22, 2007 10:42 AM

Some of the examples that you describe, such as heart tranplants patients who need immune-supressive medicines would not be a good canidate. I think that the antiretrovirls should be used to help full-blown AIDS persons, who usually have more than one AIDS-defining diseases, that is why their immune system is so weak to start with. Obviously, for instance, those with thrush would need fungal medications.

Posted by: noreen | September 22, 2007 10:59 AM

Mainly because I do not know if they would work for these particular diseases or not. Probably, most would be reluctant to prescribe the meds off-label without good cause.

Posted by: noreen | September 22, 2007 1:52 PM

Noreen,

Given that you "do not believe that HIV is the cause of AIDS," what makes you think that there is good cause to prescribe antiretrovirals as a "last ditch" effort for AIDS but not for other conditions that cause severe immune suppression?

Posted by: franklin | September 22, 2007 2:25 PM

Noreen writes about anti-cancer properties of ARV and also states,

Where you don't get it is when I state that they, along with other chemotherapy drugs, should not be a long-term fix.

I think it would be great if somebody could test Noreen's no "long-term fix" idea, especially in the context of her anti-cancer statement, by conducting a randomized trial.

How could we set up this trial? We could have a group of HIV-positive people who take ARVs continuously, and a second group who take ARVs only when their CD4+ T-cell counts drop below a certain level. Perhaps this second group would discontinue drugs when CD4+ T-cell counts go above, say, 350, and resume them when counts fall under, say, 250.

What outcomes would we expect if Noreen's statements are correct?

We would expect that people in the continuous treatment group would be much sicker than people in the interrupted treatment group due to Noreen's claimed toxic effects of unnecessary ARVs that should only be taken as a last-ditch measure. Both morbidity and mortality should be higher in the group that receives continuous "poison" compared with the group that gets these "toxic" chemicals only when they are very sick, as Noreen urges.

From Noreen's anti-cancer claim, we would predict a lower rate of cancers in the continuous treatment group than in the "conserved" treatment group.

Does anyone know of such a study? Is anyone willing to perform a study like this? We really need to know these results to evaluate Noreen's claims.

Posted by: ElkMountainMan | September 22, 2007 2:37 PM

A great study would be a group on LDN verses a group on the antiretrovirals. The interesting results would be the comparison of the blood and liver enzymes and which group had the most opportunistic diseases. Actually, there is one study being done in Africa but none in other parts of the world. It is generally assumed that antiretrovirals are the only treatment for AIDS. Now, there are enough people who LDN to perform such a study.

Posted by: noreen | September 22, 2007 2:46 PM

Wait! I just remembered a paper I just read in the journal "AIDS." Conveniently, it answers all of the questions in my previous comment.

Silverberg MJ et al, "Risk of cancers during interrupted antiretroviral therapy in the SMART study," AIDS, Sept 2007; 21(14), 1957-63.

Silverberg et al examine cancer rates in a randomized trial. One arm of the trial involves continuous use of antiretroviral drugs. The other allows CD4+ T-cell counts to direct the use of therapy. When the count rises above 350, therapy is discontinued. When the count falls below 250, therapy is resumed.

For participants on continuous therapy, viral loads are lower and CD4+ T-cell counts are consistently higher than for participants in the interrupted arm. By these measures, the continuous therapy is better for one's health than interrupted therapy. Our prediction based on Noreen's "last-ditch" comment is not validated by this study.

What about general health, since Noreen and other rethinkers dispute the validity of viral load and CD4+ T-cell counts? In this cohort, confirming the results of numerous previous studies, opportunistic infections and deaths are higher in the interrupted arm than in the continuous arm. Keep in mind that this is a randomized study. Continuous ARV treatment is therefore a better strategy than discontinuous ARV treatment as advocated by Noreen for minimizing outcomes such as OIs and death.

What about cancer rates? Again, what we predicted based on Noreen's comments is not seen. The non-AIDS cancer rates are similar between the two arms. The AIDS cancer rates, however, are six times higher in the group that takes ARVs on an interrupted basis--consistent with the drugs' role in stopping retroviral replication and protecting against immune-system damage and resulting susceptibility to certain types of cancer that are closely influenced by immune system function.

In other words, for the average AIDS patient, going off HAART is much riskier in terms of mortality and morbidity than staying on HAART.

I don't deny that some HIV-positive people do not need ARVs. The difficulty lies in identifying these people. The literature to date, however, suggests that those who follow Noreen's advice--advice that issues from a study with an 'n' of one--and use ARVs only as a measure of last resort, are more likely to suffer health consequences including death than those who take ARVs continuously.

Posted by: ElkMountainMan | September 22, 2007 2:47 PM

Carter writes,

Why don't you read Henry Bauer's book, "The Origin, Persistence and Failings of HIV/AIDS Theory" McFarland & Company; 1st edition, June 30, 2007 ?

Why, Carter, do you assume that none of us has read Bauer's book? Just as you assume none of us has read Duesberg, Maggiore, Hodgkinson, and on and on. To be honest, I haven't read the whole thing, mainly because there's a limit to the amount of amateurish ramblings of a non-expert I can stomach in a given month. But I've read enough to know that Bauer is just as wrong as Duesberg, if not as well-informed. This does let him off the hook, in a sense, since it means that he may not be trying to deceive his readers intentionally. But there is really no excuse for someone with scant knowledge of biology and statistics who writes a book claiming to bring down the entirety of HIV epidemiology. No, scratch that: HIV/AIDS science! That is the height of presumption. Who is this Bauer person, anyway, and why do you believe him, Carter?

Because you like his conclusions, I suppose, and you are just as scientifically unequipped as Bauer himself, unable to recognize his flaws.

Posted by: ElkMountainMan | September 22, 2007 3:07 PM

Noreen,

Given that you "do not believe that HIV is the cause of AIDS," what makes you think that there is good cause to prescribe antiretrovirals as a "last ditch" effort for AIDS but not for other conditions that cause severe immune suppression?

Posted by: franklin | September 22, 2007 3:26 PM

Noreen,

I have not been able to find information about Olympic athletes who have CD4+ T-cell counts as low as yours...or even anywhere close. Would you mind giving me your source for this? I would really appreciate it.

A total of perhaps several hundred cases of CD4+ T-cell counts below 300 have been found in the United States since 1985 in HIV-negative persons who do not have any other obvious reason for immunosuppression. For many of these people, the dip is transient, but for some, it persists. HIV rethinkers suggest that these rare cases prove that low CD4+ T-cell counts are a "normal" phenomenon. They are not. Just because a cause has not been identified does not mean that the low counts are normal or without cause. People with unexplained CD4+ T-cell lymphocytopenia sometimes suffer from OIs that affect AIDS patients.

Low CD4+ T-cell counts are in no way "normal," and anyone who has such counts, whatever the cause, has elevated risk of OIs and death. Noreen may consider herself an exception, but she should remember that her personal study has n=1, and the studies contradicting her collectively have n's in the hundreds of thousands.

Posted by: ElkMountainMan | September 22, 2007 5:34 PM

We all have a lot to learn in regards to HIV. I first stumbled upon the fact that athletes have low CD4's years ago. Off hand, I do not know what the source was. You see, I had many hundreds of pages about AIDS years ago when I was trying to sort all of this out. However, I questioned my infectious disease doctor about this and he admitted that yes it was so but they did not know why. Bear with me, I am sorting through three-hundred pages to get the info on HIV-Negatives and viral loads.

Posted by: noreen | September 22, 2007 7:00 PM

Henry H. Bauer is Professor Emeritus of Chemistry and Science Studies and Dean Emeritus of Arts and Sciences at the Virginia Polytechnic Institute and State University. He was born in Austria and educated in Australia. After researching electrochemistry at the Universities of Sydney, Michigan, Southampton, and Kentucky, he turned to general issues relating to scientific activity, in particular how to differentiate science from pseudoscience. He has taught both undergraduate and graduate programs in humanities and science and technology studies. Upon retirement from teaching at the end of 1999, he became Editor-in-Chief of the Journal of Scientific Exploration.

Bauer has challenged the HIV/AIDS hypothesis in several papers, based primarily on the fact that the data on HIV seroprevalence are incompatible with the notion that the HIV antibody tests are detecting a sexually transmissable virus.

You morons are starting to bore me.

Posted by: carter | September 22, 2007 8:28 PM

It would be great to have ElkMountain, Tara, Franklin, and the rest of these zealots take some AZT on a daily basis for a month, and report to the group here, what it does to them.

Posted by: Milt | September 22, 2007 9:12 PM

Carter,

Let me give you a friendly tip: copying text without giving your source doesn't exactly impress anyone. Did you copy that Bauer bio from Henry Bauer's website, or from where?

Carter, Henry Bauer is no more qualified than you to write a book about HIV...well, except that Bauer is at least able to give sources for his quotes. Since the 1970s he's been teaching "science studies," a bunch of pomo nonsense about how science is dead. For lack of a better term, "science studies," like most of the rest of what passes for philosophy these days, is mental masturbation. The influence of "science studies" on actual science and actual society is nil. I suppose its existence adds a bit to employment figures, but that's about it.

A teacher of "science studies" who doesn't know the first thing about virology is bound to make a fool of himself if he writes a treatise on how everything we know about HIV and AIDS is wrong. Predictably, Bauer makes a fool of himself in a grandiose way. I don't believe Bauer understands how wrong he is, which is why I find him more amusing or pitiful than despicable, like certain more qualified scientists who know very well that they are trying to deceive people like you, Carter, who believe them in an understandable wish to deny your own health problems.

If you would like specific examples of the sort of head-scratching, eyebrow-furrowing inanity in Bauer's writing, I will give you a few. But you've already wasted my time with Duesberg. Nobody responded to any of the many flaws that I along with Franklin, Chris, DT, apy, adele, and others I'm forgetting gave you from Duesberg's writings. We gave you quotes, references, page numbers and everything, and it doesn't seem that any of you even checked them. You certainly didn't respond.

Carter, you and your friends here are hero-worshiping Bauer just like you hero-worship Duesberg: because what Bauer says soothes your fears and helps you deny reality.

Posted by: ElkMountainMan | September 22, 2007 9:13 PM

Noreen,

Thank you for looking up those references for me. I would give you the same advice I gave Carter: when you get your information from a website, please tell us what that website is.

You wrote,
Surfing the net, I found that one study was performed in 1980, cited in a report to the Un Human Rights Commission presented by Project AIDS International

Noreen, can you tell us honestly which websites you visited to find this report, along with the quote and the Mendez et al study?

Please, Noreen, remember that these websites are giving you only a small portion of the big picture. They are filtering out all of the data that disprove their pre-selected fantasies about HIV and AIDS.

In truth, there are hundreds of studies about the effects of various types of exercise on CD4+ T-cell counts and other immune parameters. Not just one report from the early 1980s that a "rethinker" organization reportedly sent to the UN. Endurance athletes at the Olympic level are in effect torturing their bodies; there are consequences for the immune system. Some do have transient dips in peripheral blood CD4 counts. However, I have not seen any reports of an HIV-negative athlete with a CD4 count below 200. Have you, Noreen?

As for CD4 counts, they of course have a relation to general health! I'm not sure where you got this quote, but please remember that rethinker websites often take quotes out of context. They will only present quotes and data they "agree" with, even if that means a bit of distortion.

Noreen, I don't have the time right now to address your comments on viral load measurements and "non-specific" primers, other than to say that you are absolutely and completely wrong on this. The primers and probes used in these assays do not bind to anything in the human genome. False positive samples are usually not reproducibly positive, and are the result of laboratory errors. Noreen, I really don't wish to come across as pompous, but Matt Irwin and others you rely upon for your information are flatly wrong, and I encourage you to consult with a knowledgeable, non-partisan doctor to learn about the viral load assay and how it applies to you.

Posted by: ElkMountainMan | September 22, 2007 10:16 PM

Hello, DT welcome back! DT how can you argue with a perfectly healthy human being? If I were not HIV-Positive, we would not be having this conversion. I am not the only HIV+ who is doing the same as many have contacted me. It is you who is stuck with this study and that study, which may have some valid points but does not represent the entire HIV population. I would expect more inquistive questioning from some one who is suppose to be scientifically minded. Instead, from most, I get the same old gloom and doom reports, who try to instill fear back into the equation. Well, at least my doctors are following me in amazement and will have to address the obvious, maybe the patient knows better how to deal with this than the same old routine of antiretrovirals.

Posted by: noreen | September 22, 2007 10:27 PM

Are any of the Deniers still denying that Kimberly Bergalis had severe candidiasis, weight loss, hair loss and almost died from PCP before she was tested for HIV and was severely ill before she was ever prescribed AZT?

I'm getting sick of going through the exact same points every few months.

Posted by: Chris Noble | September 22, 2007 10:56 PM

yeah experts hacks like gallo announced a plague to the public without any published evidence, then a week later we found out about his partial barely detectable correlation with no animal model, not one study since designed to confirm his sorry hypothesis, you cant confirm something you already beleive to be true, so where left no evidence at all, besides Gallo's flimsy paper. His failed cancer virus turned into the AIDS virus overnight.

If im wrong please provide me with a scientific paper that states " an experiment to test whether or not hiv is the cause of AIDS, to examine Gallo's claim" Cant find it, bc it does not exist, they all had to assume it to be true.

"Experts" will say anything especially if the government is behind it, If gallo and heckler came out and said "mycoplasma" is the cause of AIDS you guys would be parroting that in Orwellian fashion.

Experts have a tendancy to follow the states propaganda, they did in Stalins Russia, Orwells 1984, Nazi Germany, and the AIDS apologists are doing it now, thank god more and more experts are speaking out like Margulis and Pollock, and this consensus you people gloat about evaporating.

Your consensus is manufactured consent ie, if experts heard both sides of the issue you artificial "consensus" would dissapear, youd be left with only a few crackpot scientists like moore/wainberg drinking the hiv kool aid. If you hear only one side of an issue you tend to believe it.

For lurkers
See hiv fact or fraud google it

Read project day lily to find out about the mycoplasma incognitus biowarfare program, a microbe that shyh ching lo killed every animal he injected with, dr garth nicolson found out it was part of the biowarfare program, a true story slightly fictionilized to stay out of court, rave reviews from several scientists, including a nobel laurete.

Project Day lily google it. read a chapter for free

Posted by: cooler | September 23, 2007 12:48 AM

"Experts have a tendancy to follow the states propaganda, they did in Stalins Russia, Orwells 1984, Nazi Germany..."

Did you just cite a work of fiction as an example of how real experts tend to follow "the states propaganda"?

Posted by: Tyler DiPietro | September 23, 2007 1:03 AM

If i am already convinced a Black man broke into my house (when it could have been anybody) and all subsequent investigation was based on that essential premise, and failed to investigate any alternative scenarious, it makes the investigation flawed, for not considering alternative hypothesis.

If every study I conduct assumes as its premise a black man broke into my house, its fallacious research. IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis, and would ignore evidence that didnt support your prexisting beleif that youd never abandon.

Posted by: cooler | September 23, 2007 1:32 AM

IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis, and would ignore evidence that didnt support your prexisting beleif that youd never abandon.

For the past 100 years every single experiment in aeronautics assumes that heavy-than-air flight is possible. Nevertheless these experiments all confirm this assumption.

Vaccine trials use the SHIV/macaque model. They all assume that HIV causes AIDS and yet they also provide confirmation from the reproducible AIDS produced in these animals. The experiments are not designed to test the theory and yet the results provide evidence that can only be ignored by people that are afraid to face reality.

Posted by: Chris Noble | September 23, 2007 1:52 AM

none of those studies were designed to test whether or not hiv causes AIDS, the asher study is a total fraud bc they viewed dissidents as nazis, If duesberg conducted a study and he came to the conclusion that hiv was not the cause of AIDS, everyone would say it's invalid bc hes partial. Well same rules apply to hacks like winklestein etc

If none of studies since 1984 have been designed to test whether or not HIV causes AIDS then they can't possibly be used as evidence that HIV does not cause AIDS according to your logic. This has never stopped Denialists from arguing exactly this. In the absence of any experimental results of their own this is their sole argument. You can't have it both ways. If these studies can be used to argue against HIV causing AIDS then they can also be used to provide evidence for HIV causing AIDS.

There are labs around the worlds using animal models such as the SHIV/macaque model of the HIV/SCIDhu mice. These results complete destroy Duesberg's bullshit claim that retroviruses do not cause AIDS. They provide overwhelming evidence that HIV causes AIDS.

I also notice the ad hominem attacks on Ascher and Winkelstein. At least you didn't call them "Fauci's buttboy" and "Winkelstinkel". If you have any factual criticisms then present them. If we use your logic then we should also ignore anything Duesberg says because he obviously isn't impartial.

Posted by: Chris Noble | September 23, 2007 2:46 AM

Well noreen thats the problem with going to a orthopedist!! just kidding everyone, sort-of!

So your doctor can't do a blood count, but you believe it when a doctor tells you olympic people have cd4 counts like AIDS patients??!! Why would you believe that? Well gee because you want to think your not just healthy you're as healthy as an olympian. Therfore low CD4 counts are HEALTHY. Noreen it makes me so sad how you're twisting things in your head, you're smarter than that I know it.

I think DT was right you got that info from our make your own positive baby friends at A&W. You got the name of the deniosaur organisation wrong like Christine "The Mom The Legend" Maggiore. ITs not Project AIDS International its Project: AIDS International. Noreen these people don't care about babies even why do you think their giving you good information.

Posted by: Adele | September 23, 2007 10:28 AM

Adele, the facts speak for themselves, HIV has not been islolated in pure form, there hasn't been one study that proves HIV causes AIDS, the HIV test is for antibodies and not an actual virus, Grade four events are real for HIV-Positives and so is liver disease, heart attacks, abnormal blood, anemia, buffalo humps, neuropathy, and diarrhea, Viral loads are only 6 to 8% accurate, CD4's are not the best yardstick for health, Gallo only found 40% of patients with HIV, Gallo was investigated for scientific misconduct, Nancy Padian could not find one couple who the negative partner converted to HIV-Positive and the majority of AIDS cases are still predominately in the male population. These are some of the reasons that I am a rethinker because the mainstream's math does not add up.

Posted by: noreen | September 23, 2007 10:45 AM

If you are interested in anything other than rhetorical wordgames then you could attempt to answer the question I posed to Carter. Your complete lack of any rational response to this post is also noted.

Dr. Noble, your incessant torture of the word word "rational", here used as a variant of the "no true scotsman" fallacy, may seem clever to your fellow political dogs in the AIDStruth kennel, but you've got to up your game a wee bit if you want me to take the bait.

Posted by: Epidemiology-LISA | September 23, 2007 11:01 AM

Noreen, remember how you said apy "believes everything you read?" Thing is, apy gets information from peer-reviewed stuff. You get all your information from alive and well and virusmyth. Its like getting all you information about evolution from discovery institute.

All that stuff you just said? Its all wrong but how can anyone prove it to you you already decided what to want to believe.

Posted by: Adele | September 23, 2007 11:23 AM

http://www.aidstruth.org/science-sold-out.pdf

"As an aside, the Duesberg review from 2003 [7 - http://duesberg.com/papers/chemical-bases.html] is representative of the denialist literature in its willful manipulation and misrepresentation of more scrupulous scientists' data. In this 30-page review, the authors complain that earlier versions of their manuscript had previously been rejected (or not accepted) by two journals with wider circulation than the eventual publisher, the Indian Journal of Biosciences. Reading the paper closely raises the question of why this third journal did not also reject it. Take the following sentence fragment as one example.

...the Palella-study found that the mortality of initially asymptomatic (sic), HIV-positive people, which (sic) are treated with new anti-HIV drug cocktails (sic), is 8.8%...and the Hogg-study found it is 6.7% (sic) [7]

Palella and colleagues document a steady decline in death rates from 35.1/100 person-years in early 1994 to 8.8/100 person-years in the second quarter of 1997. These strikingly high death rates are seen because the authors restricted their study to HIV+ individuals with CD4+ T-cell counts below 100 per microliter (ul), meaning that these patients were already severely immunocompromised. Many had CD4 counts below 50/ul. Analysis was not restricted to "initially asymptomatic" individuals. Some patients did not take antiretrovirals at all (the highest mortality rate in the second quarter of 1997--51.6/100 person-years--was in this group), while still others were on monotherapy (i.e., not the "new anti-HIV drug cocktails").

In the FJ Hogg et al paper, 6.7% is not, as implied by Duesberg et al, an annual mortality rate; the estimated annual mortality rate is 2.9%, as stated in the paper. 1219 HIV+ patients were followed for a median of 28 months. During the study, a total of 82 patients died of AIDS. 73% of the deaths occurred in patients (36% of the total) with CD4 counts below 200/ul. As in the Palella et al study, the patients were not all "initially asymptomatic": 158 had been diagnosed with AIDS (73% with opportunistic infections, 17% with malignancies, others with neurological symptoms or wasting) prior to enrollment.

These mistakes are grave and indicate, at best, the low standards of scholarship to which Duesberg, Koehnlein, and Rasnick adhere. Even worse is an example of what can only be described as true scholarly misconduct--the following misquote from the Palella article, truncated to leave the impression that all study participants were "initially asymptomatic":

Patients with a diagnosis of cytomegalovirus retinitis or M. aviarum complex disease before study entry or during the first 30 days of follow-up and patients with active P. carinii pneumonia at the beginning of follow-up were excluded. (Note the period here--KW) [7]

In the original paper, this sentence does not end with a period. Instead, it continues:

...from the analyses of the incidence of that opportunistic infection. [83]

Thus, all patients were included in the overall study, including the mortality calculations, but patients with pre-existing or early-presenting conditions were not counted as having developed those specific conditions during the course of the study. Duesberg, Koehnlein, and Rasnick manipulate the quote to make it say what they want it to say, in effect lying about the patients' health status and the study's methods to support their own assertion that most deaths reported here were due to drug toxicity. It is unfortunate that Culshaw looks to this class of scholars for her information and inspiration."

Posted by: Brad | September 23, 2007 12:41 PM

thanks you...

Posted by: sohbet | September 23, 2007 1:31 PM

Im still convinced a black man broke into my house, I refuse to consider another hypothesis, a witness tells me he saw a white man break into my house, i ignore him bc i will never abandon my hypothesis, this is the way AIDS research works.

YOU inject hundereds of chimps/mice with HIV, they were all supposed to die of AIDs none did after 20 years, instead of considering a new hypothesis, I cling on and extend the goalpoasts to save the hypothesis, hiv is now species specific

People were supposed to die within a few years, not 10 years..........when no one did just double the window period, ignore failed predictions and just carry on .............ignore evidence, just extend the window period.

Hiv was supposed to be directly killing tcells thats what youir lord gallo said...........reserachers find out hiv only infects about 1/1000 blood t cells..........instead of realizing that youve come across evidence that hiv might be harmless, you know say hiv , according to that fool joel gallant, its now a diffuse immune response that kills cells! LOL keep on extending the goal posts to save your idiotic theroy.

Back to my analogy, a witness says hey i saw I white man break in your house, I ignore him and keep coming up with convoluted speculations that it had to be a black man..........this is the AIDS research since Gallo's orwellian Press conference.

See hiv fact or fraud google it

read Project Day lily.........mycoplasma biowarfare program uncovered by the nicolsons, greatest book ever slightly fictionilized to stay out of court google it

Posted by: cooler | September 23, 2007 2:30 PM

You will have to better than that to fulfill Koch's Prostulates. The article stated "most" cases it did not state 100%, which by the way is required. To cover this obvious flaw, a new term was invented for HIV-Negative cases, idiopathic CD4T lymphocytopenia.

The virus must be found freely in the fluids of the patient, it is not in anyone's saliva, blood or other fluids. In fact PCR in required to even find remnants of anything.

The viurs must be taken out of the patient, be transferred to an animal species and the animal must develop AIDS. This has not happened with HIV, maybe similar viruses but not HIV.

Posted by: noreen | September 23, 2007 5:21 PM

DT, You said: About 15 years ago I was a volunteer in a lab study looking at CD4 variability through the day and from day to day. My counts ranged from 400 to 700.

OH MY GOD DT! You had CD4 counts of ONLY 400! Don't you know that according to the "1993 Revised Classification System for HIV Infection", http://www.cdc.gov/MMWR/preview/MMWRhtml/00018871.htm

By your OWN ADMISSION DT, You yourself had counts of less than 500 CD4 cells.

WITH ONLY 400 CD4 CELLS, YOU, DT, ARE GOING TO DIE OF AIDS AND YOU SHOULD BE TAKING AZT!!! Even the CDC absolutely agrees:

Measures of CD4+ T-lymphocytes are used to guide clinical and therapeutic management of HIV-infected persons (22). Antimicrobial prophylaxis and antiretroviral therapies have been shown to be most effective within certain levels of immune dysfunction (23-28). As a result, antiretroviral therapy should be considered for all persons with CD4+ T-lymphocyte counts of less than 500.

But since you DT, have NOT been taking your AZT for the last 15 years, it is HIGH TIME you get sick with AIDS and get on with your dying! Now take your damned AZT and antiretrovirals, DT, or get off the damned planet!

Posted by: Michael | September 23, 2007 7:52 PM

Noreen, have you ever imagined such absurdity or stupidity?

DT, who by the way is an HIV/AIDS clinician, has verified that as an HIV negative individual him/herself, DT has had results of only 400 CD4 cell counts which was proclaimed by the CDC as well into the immune deficient range of less than 500.

Further, the CDC itself recommends since 1993 that those individuals with less than 500 take antiretrovirals.

However, DT, as a clinician, does not and would not self prescribe nor take antiretrovirals for DT's own low CD cell count, but is rather insistent that YOU and OTHERS SHOULD simply because you had a highly flawed HIV antibody test show as positive.

DT, a devout follower and believer in all of the edicts of the CDC, NIAIDS, and big pharma, would further seek to brainwash you into believing that DT's own low CD counts are somehow meaningless because he/she has not had a positive HIV antibody test, BUT, your low CD counts, Noreen, mean to DT that you will sicken and die without the highly toxic meds that DT has pushed unthinkingly and gleefully onto many others after brainwashing them into believing they would die without them.

DT, what can I say? You are one sick puppy.

I can only imagine it is your own ego's denial of culpability and your own ego's guilt in the role you yourself have played in the disfigurement of many who were diagnosed as HIV and who you yourself peddled disfiguring drugs to, that further drives you to continue your ranting against the dissidents.

There is an old saying DT, that "one is only as sick as their secrets".

So come clean DT. Tell someone, or tell us your dirty little shamefilled secret and clear your soul. How many have you helped to poison or helped to scare to death and disfigurement with your stubborn scared little ego's own error in believing that HIV was the cause of AIDS?

Come clean DT. Tell someone. Seriously.

Do not agonize yourself into further insanity over it, DT. We all understand that at the time, you were doing the very best you could with what you believed was right.

The truth, as they say, shall set you free.

Posted by: Anonymous | September 23, 2007 8:42 PM

Roy, going by your synopsis, then I should also have been very sick for the past two years because most of this time, my CD4's have stayed in the eighties. We will never know what was normal for me prior to getting sick. Perhaps, mine have always been on the low side. This is why, none of this makes much sense according to the mainstream's standards.

Personally, I was very sick mainly due to undiagnosed and untreatet medical conditions, unhealthy living habits, and past health issues. Due to all of the above, I proceeded to go downhill, which is not impossible to do when one is immune compromised. All of my conditions were around prior to the new classification of AIDS.

Posted by: noreen | September 23, 2007 9:02 PM

The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

Duesberg has been caught with his pants down again.
Why does Duesberg deliberately misrepresent these studies?
Why was the manuscript rejected by two high ranking journals?
Why was it finally published in a low impact factor journal where the corresponding editor was a friend?

Posted by: Chris Noble | September 23, 2007 9:47 PM

After the numbers she copied-and-pasted from Duesberg were shown to be fudged, Lisa claims:

The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

Do you have any evidence for this claim, Lisa?

Or is that just what you told yourself as you buried your head in the sand, little ostrich.

Posted by: franklin | September 23, 2007 11:54 PM

Brad,

The errors that you reported from Duesberg paper are minor errors, because correcting them would not change the main conclusions of the paper.

And therefore are you writing your post on these errors because you dont have anything to say about the major points that would be suggested by the authors, two of them being a) that standard ARV's treatment accelerate AIDS, b) there is another way to treat AIDS patients, ?

I believe that these were the questions to answer if you wanted to discredit the authors.

Posted by: Braganza | September 24, 2007 4:55 AM

These endless discussions over the question whether or not the equation HIV=Aids=Take_The_Toxic_Drugs is accurate or not really are far out and one day our children... no, too optimistic... our grand-grand-grand-grand-children, will be truly amazed reading them.

- Hey, look at this! It's insane! Grand-grand-grand-grand-dad really believed that poison would help a starving person get back onto his feet! And he was not alone with his believe. Almost everybody did believe such nonsense. And to top it all, they insulted people who said "Give'em eat instead of drugs" and tried to curse them into jail!!!

Posted by: jspreen | September 24, 2007 5:24 AM

Dr. Noble, If you'd care to read Duesberg's paper he is so unscientific as to consider every AIDS case in the global stats an AIDS death whether the patient died or not. That is he geenrously counts all no-test clinical diagnoses of AIDS, all cases of CD counts below 200, and whatever elso goes into the WHO's numbers, as an AIDS death. Certainly that's going to artificially inflate the number of AIDS deaths globally, so how come you or the ghost smearer who critiqued the paper didn't mention that?

Dr. Noble, I don't kno why Duesberg's paper was rejected by two high ranking journals, though I might have a suspicion. Why haven't any of your own effusions appeared anywhere outside obscure blogs?

Posted by: Epidemiology-LISA | September 24, 2007 5:28 AM

Dr. Noble if Duesberg's LTNPs irk you so, you are welcome to provide your own large cohorts of LTNPs consistently on early monotherapy to counter Duesberg's (almost) drug free examples.

You can start with your friend Mundt here, who came off so convincingly, but then unfortunately clammed up and disappeared just as he was about to become a scientific celebrity.
http://medicine.plosjournals.org/perlserv/?request=read-response&doi=10.1371/journal.pmed.0040256#r1777

Posted by: Epidemiology-LISA | September 24, 2007 5:42 AM

Dr. Noble if Duesberg's LTNPs irk you so, you are welcome to provide your own large cohorts of LTNPs consistently on early monotherapy to counter Duesberg's (almost) drug free examples.

What irk's me is Duesberg's deceptive presentation of the literature.

LTNPs are not given antiretrovirals because they do not progress. Their CD4 counts do not fall to levels that are consistent with the recommendations for initiating ART. This is the direction of causality.

a) lack of progression -> not given ART

Duesberg abuses logic by arguing the reverse.

b) not given ART -> lack of progession

The same perverted logic could argue that insulin causes diabetes and ambulances cause road accidents.

Posted by: Chris Noble | September 24, 2007 6:03 AM

Ah I see so what you're saying, Dr. Noble is, forst of all that you camn't find LTNPs consistently on monotherapy, secondly that none of the drug free LTNPs hav had CD4 counts below the recommended ARV starting point? That's a bold claim, Dr. Noble, especially since even the first of the two studies you reference imply that some of the subjects indeed had been on ARVs:

"Cao Y, Quin L, Zhang L, Safrit J and Ho D D 1995 Virologic and Immunologic Characterization of Long-Term Survivors of Human Immunodeficiency Virus Type 1 Infection; N. Engl. J. Med. 332 201­208

"Ten HIV-1-seropositive subjects from the New York metropolitan area were referred to us because they met our working definition of long-term survivors of HIV-1 infection: they had no symptoms, normal and stable CD4+ lymphocyte counts, no prolonged use of antiretroviral agents, and at least 12 years of infection

Posted by: Epidemiology-LISA | September 24, 2007 6:16 AM

How do you explain your high HIV viral load and low CD4 count prior to HAART, reduction of HIV viral load to 0 and increase in CD4 to 240 while on HAART, then after quitting your medications your HIV viral load shot straight back up to 100,000 and CD4s have been dropping continuously to about 80 (I think you said).

Oh so simple Roy. During HAART she was taking frequent trips to the hospital. Remember, loneliness causes AIDS? At the hospital gets plenty of human-on-human interaction. Now she's off HAART, doing her own thing, less interaction, the loneliness is killing her!

IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis

Umm...Did you not attend middle school science class? You state hypothesis TO TEST them. That is the whole point.

noreen:

... the facts speak for themselves ...

You bet they do! Like these facts:
noreen: I read this on Alive & Well
Me: Noreen, do you get all of your info from denialist websites or do you actually verify what they say?
You: I don't goto denialist websites.
Me: But you just said you do, and if I google what you wrote it comes up on Alive & Well and Virusmyth.
You: I don't go there, I come to all my conclusions on my own.
Me: Then where did you get reference X? It only shows up on denialist websites.
You:
Me: Well?
You:
Me: 3rd time the charm?
You:
Me: Asking again....
You: HIV doesn't cause AIDS!

Posted by: apy | September 24, 2007 10:54 AM

Apy, you just don't get it. I had many SYMPTOMS, that it the key to this not some unvalidated Antibody Test nor meaningless viral load test either. These tests are the problems with AIDS. If these test were no longer used then many of the AIDS cases would go away but we can't have that now can we? We must keep them along with adding more diseases to the pot and let's just add the statistics cumulatively too to make it look worse. Doesn't it strike all of the supporters of AIDS that persons with high viral loads and low CD4's are healthy? It would be obvious to a fifth-grader that this is faulty. The reason that many of us are healthy is because both of the above tests are not indicators of health and because we have good, health habits therefore no symptoms. If one cleans up their act, then AIDS will go away as many are proving this to be true in reality.

Posted by: noreen | September 24, 2007 11:49 AM

Apy, I am not goint to get into a pissing contest with you. It's sounds like you just want to argue every point against the rethinkers. Some points may be valid on both sides of the fence but the bottom line should be who is surviving better, those on the antiretrovirals, those off of them and those on LDN? The proof in all of this is in the health of the patient. Do you wish to argue this too?

Posted by: noreen | September 24, 2007 12:25 PM

As of now, there is only one study currently being done and some earlier studies have been done by Dr. Bihari if you care to check out lowdosenaltrexone.org. One thing is for sure though, grade four events and other side effects do not occur with LDN and to me it is a no-brainer!

Posted by: noreen | September 24, 2007 1:07 PM

Apy, I am alive and breathing, if that isn't evidence then what is? I was only on the antiretrovirals two months with LDN. For twenty months now, I have only been on LDN. I doubt very seriously that the antiretrovirals are having any effect on my health now. And LDN only has one, minor side effect, when first started it may cause sleeplessness in some. I did not experience this. How can you compare this drug to grade four events. It is one of the all-time safest drugs with a long-proven track record.

Posted by: noreen | September 24, 2007 2:04 PM

Noreen, I am alive and breathing too and I take LDO (low dose oatmeal) every morning. Am I to argue LDO is what is keeping me healthy? No! Just because LDN has a scientificy name doesn't mean it is actually doing anything. You have no actual evidence that your situation is the direct result of the LDN. You have no control and you have no statistical evidence. I'm not sure why this is so difficult to get across but: something happening for you DOES NOT imply any statistical significants, at all. Again, I did not tell you to stop taking it, I did not say that it DOES NOT work, I stated that you have no evidence that it DOES work. There is a difference.

Read what I posted again, I did NOT say that the ARV's were still having an effect on your health, I stated that you have no proof that the overlap between them did not cause something else to happen that is helping you and you have no evidence that LDN alone is the cause of your health. The very point is that you are giving LDN all this praise but you don't know if that is what is helping you. You complain and complain that HIV = AIDS is unscientific and pure dogma and has no proof nor a paper proving HIV causes AIDS but you are a complete hypocrite when you tell everyone the wonders of LDN when you don't have any actual proof that it is doing anything. You don't believe HIV causes AIDS? You think that because you are healthy on LDN that is the litmus test for its benefits? So what do you say to all those people that say "I am HIV+ and I have AIDS, therefore HIV causes AIDS". Is your solitary opinion all the more meaningful than theirs?

How can you compare this drug to grade four events. It is one of the all-time safest drugs with a long-proven track record.

Read what I said again, I did not compare this drug to grade four events. I said that LDN not causing grade four events is completely useless bit of news unless LDN is actually proven to be helpful to an AIDS patient.

Posted by: apy | September 24, 2007 2:27 PM

I am not making fun of her. There is a world of difference between "likeliness" of working and "actually" working in a real world biological system. Even if it theoretically should work like a charm, that in no way proves that something in any way is going to actually work. But that is not what noreen is doing. She is saying LDN works, even with no proof that it actually works besides that she feels healthy.

Posted by: apy | September 24, 2007 2:39 PM

Ah I see Adele, So if there were a cumulative 34 million AIDS cases last year, but 34 million die we're left with million cumulative AIDS cases, right? So how many cumulative AIDS cases are there in the US stats today?

Posted by: Epidemiology-Lisa | September 24, 2007 3:01 PM

"I am glad that Mark Wainberg raised the issue about whether the Constitution should be changed to stop medical endangerment."

Wow, someone here's been finally honest enough to just come out and say it.

That's all it takes for you, hysterical Elkie, the mystical term _medical endangerment_ which of course is a term that has a precise and rigorous definition, right, mister let's-just-turn-our decisions-about-our-bodies-over-to-the-authorities because, surely as they're now showing us every day they know best ...

Posted by: Mr. Natural | September 24, 2007 3:14 PM

DR. Mark "Natural" says

If a libertarian and a liberal question Aids, they are both obliged to get their differing political positions aligned before they post here.

of course not "luv"!! Just see these nutso militia black helicopter ron paul guys got their own reasons for questioning AIDS that're alot different from say a gay man in New York whose got HIV who questions AIDS bc he's dealing with his health issues a really common way by denying them.

See theres lots of people around the ron pauls and other freaks who don't like gay men and don't want them to be healthy and don't want their precioussss tax $$ used on anything that might include gay people not dying and that's why they question AIDS.

But I bet you like carters new lord and savior to. Henry Buaer the man who said we should take away free speech for gay people so they don't spread look it up on aids truth.

I think it's very difficult to draw a line between free speech about civil rights for gays and the tendency for the life-style to be presented as something that it would be perfectly all right for anyone to choose.

You're a rethinker for your health? OK, I respect it, like Noreen. You don't know what your talking about but that's your choice. So why do you get all luvy with Duesberg and Bauer after all the stuff they've said? Would you take a word of that crap from a HIV scientisT?

Posted by: Adele | September 24, 2007 3:30 PM

Apy, so what do you attribute my good fortunate too, luck? I don't believe so. Common sense would dictate that all the good, positive influences in my life would be the answer, including LDN. Do you not believe Dr. Bahari's success with treating AIDS patients with LDN or is your mind so closed that you will not accept anything but antiretrovirals?

So my viral load of >100,000, the limit of where mine is tested it could be much higher, has spontaneously mutated to a harmless variety of HIV. Which is it Apy, harmless HIV or other factors are keeping it at bay?

Posted by: noreen | September 24, 2007 3:39 PM

"No, Carter, AZT's side effects are not indistinguishable from AIDS. That's just another Duesberg distortion."

Elkie darling, perhaps you can clear this up for us on the biochemical level. How Duesberg has distorted the biochemical argument in Inventing the AIDS Virus, and of course, you're stinging rebuttal.

And Adele, who's an expert on polymerase enzymes, can explain the technical terms for us.

Posted by: Mr. Natural | September 24, 2007 3:44 PM

AIDS denialism--in many cases, in my opinion should be. "Rethinkers" make money from the vulnerable people they exploit; their propaganda could be, but often is not, restricted under commercial speech regulations.

What are you talking about, ElkMountainMan? ...Vulnerable people they exploit...
But it's the other way around, yo dummy. The vulnerable people are those who swallow main stream propaganda hook, line and sinker with their dusty brain on zero activity. Anyone listening to a rethinker, can only do so if he found the use of his own brain again, after having cleaned up the dust.

The I_saw_it_on_TV_so_it's_true hillbillies, there are your vulnerable people. Don't worry about rethinkers me boy, they don't need speech regulations at all, they can sort out the information quite well for themselves.

Posted by: jspreen | September 24, 2007 3:48 PM

so what do you attribute my good fortunate too, luck?

I'm not foolish enough to contribute your good fortune to anything, I'm clearly stating that we don't know what it is and it's important to find out so we can reproduce it.

Do you not believe Dr. Bahari's success with treating AIDS patients with LDN or is your mind so closed that you will not accept anything but antiretrovirals?

What successes? You said we don't have any studies completed and you only know of one study in the works. Does Bahari have a control group? Has he submitted his paper to any journals? Gotten it peer reviewed? Gotten any form of review on it? Have you given his work the thorough due-diligence that you give Alive & Well's claims about Amy Justice? What do you want me to say here noreen? You have proven yourself completely incapable of verifying any fact you report to us. Short memory? Let's not forget your "Clinton pardoned Gallo" miss and your complete miss on Amy Justice. What am I supposed to think here? Oh noreen made a few minor mistakes in the past but I'll take her word this time? Not a chance.

So my viral load of >100,000, the limit of where mine is tested it could be much higher, has spontaneously mutated to a harmless variety of HIV. Which is it Apy, harmless HIV or other factors are keeping it at bay?

Again, I don't know! That is why I'm suggesting some work be done to determine it. But sitting around telling everyone here that questions what you say that HIV doesn't cause AIDS because there is no paper that proves it and then telling them that LDN helps AIDS patients when there are absolutely no studies on it in regards to AIDS is not consistent or rational.

Posted by: apy | September 24, 2007 3:55 PM

apy and noreen,

i just made a mistake too. I didn't read something right and tony-lisa caught me. He was right on that one but I was right and Duesberg was wrong on the other two. I admitted my mistake.

Noreen admitted she mistook the thing about the Clinton pardon. She read it somewhere on the net didn't confirm it.

I don't remember did Noreen say anything ever about Amy Justice? Maybe because she doesn't know enough about amy justice work to say one way or the other. So she just copies virusmyth or someone what they say about Amy Justice. But you can't admit your wrong on that one, noreen because its so important to your beliefs. Amy Justice was the one proved protease inhibitors kill most AIDS patients right? WEll she never said that and her work dosen't support it its just what you WANT to believe. But the good thing about only reading virusmyth is you don't have to admit your wrong. ever!! As far as you know maybe Amy Justice did say those things!

Posted by: Adele | September 24, 2007 4:04 PM

sorry I meant did noreen ever admit she was wrong about Amy Justice?

Posted by: Adele | September 24, 2007 4:06 PM

I believe that the info on Justice was from a university site.

Could you find that site again please?

Posted by: apy | September 24, 2007 4:24 PM

Adele, Of course I can accept you misread or got confused and leave it at that without questioning your general ability to read and understand. It happens to everybody here all the time (yes even to Chris Noble). The sad thing is precisely that in this atmosphere one has to be afraid of admitting it.
http://scienceblogs.com/aetiology/2007/09/loneliness_causes_aids_claims.php#comment-577733

Nobody jumped on you for it and nobody will compare that with the barrage fom different(?) people like Brad, ElkMountainMan, Shalini, Noble who all wanted to join in the massacre when they thought they'd caught me/Duesberg above. . . And by the way, Duesberg clearly DID get the Canadian study wrong taking the mortality at 28 months as if it were 12. I have no problems admitting that.

Posted by: Epidemiology-LISA | September 24, 2007 4:57 PM

The body.com has several article about Amy Justice, which was probably one of the sources where I saw it. I do not frequent most rethinkers sites because if you check them, you will find that there is not much new information on them. I prefer university sites, normal AIDS sites and AIDS support groups, which tend to have a wealth of info.

Posted by: noreen Martin - the rock | September 24, 2007 6:17 PM

Wall Street Journal
AIDS Effort Suffers Big Blow
As Merck Vaccine Fails
By MARILYN CHASE and MARK SCHOOFS
September 22, 2007; Page A2

In a major setback, one of the leading experimental AIDS vaccines not only failed to prevent test subjects from becoming infected with HIV, but it didn't offer any indication it might delay the onset of full-blown AIDS,
which had been a key hope.

The collapse of the trial leaves Merck & Co., which had spent a decade developing the vaccine, with no remaining prospects in the global hunt for an AIDS immunization. The vaccine was tested in a network funded by the National Institutes of Health.

"We've been kicked in the teeth," said Bruce Walker,....

(well you didn't listen when we dissidents kicked you in the ass, maybe a kick in the teeth will help you pay closer attention)

....a veteran AIDS researcher at Harvard University who wasn't involved in the study. Lawrence Corey, a leader of the NIH-funded HIV Vaccine Trials Network, said he was "mourning."

(So am I, mourning all of the people you morons already scared and poisoned to death)

The results are particularly disappointing because it is widely agreed that only a vaccine could end the epidemic (of scaring and poisoning people to death. Last year, more than four million people world-wide contracted (no, dummy, they were falsely diagnosed as having contracted) HIV, the virus that (only fools still believe in this slogan) causes AIDS, and nearly three million died, according to United Nations estimates. Almost 40 million people are currently living with (a faulty diagnosis of) HIV.

But researchers cautioned against overreacting. Merck's vaccine is one of many in or heading into clinical trials, (oh Gawd, here we go again) and different types of vaccines are known to stimulate different kinds of immunity. For example, an experimental immunization now in human trials that was developed by the HIV Vaccine Research Center of the NIH had shown more-promising results in monkey trials than did the Merck vaccine.

"It isn't the end of the line," said Mitchell Warren, (as long as taxpayers keep throwing money at these morons) executive director of the AIDS Vaccine Advocacy Coalition, a New York group advocating prevention. Merck's data "aren't the answers we wanted, but they will help
improve our other vaccine candidates."

Tuesday, the trial was stopped early by independent overseers known as the Data & Safety Monitoring Board. Comparing two groups -- those who received the vaccine and those who received a placebo -- the overseers determined
there was virtually no statistical difference in infection rates between them, indicating the vaccine wasn't working. Also, the amount of HIV (mistakenly believed to be) in the blood of those who did get infected, a (false) predictor of how fast a person will get full-blown AIDS, was virtually the same in each group.

The ultimate fear among researchers is that the whole theory underlying the Merck vaccine might be flawed, which, if true, could doom an entire class of experimental vaccines.

(No duhhh! Of course the ENTIRE theory underlying HIV and HIV vaccines is flawed. But these fools will need a few more lifetimes to figure that out. Maybe if they had an actual virus that was doing something to Tcells, they might be able to create a real vaccine.)

Most classical vaccines, such as those against smallpox or polio, stimulate the body to produce antibodies that ward off infection. (but of course, that requires there to be a real virus to begin with, instead of just finding biomarkers that are believed to have something to do with the imaginary virus) But stimulating antibodies that neutralize a broad range of HIV strains has been notoriously difficult (because there is no actual virus, just biomarkers), so researchers focused on the other arm of the immune system: killer T-cells, which attack and kill cells that HIV has already infected. Such vaccines have been considered less likely to prevent someone from getting infected; instead, it was hoped they would enable an infected person to suppress the virus and so delay, perhaps for many years, the onset of disease.

"Given that this study was the leading edge" of research on T-cell based HIV vaccines, said Mark Feinberg, vice president for medical affairs and health policy in Merck's vaccine division, "there was great disappointment."

"There is nothing on the horizon" at Merck, he said. "We don't have any other vaccine candidates we've identified as promising enough to advance into clinical studies." Dr. Feinberg added that Merck is "committed to finding ways to share information accumulated over two decades to
facilitate the broader effort" to develop an AIDS vaccine.

The Merck vaccine did stimulate the immune system's T-cells -- a notable development -- but not in a way that helped infected test subjects control the virus. Now, researchers will try to figure out why.

(more evidence HIV has nothing AT ALL to do with t cells)

Merck's shares, reflecting downplayed hopes that such an early vaccine would work, were up 44 cents to $51.82 at 4 p.m. Friday in New York Stock
Exchange composite trading.

Posted by: Michael | September 24, 2007 10:54 PM

Michael,

the "vaccine" folks are pretty desperate at this point it seems.

Think about it. First, they're dealing with something utterly illogical. They're trying to get an immune system to produce...what...? ANTIBODIES! Antibodies to....what...? HIV!!

How do we find out if somebody's (so-called) "HIV positive"? We find...(drum roll, please)..."HIV ANTIBODIES"!

So, the purpose of a vaccine is to help produce...um...oh, yeah...HIV ANTIBODIES. Which, oddly enough, those who've been proclaimed "HIV positive" supposedly possess!

Here's where their desperation kicks in. The AIDS goons (your various and sundry "researchers"), having already set aside the illogic and futility of their undertaking, have gone the extra step in the HIV/AIDS folklore to include the incredible (literally) mutating power of "HIV" into their vaccine equation. It's a way to sidestep the original illogical premise. Good thing these guys get paid, regardless of what idiots they are.

Posted by: Dan | September 25, 2007 12:08 AM

Epidemiology-Lisa, I want to thank you for responding to the Duesberg criticism. You are the only person here who has done that. I think you're wrong, but you get some praise from me for trying. You wrote that,

Duesberg's contention is not that ARVs cause AIDS, but that Drugs, ARVs being among them, cause AIDS.

No, Duesberg's contention IS that ARVs cause AIDS, AND that other drugs can also cause AIDS, AND that malnutrition can cause AIDS. For Duesberg AIDS is caused by one or more of the three factors in the title of his 2003 "review": "The Chemical Bases of the Various AIDS Epidemics: recreational drugs, antiviral chemotherapy and malnutrition"

In that review, Duesberg has some general comments about toxicity of antiretroviral drugs and a few quotes from Jay Levy, de Harven, and the Durban Declaration, but his entire literature-based argument against anti-HIV combination therapy (not AZT monotherapy) is his comments on Palella and Hogg:
"the evidence for 'declining morbidity and mortality' is only based on uncontrolled survey studies that investigated how long HIV-positive, clinically healthy subjects, but mostly from AIDS risk groups, survived on various anti-HIV drugs. The largest and most influential of these surveys was conducted by Palella et al (1998)." From page 399 of the 2003 review.

Epidemiology-Lisa, Duesberg says that all study participants in the Palella study were healthy before taking antiviral therapy and that they were selected for their health; by changing a quote from the paper, Duesberg says that study participants with OIs before the start of the study or within 30 days of follow-up "were excluded."

In other words, Epidemiology, Duesberg takes your concern into account. If AIDS-related health issues were caused by recreational drugs in these patients, they "were excluded" from the study. Duesberg emphasizes this so he can claim that ARVs increase mortality far above what he says is the rate in untreated populations.

His rate in untreated populations is an absurd hypothetical. He gives the impression of being generous by assuming all new AIDS cases for 2000 result in immediate death. But all new AIDS cases for Duesberg are actually all reported newly-diagnosed AIDS cases, a small fraction of total new AIDS cases. Chris didn't just make up that 3 million figure, Epidemiology-Lisa, it's all over the WHO report Duesberg uses. Duesberg had to dig through that report to find a much smaller figure to misrepresent, ignoring 3 million the whole time.

The lies (or whatever you like to call them) needed to support Duesberg's claim:
1)all participants in Palella et al were on anti-HIV drugs (they weren't, and the highest mortality was in the no-drug population, many times the rate for ARVs per 100 person-years)
2)Palella et al excluded anyone with OIs (they didn't, they included everyone in the mortality figures)
3)a total mortality rate from Hogg et al was represented as a per hundred person-year rate
4)Duesberg suppressed the WHO estimate of 2000 mortality in favor of using a reported AIDS case figure and a strange hypothetical of his own

Palella et al find mortality of no-ARV patients usually between 40 and 50 per 100 person years. Compare that with your 30% figure for AZT monotherapy. And Epidemiology, please tell me you are not doing math with Chris Noble's "new and improved" 3 million and the total HIV estimates for 2000. To compare the Palella et al finding (that includes deaths from patients not taking ARVs) with worldwide rates, you would have to consider the group of world wide HIV-positive people alive at the beginning of 2000 who had CD4+ T-cell counts below 100 and find out how many of them died in 2000. Without some good estimates of these numbers, there's no comparison to make.

Best to stick with what the Palella paper found: a no-ARV mortality 7 or 8 times higher than mortality with combination therapy, and higher than AZT monotherapy.

Posted by: ElkMountainMan | September 25, 2007 5:56 AM

John Edwards just promised 50 million to go towards HIV/AIDS worldwide. His plans would include health care, housing, medicare benefits, which is a good idea if elected. Certainly, all other candidates will follow suit and be politically correct. Nevertheless, how much will be handed over to the NIH to go waste on another failed attempt for a vaccine. I would love to be a fly on the wall years from now and listen to all the criticisms of our current, scientific community who won't challenge the HIV hypothesis. In regards to Duesberg, no one is 100% right all of the time but he is on the right track, which is more important.

Posted by: noreen | September 25, 2007 7:39 AM

I must admit that's some cheek if Duesberg says there are no controlled studies, then in the next sentence introduces one pretending it's not controlled. Perhaps you can elaborate?

Have you read the study yet?

You are showing a high degree of devotion to Duesberg if you are so keen to defend him when you haven't even read the papers.

Posted by: Chris Noble | September 25, 2007 8:41 AM

Some ridicule Michael's comments on stress etc. leading to AIDS. How about this article title from The Daily Telegraph, "Ancient Snakebit Treatment Has HIV Hopes." Apparently, a chinese herb used for treating snakebites is showing promising results for AIDS. This research also involved collaboration with the National Cancer Institute and the Division of Pharmacology at Uppsala University in Sweden. Now, if a rethinker had stated this, it would be a front page story here and the rethinker would be attacked.

Posted by: noreen | September 25, 2007 9:24 AM

Now, if a rethinker had stated this, it would be a front page story here and the rethinker would be attacked.

Perhaps you haven't been paying attention for the last half decade at least? The pharma companies have been prospecting everything from animals to plants to ocean life for new sources of drugs. This is nothing novel. Your statement misses the problem with your 'rethinker' attitude. Your quote states "treatment for snakebite shows promise". But when you talk about LDN you don't say it shows promise, you say it works and you are the proof, even though you lack any significant evidence. Notice the difference? Make use of it in the future.

Posted by: apy | September 25, 2007 10:10 AM

Here is an interesting link if anyone is interested in learning about bioelectric medicine.

mehttp://educate-mehttp://educate- yourself.org/cn/LymanKaalibiocompatibleHIV1996report18nov06shtmldicine

Posted by: noreen | September 25, 2007 10:38 AM

chris said
The figure from this study is 159 per 1000 py or about ten times Duesberg's "estimate".

Yeah and that's all HIV+. What do you think it'd be if it was just AIDS patients CD4 lower than a hundred??

Posted by: Adele | September 25, 2007 10:51 AM

So two doctors are going to patent some non-traditional approach to treating viruses without doing any research on the matter. They would look like idiots if they did so. Why don't you open your mind and do some reading about Bob Beck and bioelectric medicine or the MWO but again if it has not been studied and published in standard journals you will pooh-pooh it. How do you think that Indians, and our ancestors treated illnesses, by waiting for it to be published? No, by trail and error. Even today, many progressive doctors,like Dr. Zagon, think outside of the box and use a drug off-label, which works instead of the old I don't care to learn new tricks attitude and I have treated diseases a certain way for eons and will continue to do so.

Posted by: noreen | September 25, 2007 11:16 AM

E-LISA, Ok, so AZT can cause granulocytopenia (and then only in 0.2% more patients than it does in those on placebo).

You do know what granulocytes are, don't you? They are one of several types of white blood cell. Can you tell us the difference between granulocytes and lymphocytes? Do you know that scientists have discovered there are even several different types of lymphocytes? Fancy that! One of these subtypes is called the "Helper" T lymphocyte. They are usually known as CD4+ lymphocytes. Please, please tell us you have heard of these.

In HIV-induced immunodeficency they can drop down to profoundly low levels, but, wouldn't you know it, the rest of the white blood cells are hardly affected.

Can you now give us a citation where it states AZT causes isolated CD4+ lymphopenia? The wonderful Professor Duesberg's literature must be bursting at the seams with references to this phenomenon, since he states categorically that the hematological appearance of AIDS/HIV is the result of treatment with AZT.

As he is not here, perhaps you could do the honours and point us to just one of his references, so we can all bow our heads in shame at our ignorance and go home?

Posted by: DT | September 25, 2007 11:23 AM

for those who enjoy a different approach and viewpoint to medicine.

Or those who need a good laugh??! I like the one where Dr. Beck is he really a doctor? Where he says 51% of pharmaceutical companies are in "the mob"

Thanks noreen!

Posted by: Adele | September 25, 2007 11:41 AM

Beck was an engineer who took old technology and improved on it. Gallo situation was different and you know it. It was stated, "probable" cause of AIDS, This was treated as though it was 100% accurate. Surprisingly, he rushed out to patent his new antibody test for a "probable" causation factor.

Posted by: noreen | September 25, 2007 11:51 AM

Dear all,

Just to let you know that I had a quick look at PUBMED and the guys from the US patent number 518873, Dr. Kaali and Dr. Lyman have published a paper referent to their experiments, but I dont have access to the paper- it is not in my library- so I can not comment.

Lyman WD, Merkatz IR, Kaali SG.
Biocompatible electric current attenuates HIV infectivity.
Surg Technol Int. 1996;5:75-9. No abstract available.
PMID: 15858720 [PubMed]

Noreen, from my experience, (I work in research) any patent can have unreproducible experiments and nobody would really care.

Posted by: Braganza | September 25, 2007 12:08 PM

The point, noreen, is that these usages come from studies, not from some internet person saying "It works for me and I have no evidence that it is the direct result of it!" People thought that there might be something to it and they did studies and some of them come out very positive which is great. But I should hope none of those scientists saw one person taking LDN and saw they were in good health and came to the conclusion "It works!", which is exactly what you are doing. I'm not saying progressive doctors are bad, I'm saying claiming something without empirical evidence is.

Posted by: apy | September 25, 2007 12:35 PM

Dr. Bahari had more than one AIDS patient doing this and now many more now are also doing so, whether you care to believe it works or not. Like the above commentor stated, just being published isn't proof. Maybe Gallo's antibody test does work for 40% of the population.

Posted by: noreen | September 25, 2007 1:44 PM

So Adele, you admit that it is an antibody test. Could you please show me the study that proves antibodies equate to an active infection and that having antibodies to a virus is a death sentence.

Posted by: noreen | September 25, 2007 2:04 PM

Adele, your logic puzzles me. I have numerous antibodies to numerous viruses but do not have an active case at the present. According to your thinking, then I should be on numerous medications for all sorts of viruses. And if a person have antibodies to HIV well, they are told that thet have an incurable disease and must stay on medicines, pretty much for the rest of their life.

Posted by: noreen | September 25, 2007 2:44 PM

Yes, having antibodies to HIV is in fact a good thing. Besides, it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!

Posted by: noreen | September 25, 2007 3:12 PM

Antibodies to HIV, bad, mean youre infected.
Antibodies to HIV, also good! They help neutralize the virus. Some better then others.
No antibodies to HIV on one test, maybe good. You could still have infection just not seroconverted yet.
No antibodies on several tests, best. You aren't infected.

it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!

My god noreen now I believe you maybe you don't read aliveandwell anymore. Not oven the aliveandwell liars say stuff that funny. Are you trying to out deny the big deniers? Viral load measures antibodies? More virus, better health? You got a source or are you in standup improv now?

Posted by: Adele | September 25, 2007 4:24 PM

Noreen, you said:

I have numerous antibodies to numerous viruses but do not have an active case at the present. According to your thinking, then I should be on numerous medications for all sorts of viruses. And if a person have antibodies to HIV well, they are told that thet have an incurable disease and must stay on medicines, pretty much for the rest of their life.

Some examples:
EBV (glandular fever) This can re-emerge to cause things like lymphomas later in life
CMV - can re-emerge if immunosuppression exists such as transplants/HIV
Herpes simplex - antibodies mean exposure, which = infection. This never goes away, but re-emerges from time to time as cold sores/herpes lesions.
VaricellaZoster. Yup, once you've had the chickenpox, you have persisting antibody. Again, it's not protective, and the virus can re-emerge whenever it feels like it.

You don't need to take treatment constantly for these, but may need to if they relapse.

HIV is not really so different. Duesberg could never grasp the concept that for some infections, having antibody can be a sign of dormant or active infection. He relied on his kindergarden grade medicine to dismiss this, thinking antibody = recovery from infection, and therefore "cure".

He has had this point corrected countless times, but it is a sign of his deceitfulness that he has never acknnowleged that he was wrong. You can be brave, and say you are wrong. It's the right thing to do.

HIV infection is not always treated with ART. There is a period of clinical latency when treatment would do no good, so people do not attempt to treat until there have been clinical sequelae or a steady decline in lab markers such as CD4. Many people remain treatment free for many years. Why do you lie by saying we advocate treatment for everyone with the virus?

Posted by: DT | September 25, 2007 7:15 PM

Adele,

Actually I don't find this funny at all:

"it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!"

(I know you really don't either.) in fact it's one of the saddest things about HIV denial for me.

Noreen, despite all her time spent on internet HIV research, has been saying that viral load tests only measure antibodies to HIV for over a year that I know of.

If she can not, or will not, learn what a viral load test is measuring, or what an antibody is, what kind of educated treatment decisions can she be making?

As a side note it's frankly disgusting that a more scientifically literate denier like Bialy, or someone, won't explain the matter to her. I suppose any increase in her actual understanding could jeopardize her committment to denying that HIV is a threat to her health.

Posted by: Roy Hinkley | September 25, 2007 9:13 PM

What do viral loads measure? According to nobel prize winning inventor of the PCR, kary mullis, they were never meant to quantify anything, its a multiplication technique.

Mullis' book on PCR has a whole chapter on quantitative PCR. The technique is used in thousands of fields. It clearly works for everything else. For some reason known only to himself Mullis seems to think that it doesn't work for HIV. If you can find out what Mullis' reasons are then tell me. Ask him about glowing raccoons while you're at it.

Posted by: Chris Noble | September 25, 2007 9:51 PM

Hey cooler, if I take all my dollar bills and make 30 copies of them, and I end up with 31 dollars, how many dollars did I start with?

If I make 30 copies and I end up with 310 dollars how many dollars did I have to start with?

If I make 30 copies and I end up with 31,000 dollars how many dollars did I have to start with?

If I make 30 copies and I end up with 310,000 dollars how many dollard did I have to start with?

...

Cooler, would you be so kind as to explain to Noreen that no PCR based technique measures any antibodies of any kind and then go on to tell her what sort of nucleic acids would be amplified in a viral load assay?

Posted by: Roy Hinkley | September 25, 2007 11:29 PM

lots of spelling errors............im half asleep

Posted by: cooler | September 26, 2007 12:09 AM

"dont try and bully me with your techical BS"

Sorry Cooler, I should have realized that division and subtraction were beyond your capabilities.

My sincere apologies.

Really though, anyone with bachelor's degree in biology ought to be able to explain PCR Cooler. Are you telling me you don't even have a BA in biology?

Yet you come here and argue with, and insult, a professor of epidemiology, among others?

I'd like to believe this explains your inability to separate a fiction novel from actual scientific research but I'm afraid even an English major would have no trouble distinguishing the two.

So, ... what was your major Cooler?

Underwater Basket-weaving?

Posted by: Roy Hinkley | September 26, 2007 2:38 AM

Why don't you mainstream thinkers concede that many HIV-Positives, who don't believe in HIV, are surviving quite nicely without antiretrovirals. In fact, I would be so bold to state that AIDS can certainly be cured by the use of drugs temporarily, by taking supplements, herbs and by cleaning up one's health habits. Now, all of you can have a field day with that comment but it is true. This is precisely how I have managed to do so.

Posted by: noreen | September 26, 2007 6:56 AM

Why don't you mainstream thinkers concede that many HIV-Positives, who don't believe in HIV, are surviving quite nicely without antiretrovirals.

So...I only have to believe in something for it to be a problem? I didn't realize wish-full thinking was so powerful.

And I'm not sure why you keep on coming back to this noreen. As stated above, by me, and quite a few other people, the elite controller group is recognized. Unfortunately in your warped mind the presence of an elite controller group seems to mean everyone is an elite controller and AIDS doesn't really exist or something like that.

Considering you accuse everyone who disagrees with you of having a closed mind, perhaps you could show us how open minded you are by telling us where you studied biology and/or medicine? Even if you disagree with it you could atleast put forth the effort of understanding the mainstream claims since your arguments seem to be based on a complete ignorance of it. Do you know how PCR works? Have you ever done a PCR? If you don't then why are you so critical of a procedure you do not know?

Posted by: apy | September 26, 2007 9:56 AM

Why influenza vaccination, as spontaneous influenza, can increase viral load in HIV+ patients?

Posted by: Braganza | September 26, 2007 10:55 AM

hhaahahahahahahahah hinkley, youre a professor and you cant give me the reference for the first scienific paper that proves hiv causes aids, you cant give me a electron microscopic picture from a patients blood showing these 1,000000000 viral load counts.

Where did you do your graduate work, coco birds online university for dummies?

No wonder youll never debate mullis or duesberg, youll get embarrased.

Noble, nicolson and lo never used the PCR to quantify, they used it to detect microbes. shyh ching lo never used the PCR to quantify, he used the electron microscope and took pictures of animals/people teeming with infectious bacteria(mycoplasma incognitus)to quantify.

Hinkley, you bozo, maybe you should learn from your scientific elder, Dr. LO md phd armed forces of pathology cheif to find out how to really quantify a microbe, with the electron microscope, not the PCR.

Project day lily is not fiction, he had to slightly fictionlize it to stay out of court, but the events are true. rave reviews from several scientists, including a nobel laurete.

Remember, hinkley, do your homework and learn from lo how to really quantify/see a host being damaged with high titers of virus, its with the electron microscope, im sorry you didnt know that, maybe you can ask for a refund for your tuition.

read project day lily google it

see hiv fact or fraud google it

Posted by: cooler | September 26, 2007 12:06 PM

Sorry Braganza there's alot more on this. Some people say it does some people say it doesn't.

So if you vaccinate someone your changing their immune system. So its possible a vaccine activates some cells and gives a virus better places or more places to make copies. If a influenza vax does that in HIV+ then there might be more viral load for awhile. There's alot of influenze vaccines so maybe some do and some don't. I'm adding a list I found on cdc.

http://www.cdc.gov/mmwR/preview/mmwrhtml/00047346.htm

Vaccination of Persons Infected with HIV Chapman L, Hartley M, Khan A, et al. Changes in plasma HIV RNA after immune activation by vaccinations and acute illnessess {Abstract}. In: Program and abstracts of the 2nd national conference: human retroviruses and related infections. Washington, DC: American Society for Microbiology, 1995. Glesby MJ, Hoover DR, Farzadegan H, Margolick JB, Saah AJ. The effect of influenza vaccination on human immunodeficiency virus type 1 load: a randomized, double-blinded, placebo-controlled study. J Infect Dis 1996;174:1332-6. Huang KL, Ruben FL, Rinaldo CR Jr, Kingsley L, Lyter DW, Ho M. Antibody responses after influenza and pneumococcal immunization in HIV-infected homosexual men. JAMA 1987; 257:2047-50. Jackson CR, Vavro CL, Penningron KN, et al. Effect of influenza immunization on immunologic and virologic parameters in HIV+ pediatric patients {Abstract}. In: Program and abstracts of the 2nd national conference: human retroviruses and related infections. Washington, DC: American Society for Microbiology, 1995. Miotti PG, Nelson KE, Dallabetta GA, Farzadegan H, Margolick J, Clements ML. The influence of HIV infection on antibody responses to a two-dose regimen of influenza vaccine. JAMA 1989;262:779-83. Nelson KE, Clements ML, Miotti P, Cohn S, Polk BF. The influence of human immunodeficiency virus (HIV) infection on antibody responses to influenza vaccines. Ann Intern Med 1988; 109:383-8. O'Brien WA, Grovit-Ferbas K, Namazi A, et al. Human immuodeficiency virus-type 1 replication can be increased in peripheral blood of seropositive patients after influenza vaccination. Blood 1995;86:1082-9. Safrin S, Rush JD, Mills J. Influenza in patients with human immunodeficiency virus infection. Chest 1990;98:33-7. Staprans SI, Hamilton BL, Follansbee SE, et al. Activation of virus replication after vaccination of HIV-1-infected individuals. J Exper Med 1995;182:1727-37. Steigbigel RT, Craddock BC, Cate TR. Antibody responses to influenza vaccination in HIV-infected people and effect of HIV load {Abstract}. In: Program and abstracts of the 33rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Washington, DC: American Society for Microbiology, 1993. Thurn JR, Henry K. Influenza A pneumonitis in a patient infected with the human immunodeficiency virus (HIV). Chest 1989;95:807-10. Yerly S, Wunderli W, Wyler CA, et al. Influenza immunization of HIV-1-infected individuals does not increase HIV-1 viral load. AIDS 1994; 8:1503-4. Vaccination of Foreign Travelers CDC. Update: influenza activity -- worldwide and recommendations for influenza vaccine composition for the 1990-91 influenza season. MMWR 1990;39:293-6. CDC. Acute respiratory illness among cruise-ship passengers -- Asia. MMWR 1988; 37:63-6.

Posted by: Adele | September 26, 2007 12:26 PM

So ElkMountainMan, you think that I should go back on antiretrovirals even though I haven't any AIDS symptoms? Why would I do this when both tests have not been approved to detect the HIV virus? Besides, now for a change, my blood work is normal including my liver enzymes. I was constantly anemic while on the meds. I am not anti-meds, only against them when they are not necessary.

Posted by: noreen | September 26, 2007 12:41 PM

Actually, it is not from rethinkers site. Show me Adele where these test have been validated. If I listened to you folks you know good and well that AIDS doctors would immediately place me on the meds even though I am not sick and dying. Nice try but peddle your gloom and doom elsewhere.

Posted by: noreen | September 26, 2007 1:06 PM

Nice try but peddle your gloom and doom elsewhere.

Nobody said you had to go on them, you have the worst selective reading. Most of the criticism against you here, and indeed all of mine as far as i know has not been about your decision not to take ARV's but your peddling of untested treatments, your complete logical contradictions, your apparent inability to verify anything you read, apparent inability to read and comprehend other posts directed at you, as well as your apparent lack of understanding of the concepts that you so easily badmouth.

Posted by: apy | September 26, 2007 1:27 PM

You post that the FDA approved them for measuring antibodies in the blood, which by the way is no surprise. However, I asked where has the FDA approved them or any other test for measuring the ACTUAL VIRUS? We are waiting!

Posted by: noreen | September 26, 2007 1:54 PM

I don't see any mention of antibodies in Adele's post, it specifically says 'viral load'. This is the selective reading thing I alluded to before.

Posted by: apy | September 26, 2007 2:23 PM

Noreen I'm not asking you anything hard! You just wrote it 7:49 AM this morning so you must know where you got it from.

I just want to know where you got these quotes so I can read them myself. I'll remind you what you said

How can the viral load and HIV antibody tests be defended when both come with the following disclaimers: "At present there is no recognized standard for establishing the presence or the absence of antibodies to HIV-1 and HIV-2 in human blood" and "The Amplicor HIV-1 Monitor test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection"

Posted by: Adele | September 26, 2007 3:29 PM

jspreen, it sounds like you are suggesting that if I don't believe in a bullet then I have nothing to fear from one being fired at me. Is this correct?

You shouldn't write down the first thing that pops up into your brain within half a second of reflexion. In my previous message I told you to not stop thinking before you saw the light, remember? Anyway, you may try to not believe in a bullet or to not fear an agressive crook with a gun, but I figure you won't get far. Which doesn't totally exclude the eventuality that somewhere on the globe a person exists who mastered that trick and who has no bullet to fear. But a guy who just started a judo course shouldn't immediately try to floor a black ribbon so let's do some steps backwards and try to figure out an easier example.

A kid who climbs trees without ever even thinking he might fall, won't fall. A kid who climbs trees with the fear to fall, will certainly fall out of a tree one day.

Now, one step higher. HIV. The HIV=Aids equation is absolutely nonsense and only dangerous for people who believe in it. How do I know that? Simply because before the eighties HIV was never a problem and only the simplests of minds can believe that HIV popped up in nature, not one million years ago, not in 3425 BC, not in 1546 AC, no, it came to earth exactly when some virologists were badly looking for it. And what came with it? Fear. FEAR. And people who fear do the stupidest things and believe the stupidest stories. For instance, they believe guys who tell the toxic chemicals they make money with is good for one's health. Or, for instance, they listen to a theory which only approximately sticks together with super glue and is kept standing up by people who's monthly paycheck depend on that theory.

You want a world without AIDS? Close your eyes, stop listening to bullshitters and you have it. Which doesn't mean the world would be without people suffering from what is called today immunity deficiency. But the problem wouldn't be the same anymore. At all. For instance, a phrase like Hey there's a guy with AIDS, he needs ARV's! might become something like Hey, there's a guy who's starving, he needs bananas!

Posted by: jspreen | September 26, 2007 3:58 PM

You shouldn't write down the first thing that pops up into your brain within half a second of reflexion. In my previous message I told you to not stop thinking before you saw the light, remember?

What light is there to see? You said that if you don't believe in something then it cannot harm you so I gave a simple example and asked if that is what you meant. Is your 'advice' selective? It only works for bacteria and not for bullets? I don't want vagueness I want you to be specific and state your meaning not some fortune cookie saying and tell me there is some nonexistent light to seen because you have a warped concept of reality. If your brilliant idea can't withstand a question as direct as what a 4 year old would ask maybe it's not that good.

Posted by: apy | September 26, 2007 4:32 PM

What light is there to see?

May I suggest you read my previous message to the end before you start hammering on your keyboard?

Posted by: jspreen | September 26, 2007 4:52 PM

May I suggest you read my previous message to the end before you start hammering on your keyboard?

Your argument falls apart in the first sentence so what is the point? You realize that in order for your high level argument to work it's foundation needs to work too right?

Posted by: apy | September 26, 2007 4:54 PM

Umm..didn't she answer your question already? The one that showed the FDA had passed a viral load test, which is the exact thing you asked for?

Posted by: apy | September 26, 2007 5:37 PM

For those too lazy to search wikipedia:

http://en.wikipedia.org/wiki/Viral_load_test

Several different HIV viral load tests have been developed, and three are currently approved for use in the US:

* Amplicor HIV-1 Monitor test (Hoffman-La Roche), better known as the PCR test
* NucliSens HIV-1 QT, or NASBA (bioMerieux)
* Versant/Quantiplex HIV-1 RNA, or bDNA (Chiron/Bayer)

These tests have been approved by the Food and Drug Administration in the United States for use in monitoring the health of people with HIV, in conjunction with other markers.

Posted by: apy | September 26, 2007 5:59 PM

You guys are pathetic beyond belief. You know very well what Noreen means. The PCR tests have been validated for counting small pieces of RNA, but none of them has yet been validated for verisfying on its own that the RNA pieces it counts means you are infected with "HIV" - like so:

The AMPLICOR HIV-1 MONITOR Test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection

Courtesy of DT.

I repeat, you are pathetic beyond belief!

Posted by: Epidemiology-LISA | September 26, 2007 6:57 PM

Have they verified this test against those who test HIV-Negative? Did you catch that it is to be used when the person has HIV-Positive Antibodies? This to me is red flag. Let's run this test on HIV-Negative persons and then I would consider it to be a valid test.

Posted by: noreen | September 26, 2007 7:37 PM

Noble, DT, Adele, Apy, Framklin.

Why are you here? Isn't this getting a little "old Hat" for you by now?

Carter

Posted by: carter | September 26, 2007 9:58 PM

You know very well what Noreen means. The PCR tests have been validated for counting small pieces of RNA

Epidemiology-Lisa, when you are standing at a bookshelf in the library and a hand appears at the end of the row, apparently suspended about four feet from the ground and pressing buttons on a cell phone, do you assume the hand is disembodied, somehow floating about amongst the collection of books and using a cell phone of its own accord?

Unless you recently partook of some very serious drugs, I should sincerely hope not! Yet this is exactly what you assume of what the various HIV nucleic acid amplification tests (NAATs) detect. They amplify a nucleic acid sequence that is far too large and complex to appear on its own, by chance mutation of a human sequence (like the hand and its cell phone). They identify a sequence that is unique, not confused with any "relatives" (just as you could tell that the hand you saw was a human hand, not the paw of a dog or even the hand of a chimp). This sequence is unambiguously an integral part of the genome of a virus called HIV.

You are not a scientist, Epidemiology-LISA, but several rethinkers do apparently have scientific credentials. Unlike you and Noreen, carter and cooler, they (should) know what DNA is, what RNA is, how PCR works, and all the rest. They have had many years now to demonstrate the existence of a single nucleic acid sequence present in the human genome or in the genome of a bacterium, fungus, or virus that could be found in a human and would have enough identity with HIV to possibly cause a false positive on these validated NAATs. Today, courtesy of Japan, the EU and the US government, nucleic acid sequence information is available to everyone with internet access. No NIH grants are needed, no well-equipped laboratories; just a computer and an internet port. The silence you hear is the sound of the Big Deniers doing nothing to find that sequence...or reporting the sequences they have found: none.

Chris linked to the PI for the APTIMA test, but I suspect that few rethinkers will read it for fear of having to rethink.

Samples from three low-risk groups (blood or plasma donors) were tested.
First group: 6 out of 2508 tested positive. They were not re-tested, so we can't conclude whether they were initial false, repeated false, or true positives in the acute phase of infection.
Second group: 0 out of 1007 tested positive.
Third group: 2 out of 1701 tested positive, but on re-testing were negative.

A specificity of 99.9% is remarkable.

For over 1000 known positive samples, sensitivity was 100%.

To sum this up: APTIMA is a diagnostic tool, FDA-approved with a sensitivity of 100% and a specificity of almost 100%.

Posted by: ElkMountainMan | September 26, 2007 11:05 PM

Unlike the viral load tests, the APTIMA test has been approved for the diagnosis of primary HIV-1 infection, as well as for confirming HIV-1 infection when tests for antibodies to HIV-1 are positive.

Even this test requires back-up when possible. Fact is the have for along tinme used unapproved PCR tests as proof of primary infection. It was ony a matter of time before they were forced to approve one of them. And Dr. Noble get some reading glasses will ya, Noreen was talking about the viral load tests.

Mr. Elk science lecturer. The reason why I assume the hand is not disembodied is because I daily see many instances of real hands attached to real bodies in vivo.

Or to put it differently, how do you know the "known positive" samples are positive in the real world?

Posted by: Epidemiology-LISA | September 27, 2007 3:16 AM

Even this test requires back-up when possible. Fact is the have for along tinme used unapproved PCR tests as proof of primary infection. It was ony a matter of time before they were forced to approve one of them. And Dr. Noble get some reading glasses will ya, Noreen was talking about the viral load tests.

Noreen was talking about a test that measures actual virus rather than antibodies. All nucleic acid tests detect actual virus. Some are designed primarily for quantitation and some are designed like the Aptima test for diagnosis of HIV infection.

Noreen wrote:

However, I asked where has the FDA approved them or any other test for measuring the ACTUAL VIRUS? We are waiting!

I am overwhelmed by the silence when I gave her such a test. Apparently all the denialist websites haven't been updated since 2006.

In reality the viral load tests, although unapproved for diagnostic purposes, had high sensitivity and high specificity when good quality control procedures were used. Many labs scored 100% specificity and 100% sensistivity using these tests compared to antibody testing.

I can imagine what would happen if a Denialist fell off a cruise ship. The Denialist can't swim and starts to drown. Somebody throws him/her an inflatable pool toy that was on the deck. The Denialist manages to reach the inflatable toy. Then they read the label on the toy: "Warning this toy is not intended for use as a flotation device". The Denialist throws the toy away in disgust. The Denialist drowns.

Posted by: Chris Noble | September 27, 2007 6:18 AM

In reality the viral load tests, although unapproved for diagnostic purposes, had high sensitivity and high specificity when good quality control procedures were used.

Yeah! They're highly sensitive and specific but that's kept secret because the manufacturor doesn't really want people to use hem.
How full of shit are you, Noble? I remember, already back in december 1999 one couldn't send a HIV=Aids questioning message to an Internet discussion forum without having a named Chris Noble on one's back within an hour. How do you earn your living, Chris, if all you do is hangin' around on the Internet to answer a denier post wherever and whenever it pops up? Are you payed per message? If yes, I'm quite jealous of you.
I've done some nudge-nudge wink-winking to where the big money is, a year or so ago, but no reaction at all. You can read my latest attempt here. Can you check it out for me and tell me where I missed the boat? Let's say fifty-fifty, OK?

Posted by: jspreen | September 27, 2007 8:03 AM

please tell us how HIV-Negative persons have had high viral loads and why the CDC does not want this test run on HIV-Negative persons?

"HIV-Negative persons" do not have high viral loads. This is a myth from virusmyth or another rethinker group. The very few cases in which seronegative people test positive by PCR are almost certainly due to laboratory error (which should be rectified by repeat testing) or to actual acute-phase HIV-infection prior to seroconversion.

From the APTIMA literature:
5,200 people presumed negative by donor screening
8 tested positive by APTIMA
2 of the 8 were negative on re-test
the other 6 were not retested

I repeat: the APTIMA HIV-1 RNA test was used to test more than 5,200 people in low-risk donor populations. A total of eight (8) tested positive on the initial test. Two of these were re-tested and were negative. The remaining six were not retested. They could be false-positives due to error, they could be cases of early HIV infection, or they could be true false positives. In any case, this test has an extremely low false-positive rate. For a single test in the groups above, the rate is between 0.1 and 0.2%. Using a repeat testing protocol on the cohorts mentioned above, it would likely be somewhere between 0 and 0.1%.

Noreen's difficulties with giving her sources make it hard to refute her claims. Where, for example, does the CDC say that the APTIMA test should not be used for HIV-negative persons? (For that matter, why should a known HIV-negative person take the APTIMA test, anyway? I thought that rethinkers oppose testing in general, and especially in low-risk populations.)

In terms of "high" viral loads in HIV-negative people, Noreen has clearly not read the few papers on this subject referenced by denial doctor Matt Irwin and Alive and Well. One of these papers describes one individual who had a single positive viral load test, a test that was subsequently negative. Other labs tested the original sample and found it to be negative. This indicates lab error in the original measurement, not a viral load in a HIV- person.

Performing quantitative PCR assays is not trivial. A typical assay will require the use of several positive controls (purified HIV RNA and inactivated virus from positive serum) and negative controls (known negative serum, zero template copies). Because positive controls are present, contamination is always a possibility. It is a good practice to re-test an initial positive sample.

The reasons for a NAAT initial positive in a low-risk, EIA-negative population, in order of decreasing likelihood, are:

Error (equipment problems, human error including contamination)
Actual infection in the acute phase (very low probability)
True false-positive (may not occur at all in well-validated tests like APTIMA)

Posted by: ElkMountainMan | September 27, 2007 8:53 AM

Braganza and Noreen you are both confused about what PCR is. Wikipedia tells you about PCR just look up PCR and you will find out how it works.

HIV pcr does not measure endogenous retroviruses. This is another crap story from the deniosaurs. I do PCR alot and I some times sequence it and people I work with sequence their products they get from PCR. They never get an endogenous sequence from a exogenous retrovirus PCR. I don't get endogenous sequences either. If their good PCR tests are totally specific. Like APTIMA, APTIMA rocks! APTIMA uses at two sequences in HIV not just one. There's no way it measures endogenous stuff. No way in hell!

You might think why is that? But I can't even explain it if you don't know what PCR is. If that's you go take a molbio class at a college and read a little bit, you probably will understand and if you don't ask me then I'll tell you.

Posted by: Adele | September 27, 2007 11:51 AM

cooler or should I say BillyBipBip is back in action with the 9-11 Twoofers, comment from Sept 25 2007

www.911blogger.com/node/11604

Who can deny this is our very own cooler except cooler himself??

Posted by: Adele | September 27, 2007 1:14 PM

Adele,

You should know more than me about PCR because you are working with it, and I am not even a biologist. My knowledge of PCR is limited to a small number of papers/patents/web pages that I have been looking at, and mainly to the info from this blog.

If I understand you well, PCR of HIV would just pick up sequences that would be specific to the virus.

But how can we be sure that there is no another virus which would have an evolutionary link with HIV?

The paper that I picked up is from 1999. I assume that the info there published was unknown until 1999.

I assume that in 2007 many others viruses are not yet known, and still many more are not fully sequenced.

So, as not everything on viruses is known, how the persons who develop PCR's would know =?

My answer would be (I may be wrong) guesswork and using assays such as the one that ElkMountainMan reported in his post. If the particular set of people, participating in the assay, don't have a particular group of retroviruses that may have an evolutionary link with HIV, and may exist in another specific set of people, the indicated assay may still led to false positive. At this stage, could you exclude this hypothesis ?

Posted by: Braganza | September 27, 2007 1:51 PM

Tony-Lisa,

Positive control for APTIMA HIV-1 test is purified reference standard. It's the virus sequence itself you know the one from virions we isolated in the sucrose gradients. You know the sequence you don't find in human's genome. You know the one whose closest relative is HIV-2 and then SIV and other mamal's lentiviruses. You know the one thats as much like a endogenous retrovirus as a bus and an airplane.

You like word games I know it's so fun to say everything is circular logic and "gold standard" and stuff like that you get from the little denial manuals but in the end you're just ignoring the facts and talking about very simple things you don't let yourselve understand. Your like me trying to teach literature grad students about Leda and the sawn well except I would like to learn more about Leda and swans.

Posted by: Adele | September 27, 2007 2:22 PM

Braganza good questions, there's always possible there's other viruses out there we didn't see yet.

We can say HIV-1 PCR doesn't measure endogenous retroviruses. That's because we know all the endogenous retroviruses and even the stuff related to them in humans. Plus before the genome got published there was data about how HIV probes can stick to stuff in the human genome and they looked at what itt was. It was published in Horwitz MS et al in the Journal of Virology 1992. And they found just two sequences and they were very small and they weren't apart of any working endo virus any way. They wouldn't affect the HIV-1 PCR.

So then what the exogenous retroviruses? There's probably lots we don't know yet that's true. It'd be strange if there was one that's close enough to HIV in all the parts we use in PCR testing that it gets recognized. But still different in the other parts so you could call it a different virus. It's possible though, I guess. It would have tobe real close to HIV by evolution and that would be very interesting to study and maybe could help against HIV infection. That's all still hypathetical but it is possible I admit that. And other people know that to, that's why doctors want to get confirmation of antibody test with Western blot and viral load, more confirmation says definitely this is HIV not a HIV related virus we don't know yet.

Posted by: Adele | September 27, 2007 2:40 PM

Most of you can believe in HIV, viral load tests, CD4's and antibody tests if you like but many of us who defile what is considered normal do not.

Maybe because you don't know a thing about any of those and prove it over and over again but for some reason, perhaps you have seen too much of The View, you think an uneducated opinion is some how better than an educated one.

Posted by: apy | September 27, 2007 4:16 PM

Adele, im sorry, kathy bates from the movie misery,
Are you so pathetic you have nothing to do but troll the internet like the loser that you are? oh sorry forgot you are that pathetic. Ive posted my 9/11 beleifs all over these blogs its no secret you idiot, 9/11 seems to have been a false flag operation, Id rather beleive that, then be a miserable loser like you are.

Millions of people are coming to this belifs, including 150 architects from the bay area, who should I trust you, a loser with no job who trolls the internet all day, or them?

Posted by: cooler | September 27, 2007 4:46 PM

Positive control for APTIMA HIV-1 test is purified reference standard. It's the virus sequence itself you know the one from virions we isolated in the sucrose gradients. You know the sequence you don't find in human's genome. You know the one whose closest relative is HIV-2 and then SIV and other mamal's lentiviruses. You know the one thats as much like a endogenous retrovirus as a bus and an airplane.

No Adele I didn't know all that. So what you are saying is in determining the specificity of APTIMA you simply check if it picks up what it is primed to pick up?

Based on "isolated virions" as depicted here?

http://healtoronto.com/hiviso.html

Which must be a deadly pathogen because the genetic sequence is not found in the human genome?

That's all very interesting; I thank you for volunteering that information. However my specific question for you was this - frankly I don't know how you could miss it - if the "purified reference standard" for the PCR tests are highly preserved sequences of the "HIV genome", how come one and the same test kit couldn't pick up all strains from the very beginning? I might now add, how was it determined that there was such a thing as a problem of false-negatives?

Posted by: Epidemiology-LISA | September 27, 2007 5:10 PM

thanks misery women,
youre insight is very compelling. LOL

Posted by: cooler | September 27, 2007 5:25 PM

Tony,

How should I measure rainfall? How do I know if a telescope works? I give a rain gage water and I give a telescope light. Thats what their designed to measure. That's what you use for benchmarks.

APTIMA too. Its designed to measure HIV. You test it using a HIV you purified. What do you think they should use a bicycle tire?

Posted by: Adele | September 27, 2007 6:14 PM

Noreen, from your own accounts you are taking an unapproved drug.

Low dose naltrexone has not been approved by the FDA. It has not been approved for the treatment of HIV infection (or AIDS if you deny that HIV exists or causes AIDS).

Posted by: Chris Noble | September 27, 2007 7:10 PM

Dr. Noble, you are right the high priest of the FDA has blessed this test but that doesn't prove HIV causes AIDS nor does it prove that any tests have been validated. You guys are the ones on a sinking ship and need a life-line!

And the FDA has approved LDN many years ago, which is not in the same category as the unapproved drugs. LDN is being used off label, which many drugs are used for by the way.

Posted by: noreen | September 27, 2007 7:41 PM

Ah just as I thought, the cavalry has arrived. Listen Dr. putting-a-lot-of-paid-effort-into-your-answers-Noble,

You don't measure specificity by seeing whether it picks up HIV sequences when it should. That is sensitivity. You measure specificity by making sure that it doesn't pick up HIV sequences when it shouldn't ie. in non infected people,

According to Adele, there is no question of "picking up when it should". The test is confirmation unto itself that it only picks up "when it should", because it is by virtue of its primers 100% a priori HIV SPECIFIC.That's what THAT was about.

As you might have noticed I was speaking of sensitivity in exactly the context you deem appropriate.These were the words:

"Sensitivity", or lack thereof, comes under the false-negative question., False-negative = "to do with whether it picks up HIV when it should". Get it now? Fer cripe sake, don't they pay you enough to buy a new pair of reading glasses, Dr, Noble. Then again looking at your abysmal performance these days it's a wonder they don't just retire you.

Howbeit, my actual question, General Custer, didn't contain either of the words "specificity" or "sensitivity" and, although you're sligthly better at the divert-and-obfuscate game than poor Adele, we've all noticed that yo uhaven't answered it either, although I'm sure a lot of effort went into your bowel movements in producing above non-answer.

So I suggest he 7th cavalry ups its game or calls in Petraeus, cuz Crazy Horse isn't even breaking a sweat so far.

Posted by: Epdemiology-LISA | September 27, 2007 8:42 PM

Elisa your question did contain the word "specificity" and the way you used it indicated that you didn't understand its meaning.

No Adele I didn't know all that. So what you are saying is in determining the specificity of APTIMA you simply check if it picks up what it is primed to pick up?

The allegation made by Noreen was that there aren't any tests approved by the FDA for detecting actual virus as distinct from antibodies.

This was easily shown to be false.

Now instead of admitting that Noreen (and the denilaist websites she copied from) were wrong you launch into another fruitless denial of reality.

The evidence that the Aptima test works as described is given in the document I linked to.

Now in a surreal twist we've moved back to HIV has never been isolated crap. This is the default crank position to falll back to whenever evidence gets in the way of denial. Its a step in the rejection of science. The next step is to reject the "germ theory of disease".

Posted by: Chris Noble | September 27, 2007 9:03 PM

Hey Chuck,

Do you have a reference for this factoid?

Posted by: franklin | September 27, 2007 9:46 PM

My dearest general Noble Custer, how can you expect to discuss the specificity of NATs without getting into the question of isolation and "identification" of socalled "HIV"?

The document didn't tell me what was used as gold standard for determining that "the Aptima test works as described". Adele told me it was the sequenced HIV that was used as reference. That led to 2 questions

1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can't the same kit pick up on all strains.

I have now asked 4 times, all I get is whining. Could you not at least whistle Garryowen?

Posted by: Epidemiology-LISA | September 27, 2007 9:53 PM

Tara said:

"However, these stats, if true (I'd like a reference also), do show that the HIV antibody test doesn't produce nearly as many false-positives as deniers claim it does...

Tara, how is it that YOU PERSONALLY know that the eleven out of 7000 are actually positive, and not also false positive?

Do tell how you have verified this. After all, the manufacturers claim only 99% accuracy. Surely 11 out of 7000 falls right in with their 1% false results.

Posted by: Michael | September 27, 2007 10:25 PM

Hey Franklin. You like references to factoids?

How's this from the Sept. 1 edition of The Journal of Immunology?

A quote from the researcher: ""But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS"

Source: http://www.sciencedaily.com/releases/2007/09/070906145322.htm

Franklin, as well as Chris, Elk, DT, et al:

Care to explain why HIV positives are being given your much touted HIV drugs according to their CD4 count when obviously CD4 counts have NOTHING TO DO WITH PROGRESSION TO AIDS?

By the way, You guys have been telling us for 20 years that HIV depletes CD4 cells which results in AIDS. Seems you have again been mistaken.

We dissidents are patiently waiting for your explanation and apologies.

Posted by: Michael | September 27, 2007 10:34 PM

Michael,

Based upon the reference you provided, I conclude that you accept SIV as a valid animal model for AIDS.

Congratulations, that is a big first step for you.

Posted by: franklin | September 27, 2007 10:42 PM

Franklin, your non answer says it all. It says HIV and you yourself are total frauds.

Keep trying, Frankie. And after you explain the last two, then explain the latest from BMJ Specialty Journals
Date: September 14, 2007

Science Daily -- Differences in sexual behaviours do not fully explain why the US HIV epidemic affects gay men so much more than straight men and women, claims research published ahead of print in the journal Sexually Transmitted Infections.

But I thought TEAM VIRUS claimed that HIV was sexually transmitted. Here is another study that shows the theory to be total nonsense.

Hurry Franklin, your favorite fantasy is falling apart. Explain these three current research pieces fully, since YOU are telling us the virus kills cd4 cells to cause AIDS, and you are the one telling us how wonderful gene sequencing is at determining hiv infection and who infected who, and you are the one telling us how sexually transmissable the invisible virus that you yourself have never seen.

Franklin. Your big ship HIV lollipop is slowly sinking. Enjoy the trip.

Posted by: Michael | September 27, 2007 10:50 PM

http://www.sciencedaily.com/releases/2007/09/070913132930.htm

In 2005, over half of new HIV infections diagnosed in the US were among gay men, and up to one in five gay men living in cities is thought to be HIV positive.

Yet two large population surveys showed that most gay men had similar numbers of unprotected sexual partners per year as straight men and women.

US researchers applied a series of carefully calculated equations in different scenarios to study the rate at which HIV infection has spread among gay men and straight men and women.

They used figures taken from two national surveys to estimate how many sex partners gay men and straight men and women have, and what proportion of gay men have insertive or receptive anal sex, or both.

They then set these figures against accepted estimates of how easily HIV is transmitted by vaginal and anal sex to calculate the size of the HIV epidemic in gay men and straight men and women.

The results showed that for the straight US population to experience an epidemic of HIV infection as great as that of gay men, they would need to average almost five unprotected sexual partners every year.

This is a rate almost three times that of gay men.

Posted by: Michael | September 27, 2007 10:56 PM

My dearest general Noble Custer, how can you expect to discuss the specificity of NATs without getting into the question of isolation and "identification" of socalled "HIV"?
The document didn't tell me what was used as gold standard for determining that "the Aptima test works as described". Adele told me it was the sequenced HIV that was used as reference. That led to 2 questions

1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can't the same kit pick up on all strains.

I have now asked 4 times, all I get is whining. Could you not at least whistle Garryowen?

Posted by: E-Lisa | September 27, 2007 11:12 PM

Michael,

Here is your first question:

Hey Franklin. You like references to factoids?

How's this from the Sept. 1 edition of The Journal of Immunology?

A quote from the researcher: ""But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS"

Source: http://www.sciencedaily.com/releases/2007/09/070906145322.htm
Franklin, as well as Chris, Elk, DT, et al:

Care to explain why HIV positives are being given your much touted HIV drugs according to their CD4 count when obviously CD4 counts have NOTHING TO DO WITH PROGRESSION TO AIDS?

By the way, You guys have been telling us for 20 years that HIV depletes CD4 cells which results in AIDS. Seems you have again been mistaken.

Your criticism is based on results obtained studying SIV infection of monkeys. I was impressed that you accept that results using the SIV model are relevant to human AIDS, since this acceptance indicates that you beleive SIV infections of monkeys is a valid model of human AIDS.

As usual, the answer to your question is present in the very paper to which you directed us:

SIV Infection Of Natural Hosts Provides New Insights Into HIV Disease Complexity

Science Daily -- Three related papers published in the Sept. 1 edition of The Journal of Immunology provide key new insights into the complexity of HIV/AIDS.

Don Sodora, Ph.D., a principal investigator in SBRI's Viral Vaccines Program who recently joined SBRI from the University of Texas, Southwestern Medical Center, is senior author on one of three papers that collectively show CD4 T-cell depletion, a critical symptom of AIDS, is likely a part of a multifaceted scenario that triggers disease rather than the only cause.

In an HIV-infected person, CD4 T-cells (white blood cells that play a central role in creating immunity) decline and, at a certain point, the person gets sick and dies. This rapid and dramatic loss of CD4 T-cells is considered to be a key determinant of AIDS disease. However, in natural hosts, like the sooty mangabey (an African monkey species), simian immunodeficiency virus (SIV) induced CD4 T-cell depletion can be comparable to that in humans, but the monkeys do not show clinical signs of AIDS. "Our assessment of these natural hosts like mangabeys offers insight into the disease and shows us that progression to AIDS likely results from the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction," said Sodora.

Sodora's paper provides evidence, using the sooty mangabey SIV natural host, that virally induced CD4 T-cell depletion, by itself, is not sufficient to induce AIDS in a natural host. "When we first observed the dramatic CD4 depletion in all the tissues we examined in these monkeys, we were concerned that they might begin to exhibit clinical signs of AIDS," said Jeffrey Milush, Ph.D., lead author on the paper. "But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS".

The conventional view that HIV is the cause of AIDS does not depend on the straw man argument that the pathogenesis of AIDS is entirely the result of CD4 T cell depletion. As the very paper you cite states, CD4 T-cell depletion is merely one of the key events in the pathogenesis of AIDS.

According to the reference you cite, processes beleived to contribute to the pathogenesis of AIDS include: "the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction."

I hope that you find this information helpful, Michael. I know it is hard for you to read all of the words in an article while burying your head in the sand.

Posted by: franklin | September 27, 2007 11:18 PM

1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

The primers that are chosen are believed to be specific to HIV. You can easily do a BLAST search to check the nucleotide databases for any other organisms with the same sequence. However, to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections.

2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can't the same kit pick up on all strains.

The term is "conserved" not preserved. The primers that are chosen are from highly conserved regions of the HIV genome. These sequences remain relatively constant across different strains. There is still a possibility that a given primer will not pick up some HIV with mutations in this region. To ensure that the test detects most HIV strains they check the sensitivity against a panel of different HIV subtypes.

Posted by: Chris Noble | September 27, 2007 11:27 PM

Those 18-25 year olds surely engage in more condomless, recreational sex than any other occupational category.

Yet a grand total of 11 or one in over 7,000 actually tested positive for HIV antibodies. Mon dieu!!!

As Tara has already pointed out you do not become infected through unprotected sex, you become infected through unprotected sex with somebody that is infected with HIV.

If the adult film workers are not infected with HIV then they can't infect anyone no matter how much unprotected sex they have. Put one hundred HIV- people in a room and let them have as much unprotected sex they want and none of them will become infected with HIV.

The adult film industry undergos the most rigorous HIV testing in the world. The actors are regularly tested and if found to be positive they are excluded.

There is a small chance that somebody in the acute infection stage may not be picked up.

This is exactly what happened in 2004.

le
Epidemiologic Investigation of a Cluster of Workplace HIV Infections in the Adult Film Industry: Los Angeles, California, 2004

Posted by: Chris Noble | September 27, 2007 11:36 PM

Looking back at these last posts by Team Virus; great examples of the Orwellian Doublethink spewed from the pulpit of the AIDS church. These high and mighty proponents havent got a clue that their sanctimoniously protected research is falling apart.

They cannot answer anything without rose colored AIDS/HIV glasses, and/or repeating over and over and over "HIV causes AIDS"....

Posted by: carter | September 28, 2007 12:14 AM

The padian study showed that hiv is virtually non contagious 0 seroconversions when serodiscordant couples had unprotected sex...........one of the many strange things about hiv

Strange how 99% animals injected doesnt get AIDS and die

Strange how it it only infects 1/1000 blood t cells

strange how most viruses wreak havok before antibodies, thats why we get vaccines not 10 yrs later

strange how no one really knows after 20 years how it destroys the immune system over 10-20 yrs

You might not totally agree that this is proof that hiv is harmless.................but its a debatable issue, just bc the government says so it doesnt mean its true

See hiv fact or fraud google it

REad Project Day Lily........dr shyh ching lo md phd injected, a brilliant army scientist this into every animal and they all died, found in CFS/many AIDS cases etc google project day lily, the most fascinating book ever/

Read how the people in charge of the bioweapons program are laughing at doctors for blaming hiv when mycoplasma incognitus is the only microbe to worry about. go on pub med to see Lo's work, here is some it

http://www.aegis.com/pubs/atn/1990/ATN09501.html

Posted by: cooler | September 28, 2007 12:23 AM

THATS WHY YOUVE NEVER HEARD OF IT SON, PART OF THE BIOLOGICAL WEAPONS PROGRAM, MYCOPLASMA INCOGNITUS/PENETRANS, LEARN ABOUT KOCHS POSTULATES, EVERY ANIMAL PRIMATES/MICE/EMBRYOS LO'S INJECTED WITH THIS DIED, HE DID NOT FIND IT IN ANY HEALTHY CONTROLS

DO YOU THINK ITS A COINCIDENCE THAT AN ARMY SCIENTIST IN CHARGE OF THE BIOWEAPONS PROGRAM JUST HAPPENED TO KNOW SO MUCH ABOUT THIS NOVEL STRAIN? HE WAS ALLOWED TO PUBLISH BC HE FOLLOWED ORDERS WELL AND THE HIGHER UPS REWARDED HIM BY LETTING HIM PUBLISH...........TO BAD EVEN THOUGH WORLD RENOUN SCIENTISTS LIKE TULLY AND MONTAGNIER KNEW IT WAS A THREAT TO HUMANITY FAUCI SABOTAGED IT AND CAUSED GENOCIDE.

WWW.PROJECTDAYLILY.COM

MOST SCARY STORY SLIGHTLY FICTIONILIZED TO STAY OUT OF COURT, BY GARTH AND NANCY NICOLSON PHD'S
LEARN ABOUT SCIENCE, ANIMAL MODELS, THATS WHY THERE IS AN EPIDEMIC OF ILLNESSES NO ONES EVER SEEN BEFORE LIKE CFS, AND THIS IS WHAT IS REALLY KILLING MANY AIDS PATIENTS............

WAKE UP AND SMELL THE COFFEE, AND IF YOU THINK ITS WOO, CALL UP THE ARMED FORCES OF PATHOLOGY AND TAKE AN INJECTION

Posted by: cooler | September 28, 2007 12:39 AM

Dr. Noble-Custer thank you for the revelation that the primers are believed to be HIV specific. I'm also mightily impressed with you referring to the BLAST searches. But we've also already been over the "to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections" thank you.

The question was how do you know the samples you use to test your new PCR test kit are positive or negative? Adele says it's measured against the sequenced HIV genome, what say you?

There is still a possibility that a given primer will not pick up some HIV with mutations in this region

THANK YOU FOR THAT DR. NOBLE. NOW WE'RE GETTING SOMEWHERE. Our do it yourself PCR expert, however, said this:

Deniosaurs are all like, but dudez it mutates so much no way you can measure it! Yes there is some parts of the genome are totally conserved or close to it. Those are the parts they use for PCR! They pick them because they're the same in different clades (Adele)

Well apparently not always the same in the relevant sense, Adele. So you "refine" the tests with reference to each other, change the primers if they don't work in the PCR case, and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

Posted by: Crazy Horse | September 28, 2007 12:40 AM

Hey Lisa,

Still waiting for the scientific reference about the PCR kits not detecting all strains.

Posted by: franklin | September 28, 2007 1:24 AM

Well apparently not always the same in the relevant sense, Adele. So you "refine" the tests with reference to each other, change the primers if they don't work in the PCR case, and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

I'm interested in what you mean by "refine".

To me it seems like a bit of a coincidence that nucleic acid tests that detect highly conserved regions of the HIV genome just happen to have a close to 100% correlation with antibody tests that detect antibodies with high affinity for the HIV proteins.

Of course in denial land this is just because the tests have been "refined" in some nefarious sense to produce this correlation.

This is just magical thinking in order to have some reason for ignoring the evidence that contradicts your irrational belief that HIV doesn't exist.

I'm also interested in your courageous defense of Duesberg's misrepresentation of the Palella study when it appears you have not read the paper. The paper presents extremely compelling evidence that ARTs are effective in reducing mortality and morbidity in HIV infected people. That Duesberg somehow twists the study in a bizarre attempt to argue the opposite is close to incomprehensible. You have to wonder who Duesberg is trying to convince.

Well I guess you can answer that question.

Posted by: Chris Noble | September 28, 2007 1:48 AM

You test it using a HIV you purified.

Hey Adele! Do you really work with purified HIV? Now, that's the most interesting news I've read on this item in the last seven years. Spread the word! You must immediately go over to the Aids Myth Exposed forum and explain them how you purified. And, while you're at it, also send an explaining mail to Robert Gallo and Luc Montaigner, they will go down on their knees to thank you for your gift. Do it today. End of HIV=Aids deniers tomorrow. Guaranteed. That will do them in. Well, all but myself, of course. You know my ideas and personnally I couldn't care less whether you purified or not.

Posted by: jspreen | September 28, 2007 4:05 AM

I don't know cooler's source for "99% animals injected doesn't get AIDS," and it's likely cooler doesn't know it either. Numerous animal models of AIDS are in use. For example, renouned (if unstable) dissident Michael Geiger has just endorsed the SIV/monkey model of AIDS.

The rethinker myth of no animal model of AIDS is addressed at an excellent website called aidsvideos dot org. The aidsvideos comment about animal models:

"Myth: Primates Injected with HIV Show No Symptoms of AIDS

"NIAID "Relationship Between HIV and AIDS": "[A]n HIV variant that causes AIDS in humans--HIV-2--also causes a similar syndrome when injected into baboons." [Barnett et al, "An AIDS-like condition induced in baboons by HIV-2," Science 1994;266:642-6.] The same is true of pigtailed macaques. [Morton et al, Infection of Macaca nemestrina by HIV-1/HIV-2 ...," Laboratory of Tumor Cell Biology Annual Meeting, Aug 22-28, 1993. AIDS Res Hum Retroviruses 1994;10(suppl 1):S1-125.]

"NIAID "Evidence That HIV Causes AIDS: "Chimpanzees experimentally infected with HIV have developed severe immunosuppression and AIDS." [O'Neil et al. J Infect Dis 2000;182:1051]"

(http://aidsvideos.org/myths/index.shtml#HIVPrimatesNoAIDS)

Many people who are not scientists may find the rethinker arguments compelling on the surface; I encourage these people to read the "myths" page on aidsvideos dot org and learn more about what the science and med literature really says.

Posted by: ElkMountainMan | September 28, 2007 8:09 AM

Many people who are not scientists may find the rethinker arguments compelling on the surface; I encourage these people to read the "myths" page on aidsvideos dot org and learn more about what the science and med literature really says.

Hmmm... interesting. What's aidsvideos dot org ? Let's have a look...

... all the world's HIV/AIDS videos ... in all the world's languages ... all online for free!

They're lying! Fact or fraud is nowhere in it ! Seems like just another page of typical propaganda.

Now, instead of inviting people to dive into the dark trench of HIV=Aids misery, why don't you come up to surface to admire the rethinker arguments? Seen in bright daylight they're baffling, you know.

Posted by: jspreen | September 28, 2007 8:23 AM

But to E-LISA, the vase is a hedgehog, or doesn't exist.

Hi hi hi... You compare two things but in your comparison you leave out a vital element. The vase, we can all easily agree upon what it is, before we go smashing it on the floor or before we cry out to our neighbour: "Lo! A vase". But although HIV has never ever been in sight anywhere you guys immediately start punching the air when a guy shouts "Hey, there's a HI-virus we should crush"

Posted by: jspreen | September 28, 2007 9:13 AM

Franklin,

I was not speaking of HERV-K but another hypothetical virus which could have the following sequence:

AAAGCAACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGA GAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCGGAGCCT GTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGA - this is just an example.

I hope that you could see that PCR primer of this hypothetical entity could overlap with the one from HIV.

but this is a theoretical situation, which probability may be very small, and therefore may not have practical interest.

Posted by: Braganza | September 28, 2007 10:15 AM

Hi Braganza you said

If two living beings are related (have a common ancestor), would they share similar nucleic acids ?

Yes they would actually they would be almost identical. You and me are about 100% identical in nucleic acid. Just men and women are just a little different bc men have a y chromosome.

You said about PCR
I hope that you could see that PCR primer of this hypothetical entity could overlap with the one from HIV.

Yes a pcr primer is short enough the sequence might happen somewhere else just in coincidance. It needs to be exact or nearly exact overlapping won't do it but it could happen. But look at the Wikipedia figure about PCR again. Your needing two primers not just one for pcr thats not happening by chance. So if your fals positive is amplyfying something real than it needs TWO sequence for HIV primers binding and the part in between is exact same size as the part in HIV. The only way that happens is, if the sequence is HIV or its more related with HIV then any virus that's known.

So that's not it. Alot of the DNA and RNA tests have a probe to, that's something in the middle between primers and its also attaching with a sequence and its longer than the primers. So its even less likely you find that by chance. So two primers a probe, the right size product, all this stuff you don't get by chance. If your still doubting it you can sequence your whole product and find out if its really HIV.

Posted by: Adele | September 28, 2007 10:50 AM

"there you go making exceptions into rules..................It might be possible for it to be a slow virus, it might be possible a diffuse immune response causes immune depletion according to "expert" joel gallant.........."

Exceptions to rules? Cooler, there are no broad rules that govern how a virus behaves. Every viral system behaves differently: infects different cell types (tropism), cause different symptoms/disease, different abilities to activate an immune response and to evade immune surveillance ect ect. Those viruses are not exceptions to rules because there are no rules that govern all viruses.

"The tcell count is a blood test....thats where the tcells are being depleted,"

Did you even look at the paper I linked? That's not what the paper says and I trust a paper containing results that can be reproduced than some wild speculation you read on a denialist website. So read the paper and come back and tell me why the conclusions and science are wrong and that infection in the intestinal mucosal doesn't result in massive T cell depletion.

"HIv does not cause disease in animals so its possible its species specific...........speculation"

No, not speculation. Observed fact. But since you're ignorant enough to deny this, of course you will think the species specificity is "speculation."

"all speculations, then you run off all these viruses that have failed kochs postulates"

Many of those viruses I listed have been studied extensively in animals and people, so I'd really like to hear how they don't fulfill Koch's postulates.

"are found in millions of helathy people and do nothing"

Do nothing? So symptoms/diseases from these virsus such as cold sores, genital warts, Burkitt's lymphoma, cervical cancer, Kaposi's sarcoma and many many more are actually caused by something else? You have this black and white version of how infectious diseases work, you think that all infections result in disease when that's just not true for a lot of viruses, particularly viruses that have been in the human population as long as those listed.

"I dont want speculations, since you claim the case for hiv is airtight I would like a reference for a study that confirmed Gallo's claim

it should read something like this"

People have posted many studies that positively link HIV and AIDS, but because they don't say exactly what you're looking for you discount them (if you even bothered to read them). You'll never accept any evidence and will be contnent with your ignorance of science and virology in particular.

Posted by: Jim | September 28, 2007 10:59 AM

Earth to Tara...... your explanation for the absurdly low numbers of HIV positives in the porn industry is wonderful. Why not at least also consider the strong - very strong - likelihood that sexual activities have nothing to do with testing HIV positive.

Whoops. Plum forgot. No counter-intuitive thoughts permitted in the Church of AIDS Orthodoxy. Sorry.

Does your same just-so explanation also apply to the absurdly low numbers of college students, aged 18-26 (15-16 million of them, mostly middle class!) who ever test HIV positive and yet are having oodlesand oodles of recreational sex whereby no condoms are used because the smart heterosexual female cookies have enough common sense to take care of their own reproductive lives?

Let's face it..........there never has been and there never will be any heterosexual AIDS epidemic in the USA, something that Robert Michael, et. al. made perfectly clear 13 years ago in their meticulous study, "Sex in America: A Definite Study" (Little Brown, 1994).

Looks like you missed the boat again Tara. Keep trying though.

Posted by: Chuck | September 28, 2007 11:57 AM

Braganza,

Thank you for conceding that HIV PCR tests do not react with HERV-K sequences.

Your hypothetical sequence is so similar to the HIV-1 rev sequence that any real virus containing your hypothetical sequence would almost certainly represent an isolate of HIV-1.

Whether or not a virus containing your hypothetical sequence would be detected by a PCR assay for HIV-1 would depend on the similarity between the sequence of the PCR primers used in the assay and the sequence of the hypothetical virus.

Posted by: franklin | September 28, 2007 12:08 PM

Thank you ever so much for confirming that sexual activities have nothing to do with testing HIV positive.

Your reading comprehension is about as good as noreens. Your claim is not supported by Tara's post at all. She says having sex with HIV- people does not lead to a HIV+ test. This does not mean that HIV is not spread through sexual activity. There is a different, deal with it.

The Padian study that denialists love quoting so much says that if you practice *safe sex* your chances of getting HIV from an HIV+ person are very low, but it clearly states that if you do not practice safe sex, such as wearing a condom, you can be as much as 20 times more likely to get HIV.

Do you have any questions?

Posted by: apy | September 28, 2007 12:47 PM

chimps

Posted by: cooler | September 28, 2007 1:17 PM

Tara, Tara, Tara..... why not address the basic statistical data on AIDS cases in the USA. or to paraphrase John Maynard Keynes, "When the facts change, I change my mind. What do you do, maam?"

Many orthodox AIDS researchers and your own fellow true believers cannot acknowledge any new realities - "novel facts" as William James called them - because their theories exclude them. Padian is a prime example.

HIV/AIDS has become a crusading faith in itself with a high fervor quotient and no room for doubts or second thoughts, proving that to be a religious fanatic, you don't need a religion per se.

You consciously, but predictably, evaded the key points that I've made and changed subjects.

Nancy Padian intones, "HIV is unquestionably transmitted through heterosexual intercourse....In short, the evidence for the sexual transmission of HIV is well documented, conclusive, and based on the standard, uncontroversial methods and practices of medical science."

If she ever doubted, questioned or merely reconsidered that mantra, then her funding and status would vanish. We all know that. It also prevents her from even grasping the counter-intuitive results of her own research.

I once asked Padian herself, directly, in San Francisco/Feb. 2007 at a morning session on public health at the annual meeting of the AAAS that if AIDS cases are sexually transmitted, and the overwhelming majority of San Franciscans are heterosexual then why have there been only 266 (alleged) heterosexual female contact cases of AIDS in 27 years in SF, less than 10 per year?

Padian seethed with anger, looked away and refused to answer.

Hint: the answer can be found in Michelle Cochrane's brilliant book, "When AIDS Began" (Routledge, 2004).

Enjoy yourselves, keep saving the world, and I now leave you alone to play amongst yourselves. Ta ta......

Posted by: Chuck | September 28, 2007 1:42 PM

Hey Jim. Although you stated it as, and assume it as, FACT, you said your "OPINION" and the researchers "OPINION" of their study was that:

"A gay man can be easily infected through unprotected receptive sex, and then infect someone else through insertive sex.

Oh, Now I get it, gay men must be somehow physically different, or perhaps genetically programmed to be easily infected by HIV, and also to more easily infect others, but heteros are not.... Hmmmmmm......

and

Gay men are therefore far more susceptible to the spread of the virus through the population, even with the same numbers of unprotected sexual partners."

Hmmmmm. We gays are far more susceptible.......

Yes Jim. We are far more susceptible. Susceptible to the homophobic bullshit from people like you and from society and even quite often from our own familes. We are also susceptible to high stress from constantly being told that we are all to expect a slow and painful death by HIV/AIDS.
We are susceptible to emotional stress and distress by trying to live in a world that constantly projects its homophobia and lack of acceptance for us and projects beliefs in imminent death upon us.

Keep talking Jimmy, because I really am beginning to understand you. Really now. Gay men get infected easily, but straights do not......unless they also happen to be inner city drug addled blacks or poor black Africans or other destitute people in third world countries.

Jim. You REEK of homophobia. You reek of rascism. You have transferred both into believing that it is about HIV and what you call AIDS. You demonstrate both by channeling your homophobic and rascist beliefs into beliefs of infectious viruses that only affects these downtrodden groups.

Obviously the researchers who propose such a nonsensical explanation REEK of homophobia as well.

Tell me Jim, did these researchers just so happen to be elite white heterosexuals? Well, yes indeed, investigation shows this to be exactly the case.

Neither you, nor they, have proof nor evidence for such blatantly absurd projections of your homophobia. Nothing but correlations that YOU project are causations.

You only have scared into immune suppression gay men, who deal internally and constantly with you and your ilks projections and declarations of sickness and death upon them by often engaging in very self destructive drug abuse and addictions that the non-stressed heterosexuals do not have to contend with, and often by being overwhelmed with immuno suppressing emotional stress from it all.

Jim. You and your ilk ARE THE CAUSE OF AIDS.

Posted by: Michael | September 28, 2007 4:09 PM

Michael,
Your little tirade and fall back position of homophobia and racism tells me nothing more than you are an intellectually bankrupt individual. You blatantly misinterpret an article and claim it supports your position and yet, somehow, I'm a racist and homophobe for pointing that out. I point out that you left out the end of another article that you also claim supports your position that, surprise surprise, includes information explaining that although the number of sexual partners doesn't explain the nature of HIV spread, the difference in sexual BEHAVIOR may have a big impact. Do you own up to this intellectually dishonest behavior? No, you respond with more intellectual dishonest.

"Oh, Now I get it, gay men must be somehow physically different, or perhaps genetically programmed to be easily infected by HIV, and also to more easily infect others, but heteros are not.... Hmmmmmm......"

That is not what I nor the article said, but yet you assign that position to me. Why? Because you don't have a leg to stand on and your argument is based on distortions and half truths. Instead of educating yourself on the topic, you repeat the same BS over and over and then scream "homophobe!!racist!!" at anyone who points out the obvious flaws. Believe whatever you want, Michael, it doesn't make it true.

Posted by: Jim | September 28, 2007 5:55 PM

Oh well, Jim, then please explain EXACTLY how it is that

"A gay man can be easily infected through unprotected receptive sex, and then infect someone else through insertive sex.

and:

"Gay men are therefore far more susceptible to the spread of the virus through the population, even with the same numbers of unprotected sexual partners."

Go on Jim, explain to us why the bodies of gay men are different in that THEY are EASILY INFECTED, and that THEY ARE MORE SUSCEPTIBLE, and that THEY PASS THE VIRUS EASILY.

I am patiently waiting for your FULL EXPLANATION of why HIV somehow affects gays differently from straights with HIV but not with other STDs.

And then explain to me why HIV is a HETEROSEXUAL disease in Africa, but not in the west.

When you have sufficiently explained this, I will rescind my accusations of homophobia and racism. Until you fully explain it, my accusation stands.

Posted by: Michael | September 28, 2007 8:54 PM

Franklin said:

"The epidemiologic investigation of THIS CLUSTER OF CASES in the adult film industry clearly documents heterosexual transmission of HIV."

Franklin, since when are eleven cases spread over thousands of different people, equivalent to a "cluster"?

Come on, Frankie, explain yourself here. And don't run off and hide and evade the question this time.

Posted by: Michael | September 28, 2007 9:50 PM

Michael,

I don't have access to the journal in question but here's some evidence that suggests you whould "rethink" your understanding of the sexual behavior of male homosexuals:

"Table 1 summarizes the demographic findings. Of the 205 participants, 36 (18%) self-identified as tops, 47 (23%) as bottoms, and 97 (47%) as versatiles, and 25 (12%) reported that these labels did not apply to them (hereafter referred to as the no label group)."

http://www.thefreelibrary.com/Sexual+behavior+among+HIV-positive+men+who+have+sex+with+men:+what's...-a0105518220

This is why science has proven to be such successful innovation. By following its tenets we learn things that otherwise would have eluded us.

Posted by: Roy Hinkley | September 28, 2007 10:21 PM

Roy, you said: "This is why science has proven to be such successful innovation. By following its tenets we learn things that otherwise would have eluded us.

And again, Roy, the reality of the situation is the opposite of what you were led to believe.

The study you presented, if you choose to believe it and choose to believe the individuals who were questioned were honest when asked such extremely intimately personal questions that very much even threatened the egos of those being questioned, will not enlighten you as to the real world experience. It will simply result in you being even more deluded.

Posted by: Michael | September 28, 2007 10:51 PM

Hey Roy. If your own preferred sexual act was getting screwed in the ass by another man, would you willingly admit it to strangers?

Think about it.

Posted by: Michael | September 28, 2007 11:07 PM

Tara, are you censoring dissidents comments to this thread again? My own comments will not post unless I either use someone elses email address in the email sign-in or use a different computer than my own to leave posts. Any posts I leave using my own email address comes back as "Held For Approval" by you.

Other dissidents have emailed me that their comments are coming up the same as my own: "Held For Approval" by you.

Whats up? Are you terrified that a "denialist" might be the 500,000th comment Tara? Or are you just censoring debate again?

Posted by: Michael | September 29, 2007 12:26 AM

Michael,

If you read the paper, you will see four cases of HIV infection among workers in the adult film industry in the Los Angeles area. The four cases include a man and three women with whom he performed various sex acts in the line of duty.

These four cases are a cluster, an index case and three of his primary sexual contacts.

All of the actors in these film productions were required to provide the results of monthly testing for HIV infection. Negative test results were a condition of employment, and all of the actors had received negative test results prior to this outbreak. These four cases are well-documented new infections of HIV.

Phylogenetic anlayses showed that the viruses in the man and two of the women had exactly the same nucleotide sequence. Therefore this cluster of cases is linked by molecular phylogenesis, as well as by the epidemiological criteria of primary sexual contacts.

This cluster of cases demonstrates heterosexual transmission of HIV and uses the combined epidemiological and molecular approaches advocated by the other article you posted.

Posted by: franklin | September 29, 2007 12:50 AM

they are laughing knowing full well mycoplasma incognitus is the only real microbe to worry about it..................project day lily google it

Posted by: cooler | September 29, 2007 1:34 AM

Cooler,

You keep linking S.C. Lo to the idea that Mycoplasma has caused an epidemic of Chronic Fatigue Syndrome.

Do you have a reference (nonfiction) to support your claim?

When I look on Medline I keep coming up with this paper that seems to refute your claim:

Komaroff AL, Bell DS, Cheney PR, Lo SC. (1993). Absence of antibody to Mycoplasma fermentans in patients with chronic fatigue syndrome. Clin Infect Dis. 17:1074-5.

Posted by: franklin | September 29, 2007 10:02 AM

Wow.

You really brought 'em out of the woodwork, Tara. I'd have banned Lisa after the second post for the thoughtless and repetetive issuance of really, really lame insults. Adso? Dr. Smearah Tit?

Jesus. Frelling. Christ. That has got to be the stupidest thing I've seen on science blogs, ever. Maybe even on the whole internet.

Posted by: Leni | September 29, 2007 12:20 PM

the monkeys that died that lo injected only had a weak antibody reposnse when near death, so pcr is the way to detect this microbe, not antibodies

do a pub med search for garth nicolson and youll see him find Lo's mycoplasma incognitus in several diseases such as als/cfs by pcr.

do a search on pub med for shyh ching lo, and youll see his animal models, and that even he used the PCR to detect it............

now why would Lo use antibodies testing in that study? well youll have to read Project day lily to find out, being a military scientist Lo was being handled by superiors.

Project day lily's events are true, it had to slightly fictionilized to stay out of court. rave reviews from several scientists, including a nobel laurete roger guilleman md phd.

It was part of the bioweopons program. Every animal Lo injected with it mice/primates/embryos sickened/died. he found it in no healthy controls. These are all peer reviewed sources from Lo md phd, who was considered a scientific genius in china, which is why the military made him the highest ranking scientist, in 1990, he along with several other scientists came to Duesbergs defense, bc Lo had trouble believing the hiv hypothesis as well.

If you are really interested you can search pub med, every time I post links my posts get held up for some reason.

Shyh ching lo md phd is one of the only scientists since koch to discover a microbe that killed/sickened every animal injected....scientists from the nih like Tully were very impressed with his work, but Fauci sabotaged it and caused genocide. good work Tony Fauci.

Posted by: cooler | September 29, 2007 1:10 PM

sorry about the double post, some of lo's work, note the lack of antibody response

http://www.aegis.com/pubs/atn/1990/ATN09501.html

garth nicolson phd is finding it by pcr in cfs/als/gwi etc

his work is all over pub med

Posted by: cooler | September 29, 2007 1:24 PM

the link above is nonfiction, lo's peer reviewed work, here is nicolsons post, i told you to search pub med but you refused, so please try using pub med instead of lying about "fictional refrences" learn something from other scientists instead of dismissing them

nicolsons peer reviewd work on gwi/als, search more and youll find a lot on CFS
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=12383408&ordinalpos=13&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

Posted by: cooler | September 29, 2007 2:03 PM

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=12887507&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

her mfi/cfs correlation

Posted by: cooler | September 29, 2007 2:25 PM

Cooler,

M. fermentans incognitius is not even the most frequent mycoplasma species identified in the papers you are citing.

Is that your evidence that M. fermentans incognitius causes Chronic Fatigue Syndrome?

Posted by: franklin | September 29, 2007 2:37 PM

Cooler,
Why are you even arguing about mycoplasma and CFS? What exactly does it (and Project Day Lily for that matter) have to do with HIV denialism?

Posted by: Jim | September 29, 2007 3:13 PM

http://www.aegis.com/pubs/atn/1990/ATN09501.html

more than gallo ever had, this bug is found in many CFS cases, youre going to say lo's animal model does not exactly resmemble CFS, the monkeys/mice wasted and died in 9 months (even though according to Lo's patents its a definte possible cause of CFS I and I trust his opinions much more than yours, for he is obviously a much more competent scientist than you will ever dream of being, in one of his patents he incolated chimps and they displayed "symptoms of AIDS" )

Funny how you scrutinize Lo's animal models, when 150 chimps were incoulated with hiv and none have died after 20 years, nor do mice mice or chicken embryos get any type of disease when inoculated with HIV, lo incoulated all of these different species with mycoplasma incognitus/penetrans and they all sickened/deformed died.

I suggest you call the armed forces institute of pathology and take an injection if you think they cant cause complex diseases like CFS/ALS

Posted by: cooler | September 29, 2007 3:58 PM

Cooler,

You insist that Mycoplasma fermentans incognitius is the cause of chronic fatigue syndrome. You insist that Koch's postulates have been fulfilled for this association. Yet I am unable to find one scientific paper that agrees with you.

Has Garth Nicolson ever claimed that Koch's postulates have been fulfilled to prove that Mycoplasma fermentans incognitius is the cause of chronic fatigue syndrome?

Has Shyh Ching Lo?

Has anyone other than Cooler ever made that claim?

Posted by: franklin | September 29, 2007 4:15 PM

yes nicolson has claimed KOchs postulates have been folfilled, Lo has suggested it as a cause of CFS in his patents

lurkers should read http://www.projectdaylily.com/

to find out how it was part of the bioweapons program

Posted by: cooler | September 29, 2007 4:41 PM

Cooler,

You say that:

Kochs postulates have been folfilled for mycoplasma incognitus /penetrans causing disease in humans so if you test positive for it and feel sick, it is probably the cause of much of your symptoms, regardless of what garbage can diagnosis youve recieved , CFS, depression etc.

The first of Koch's postulates states that:

The microorganism must be found in all cases of the disease.

Please provide evidence that this postulate has been fulfilled for mycoplasma incognitus /penetrans in any human disease.

Please don't send us to Project Day Lily or any other work of fiction.

Posted by: franklin | September 29, 2007 6:06 PM

Lo found it no healthy controls either, not mycoplasma incognitus/penetrans, please read his studies and learn from a far more accomplished scientist, all the peer reviewed refrences are above. I do not really wish to further debate someone who is on the drug companies payroll in all probablilty, it makes me sick.

Have you ever taken any money from a drug company for research? please disclose your conflicts of interest Franklin, I can not debate someone who is paid to take certain positions by drug companies, answer honestly. A debate with a drug comapny hack is like debating a robot, there is no point, disclose the funding youve recieved from drug companies now.

Posted by: cooler | September 29, 2007 6:44 PM

Hey Chris, I see you are not very proud of the fact that your favorite fantasy has resulted in Andre Parenzee being convicted to a 9 year sentence for supposedly spreading HIV. And I see that you are more than happy to project your own inner guilt over his conviction by projecting your guilt onto the dissidents who did their best to defend Parenzee by exposing the flaws of HIV belief. Well, Chris, you did your part to spread the fantasy, not the dissidents. The results fall squarely on you and those you unquestioningly follow.

Michael, I'm not convinced that a 9 year prison sentence is the best answer. However, Parenzee should take responsibility for his actions. He hasn't yet.

Michael you should read the actual editorial by Pillay et al

They warn against using phylogenetic analysis by itself. Like many other types of forensic evidence juries have to understand the nature of the evidence. Phylogenetic evidence can yield estimates of the probability that two isolates are related. These are probabilities and it does not prove anything with 100% certainty. In the cluster of cases in the adult film industry the sequences from the isolates from all four were 100% identical. The isolates were obtained shortly after infection and little evolution of the virus had occured. In this case the probability that these three people were infected from somebody other than the initial case is very, very small. Together with other evidence that indicate who was infected first it is beyond all reasonable (and unreasonable) doubt that the infections occurrred as described.

Posted by: Chris Noble | September 29, 2007 9:24 PM

sorry misery women youre wrong again researchers from the university of alabama concluded it was a novel strain, use your brain a ordinary contaminent would not induce disease in animals, u of alabama reserachers injected the ordinary mf into rats, nothing happened, when mfi was injected all hell broke loose.

Lo had control cultures to ensure it wasnt a contaminent, misery women, call up lo and get injected if you think its harmless

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=8399932&ordinalpos=186&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

Posted by: cooler | September 29, 2007 9:29 PM

misery women,
I read hannans study, he found one strain of mycoplasma that Lo isolated and speculated it could be a contaminent or just that that patient overused abx. Its a pretty pathetic study from one scientist no ones heard of thats half a paragraph long.

compare that with everything that lo did to ensure it was a novel strain, he only found it in sick patients, not in anyhealthy controls he identified in the tissues with electron microscopy, he had control cultures, caused disease in healthy hosts.

Posted by: cooler | September 29, 2007 10:58 PM

Cooler,

Although you claim that "Lo found it no healthy controls either, not mycoplasma incognitus/penetrans," the peer-revied study that you pointed to as proof that Mycoplasma fermentans causes chronic fatigue syndrome identified this organism in only 32% of chronic fatigue syndrome patients and in 8% of healthy controls.

How do you explain this?

Posted by: franklin | September 30, 2007 3:23 PM

Cooler,

Here's a quote from the abstract of the paper you sent us to:

Mycoplasma fermentans, M. hominis andM. penetrans were detected in 32, 9 and 6% of the CFS patients while they were detected in 8, 3 and 2% of the healthy control subjects, respectively.

According to the paper you cited, M. fermentans was detected in 32% of CFS patients and 8% of healthy controls.

How do you reconcile this finding with your contention that M. fermentans has been shown to fulfill Koch's Postulates for Chronic Fatigue Syndrome and your claim that Lo is unable to detect this organism in healthy controls?

Posted by: franklin | September 30, 2007 4:23 PM

Lo between his patents and papers looked at hundereds of healthy controls and found them in no healthy controls, if m penetrans/incognitus pops up in a few healthy controls, thats normal they could be false positives, they could be in the early stages of infection, etc etc...................

obviously more research is needed, Im sorry that your drug company employers are instructing you to "debunk" this research, but its hard to debunk a microbe that kills/sickens every animal injected when the microbes you push hiv, hpv, hepatitis c do
zilch in virtually every animal.

get a life I do not wish to debate a man who is on the payroll of a drug company any further. Ive showed this research to many scientists at my old university and they all agree this agent is real and more funding and research is needed, I do not wish to debate hacks that are associated with the Gallo/moore/wainberg drug company mob any longer.

Posted by: cooler | September 30, 2007 5:09 PM

Roy. You said: That would make 82% bottoms. Do you think such a finding has any implications for a sexually transmitted disease such as HIV Michael?

I think it has immense implications, Roy. What it means is that there is a lot of oral only sex going on and far less anal then most would think. Matter of fact, Roy. Oral sex transmits few stds.

This is another reason the HIV causation of AIDS thing does not add up in the gay community. What does add up, is a large number of emotionally stressed out people, in percentages much higher than in the straight community, as is evidenced by substantially higher drug and alcohol addiction and suicide rates.

I know you are well aware that stress and beating ones self up with life in the fastlane on dope steadily weakens immunity. I know you are well aware that drug and alcohol abuse takes a huge toll on a person physically.

And falling into emotional states of depression and hopelessness and panic after an HIV or AIDS diagnosis does not help them to recover at all.

It ain't rocket science as to why some of these people would get ill or be slow to recover or even die of common ailments, Roy, just simple common sense.

Posted by: Michael | September 30, 2007 8:16 PM

and then caused disease when he inoculated healthy animals (mice/primates)

Posted by: Cooler | September 30, 2007 8:51 PM

Michael,

You brought an article to our attention because you somehow thought it supported your HIV denialist position:

Specialty Journals Date: September 14, 2007

Science Daily -- Differences in sexual behaviours do not fully explain why the US HIV epidemic affects gay men so much more than straight men and women, claims research published ahead of print in the journal Sexually Transmitted Infections.

When Jim and Roy pointed out that you omitted several key points made by that authors that can account for the differences between the rates of HIV infection in gay men versus the heterosexual population, you reverted to your usual as hominem attacks:

Gay men DO NOT honestly share their preference with strangers, even when the stranger is another gay. Usually one does not find out the truth until they are naked in bed.

The 47% who told a stranger they were "versatile" and 12% who refused to be labeled, ARE ALL BOTTOMS.

Don't take my word for it Roy, go find ANY gay man, and just ASK HIM what it means when someone gay says they are "versatile". He will simply chuckle to himself and to you, and tell you that it means they are a bottom.

Well, Michael, it turns out that at least one of the authors of the paper to which you directed our attention is an openly gay man. Here is a link to an editorial he wrote in favor of same-sex partner benefits and same-sex marriage.

So, I guess at least one gay man disagrees with your blanket characterization of the sexual behavior of all gay men. Why should we accept your opinion over his, especially since his position is based upon scientific data--not merely on ignorant prejudices.

The lengths to which you go to maintain the charade of denial that you beleive is somehow magically protecting your lover from the consequences of his HIV infection never ceases to amaze me.

Posted by: franklin | September 30, 2007 11:11 PM

Cooler, before you storm off in a flurry of CAPITALs could you write down all of Koch's postulates and give a reference to the evidence that Mycoplasm incognitus fulfills each one in turn.

This should be an easy task for you

Posted by: Chris Noble | September 30, 2007 11:43 PM

already did list kochs postulates above any how lo's pathenogenic mycoplasmas folfill it for the cause of human diseases scroll up. (a subset of cfs/ra/als patients etc) scroll back, youll see how hiv folfills kochs postulates at a much lesser degree.

I think its time you guys debated lo and montagnier, the nicolsons and tully, or debate me publicly and we can tape it on you tube, the debate will take place in front of scientists and students at a good university, and well take a poll at the end of the debate to see who wins.

the debate topics will be hiv as the cause of aids
and mycoplasmas a the cause of human diseases CFS etc.

Posted by: cooler | October 1, 2007 12:34 AM

well I guess hiv fails because of all the long term non progressors, and the fact that almost everyone with hiv is healthy and asymptomatic, I guess I could create a 10 year window period with mycoplasma incognitus to buy time if people were not sick, but there is no need for that. I guess hiv fails kochs 3rd postulate as well, bc 99% of animals injected dont get sick

according to the body's aids resource famous page Kochs postulates are this.

epidemiological association
The mycoplasmas are strongly associated with CFS. A 100% correlation could be acheived by making a postive mycoplasma test a essential criterion for CFS, thats how you idiots got your 100% correlation with hiv/aids.

Isolation and growth in culture
shyh ching lo did this, learn from him was considered a scientific genius in china, not a drug company hack like you.

Induces disease in healthy host.
every monkey, embryo, mouse sickened and died when injected with mycoplasma penetrans/incognitus. Peer reviewed refrences above. Are you stupid? You call me out on Kochs postulates when hpv, hiv, hep c does not induce disease in virtually every animal.

You're a pathetic drug company hack. There is no reason to further debate, Ive already won

Refrences all posted above...........this internet debate is over...........debate me publicly on hiv and mycoplasma at cal berkeley, well you tube it, why dont you in your own words say how hiv folfills kochs postulates, please in your own words dont copy and paste from fauci's website.

Posted by: cooler | October 1, 2007 1:34 AM

More research should be done, especially on those who have died from AIDS. A doctor in Texas found that all of his patients who had died from AIDS also had Herpes Virus 6A, which is very destructive to the immune system. Many believe that HIV is not so important by itself but other co-factors such as the above virus or mycoplasmae such as, penetrans fermentas are the real culprits. An excellent book about the Herpes 6A virus is,"The Virus Within."

Posted by: noreen | October 1, 2007 9:36 AM

Yes, all of the population has been exposed to this virus, except one small group of people. Nevertheless, around 95% have been exposed to the harmless variety, which is HVV6B and the other 5% have the "A" variety, which causes havoic in the body when reactivated.

Posted by: noreen | October 1, 2007 10:18 AM

And while you look that one up, also give us the rference to your claim that HIV-PCR is positive in HIV negative people.

Posted by: DT | October 1, 2007 11:41 AM

Why are these people like this? What is wrong with their brains?

I find the above some very interesting questions. Why? Well, because this time they may have been formulated by a HIV=Aids apologist, but each and every HIV=Aids dissident feels the same questions popping up into his brain when reading the Chris Nobel, franklin, etc. contributions.

Which is one more proof for my statement that, in fact, Aids Apologists and Aids Denialists are one of a kind.

Posted by: jspreen | October 1, 2007 11:50 AM

misery women,
you are not even worth talking to.

Branzaga,
I dont think chocolate will do much for the subset of cfs patients infected with lo's pathenogenic mycoplasmas, i think high dose abx is a much better approach. Here is a case study of someone with a cfs like illness who tested positive for mycoplasma incognitus and was cured with high dose abx
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=1788266&ordinalpos=226&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

Posted by: cooler | October 1, 2007 2:28 PM

Oooh forgot some apex11

What is a "pathenogenic mycoplasma" is that more like a parthenogenic or a pathogenic one?

Also you know Michael Fumento right the right wing journalist critical of big science SARS and stuff right? Weird how he said

First, 123 different symptoms have been attributed to GWS according to Nicolson's own assistant, a number which correlates roughly with my findings. But according to the nation's pre-eminent authority on MF, Dr. Shyh-Ching Lo of the Armed Forces Institute of Pathology, only one symptom - joint problems - seems strongly correlated with MF. Another - breathing problems - may be related. I confirmed this with two other prominent MF researchers. So how do we account for those other 121 symptoms?
www.fumento.com/gulf3.html

Wow frummyBilly why did he say that is Fumento and Lo in that big conspiracy too?

Posted by: Adele | October 1, 2007 3:02 PM

Cooler, not sure why you so angry but I guess its probably bc your wrong about Dr. Lo and you know it.

When Dr. Lo says something you like then you say he's a genius and general of the "Armed Forces of Pathology"

when you don't like what he says and what he finds in his research then he's getting "handled" and he's getting forced to say stuff by the chemtrails gov people who like to infect the Nicolson's cat with mycoplasma.

You are one logical man cooler I hope you stick around here! Seriously!

Posted by: Adele | October 1, 2007 3:50 PM

Cooler you can learn alot from Dr. Lo. HE says "apparently is associated" You say "IT KILLS EVERYTHING IN ITS PATH 99% OF ALL LIFE IN THE UNIVERSE"

I just told you what Fumento said I thought maybe you'd listen to a right winger like you. But no.

Vernon, Shukla and Reeves in J Med Microbiol 2003 have this article called "Absence of Mycoplasma species DNA in Chronic fatigue syndrome"

If you read it you find out why the Nicolsons might be wrong I mean beyond thinking they cured former Prez Bush'es dog of Mycoplasma and their cat died of it. This is Vernon et al,

Our goal was to reproduce the results of Nasralla et al. (1999) and Nijs et al. (2002) in a systematic way by using well-defined CFS subjects and non-fatigued controls. These authors detected the presence of four species of Mycoplasma DNA in patients with CFS and fibromyalgia. These studies used patients in tertiary care clinics rather than the general population and the results may reflect recruitment bias. Our study tested persons with CFS identified in the general population. Previous studies did not include appropriate controls, thus reported associations may be spurious. Our study enrolled non-fatigued controls from the same population as CFS cases.

Recruitment bias cooler. See no one says Mycoplasma isn't interesting we all think it should get researched. That's why Tony Fauci asked Lo to give a talk back in the eighties when he found the mycoplasma but Lo refused six times. everyone thinks its good to look at cooler. IT's probably another opportunistic infection like PCP or KSV and stuff. Maybe its more than that who knows yet. But a bunch of people don't find it more often in HIV then in uninfected people and that includes Montagnier WITH PCR. And people like Vernon et al who used better sampling then Nicolson don't find it in CFS patient.

Posted by: Adele | October 1, 2007 6:02 PM

yep that meeting did take place in 1990,

The meeting was led by Dr. Joel B. Baseman, a mycoplasma expert at the University of Texas Health Sciences Center at San Antonio. He said the participants were ''very impressed with the quality of science that Dr. Lo's group displayed.''

''The pathology data was solid and convinced us that the agent is in the tissues,'' Dr. Baseman said. The ability of M. incognitus to cause a fatal wasting disease in monkeys and mice persuaded most participants that the microbe ''has the potential to cause disease in humans,'' Dr. Baseman said, although solid proof is lacking.
new york times 1990

a year later the Miami herald impressed with LO's work tried to call fauci and ask him what happened after the panel reccomended funding and research, faucis response

When asked for an interview concerning Lo's work, NIAID director Anthony Fauci said through spokesperson Mary Jane Walker that he "will not talk about mycoplasma or any other AIDS co-factor."

miami herald 1990, no reason why he refused funding, just didnt want to upset the hiv religion, even though this microbe sickened and killed hiv negative patients.............FAUCI IS GUILTY OF GENOCIDE, for this microbe has infected a subset of cfs/als patients and been the final death blow to many AIDS patients

Posted by: cooler | October 1, 2007 7:21 PM

Yo, I have a comment being held in moderation that refutes Adeles lie that Lo refused to disclose his research
http://query.nytimes.com/gst/fullpage.html?res=9C0CE3DF1038F935A25752C0A966958260&sec=&spon=&pagewanted=1

scientists sent from the NIH were very impressed with Lo's work and reccomeneded further research/funding,
a year later the miami herald called Fauci to ask why there has been no funding, with no reason he said he would not discuss "mycoplasmas" aka he caused genocide bc he didnt want to upset the hiv religion

Posted by: cooler | October 1, 2007 11:03 PM

Cooler,

You referred to a report that you characterized as a "case study of someone with a cfs like illness who tested positive for mycoplasma incognitus and was cured with high dose abx."

You later posted the abstract from this paper, including this description of the patient:

An apparently immunocompetent male who lacked evidence of HIV infection developed fever, malaise, progressive weight loss, and diarrhea and had extensive tissue necrosis involving liver and spleen.

Cooler, this patient's disease is nothing like chronic fatigue syndrome. Extensive tissue necrosis involving the liver and spleen rules out chronic fatigue syndrome.

In his paper looking at the possible association of M. fermentans with Gulf War Syndrome, here's how S. C. Lo characterized this patient and similar patients:

We later reported, in non-HIV infected patients, a previously unrecognized fulminant disease apparently associated with systemic M. fernentans infection [6-91. These highly unusual cases revealed a rapidly deteriorating illness with adult respiratory distress syndrome (ARDS) and/or multiple organ failure. These findings suggested that M. fernfentans may be pathogenic in humans. However, although no other infectious agents could be identified, it was not clear if these patients had another yet unknown underlying condition.

[Lo et al. (2000) Lack of Serological Evidence for Mycoplasma fermentans Infection in Army Gulf War Veterans: A Large Scale Case-Control Study. Epidemiology and Infection, 125:609-616.]

Again, a "fulminant illness" is nothing like chronic fatigue syndrome. And it seems that S.C. Lo feels that he has not proven that M. fermentans was the cause of illness in these patients.

On the other hand, the response of this patient's illness to doxycycline suggests an obvious test of the hypothesis that chronic fatigue syndrome is due to M. fermentans (incognitus strain).

Seems strange that after all this time Nicolson hasn't published a randomized trial of doxycycline for chronic fatigue syndrome.

Such a trial has been published for Gulf war syndrome (491 patients with mycoplasma detectable in the blood), but a one year course of doxycycline led to no improvement in symptoms compared to placebo.

Posted by: franklin | October 1, 2007 11:31 PM

Hello AK. The link you put up says a lot, depending on the viewpoint you look at it from:

http://www.jaids.org/pt/re/jaids/fulltext.00126334-200605000-00002.htm;jsessionid=HB5Tr4kSnHGKsTVsn8vLpF1mHvWDsFlskQnvbFb0vvW0RJQ9hv5j!1330140564!181195629!8091!-1

You said: "My thought is that an HIV infection won't cause AIDS unless it has enough diversity in its initial infection(s) so that between recombination and mutation it can stay ahead of the immune system.

However, the link to the guy you show us in the study verifies the following, which shows this guy to be nonstop abusing himself by IV drug abuse since 1981, and further shows him to be on extremely harsh aids drugs, including AZT, D4T (related to DDT), 3TC, and others, all with well verified extremely toxic effects (just google them) on his entire body:

The plasma samples analyzed were obtained from an HIV-1 patient diagnosed in 1987 who reported continuous intravenous drug use since 1981

AK, is not being a verified self destructive junkie, with all of its own associated emotional negativity, poor nutrition, etc, not quite "enough diversity" as you put it, of a reason to have an extremely rundown immune system?

If it is not, perhaps we can add in the fact that he has also been taking the following highly toxic drugs with vast verified toxic effects including attacking bone marrow, since 1995:

FIGURE 1. Immunological and virological characteristics of the patient follow-up. Different antiretroviral regimens are AZT + didanosine Symbol, AZT + zalcitabine Symbol, 3TC + d4T + NFV Symbol, didanosine + d4t + NFV Symbol, and d4T + indinavir (IDV) + ritonavir + abacavir Symbol. Short treatment regimens (15 days of treatment) are indicated by vertical gray arrows in the x axis; first, 3TC + d4T + IDV, and later, d4T + IDV + ritonavir + abacavir.

And if that is not "enough diversity" for you, consider just for a moment factoring in this obviously self destructive individuals personal emotional stress factors over the years of shame, guilt, apathy, etc, including the intensity of his diagnoses of HIV and AIDS, which all must have been quite intensely stressful and shocking to his immune system by themselves.

Would you, AK, agree or disagree that with all this person had going on, it is impossible to say what part of his problems were caused by what, or do you simply attribute any and all health problems strictly to HIV?

Should you find that the overall assault on this guys body, from drugs, nutrition, AIDS drugs, emotions, and perhaps even other things this guy went through is enough to take down most peoples health, then you will understand why there are so many HIV dissidents who say: "Its NOT THE HIV, Dummy!".

Posted by: Michael | October 1, 2007 11:40 PM

"seems strange" when there is no funding its a bit difficult

besides the necrosis, that patient could have easily been diagnosed with CFS.....or a number of garbage can diagnosis's, funny how you have such a explicit defintion for CFS must be, but when it comes to hiv its ok for some people to have dementia, some not, ok to have some progress in 2-3 years, and others progress in 20 years, thats all ok right?

the real question is if you are not feeling well, and have been given a mulititude of garbage can diagnosis like MS, Fibromylagia, CFS, you should have a right to get tested for a microbe that kills/sickens every animal inoculated unlike hiv.

I know of several people that have recieved several of these diagnosis's simultuaneoulsy! You dont group diseases by the symptoms, you group them by the cause.

And bc its clear that LO's pathenogenic mycoplasmas kill every animal injected, are found in the tissues of people who died of mysterious infections, are not found in healthy controls and there are clear correlations PCR with a subset of CFS/RA/ALS patients, you should get tested and treated if pcr positive, especially with strain ingonitus/penetrans if you are not feeling well, and get a new diagnosis every week.

I know this will lose a lot of money for the drug companies you work for, but for people who are feeling horrible with this microbe in thier blood they have every right to eradicate it with ABX.

As for that gulf war abx study, well if you wait 14 years to treat the infection, any infection chances are slim for a recovery, try treating a syphillis patient 14 years later. Secondly the study was conducted by several people who didnt want national scandal, ie how did the mycoplasma get in their blood?

Independent scientists should conduct studies.

Posted by: cooler | October 2, 2007 12:10 AM

Cooler,

Doxycycline is cheap. It would not be an expensive study.

Then again if it showed no improvement, it might be bad for business.

Liver necrosis is not a minor difference. S. C Lo, himself, describes the patient as having a "fulminant infection." Look that up in the dictionary and see if it sounds anything like chronic fatigue syndrome

Posted by: franklin | October 2, 2007 12:24 AM

Chris, you said: "HIV causes a particular form of immune suppression with the specific depletion of CD4+ cells."

However, you forgot to mention that this only happens in a small percentage of the HIV diagnosed. And quite far from all of them.

Even DT, the avowed HIV negative HIV believer and AIDS clinician admitted to personal CD4 counts that varied greatly, including as low as 400, and was even free of HIV infection.

DT's 400 count, which would have been classified as AIDS or on the way to progressing to AIDS at the time were DT an HIV positive, he/she would even have been recommended by the CDC to be taking the aids drugs that he/she has prescribed for decades.

The fact is, CD4 counts are seldom ever even tracked in any other diagnosis other than HIV, so who knows what CD4 counts anyone would have with or without any other known or unknown infections of any other viruses or diagnoses.

Furthermore Chris, you seem to have conveniently forgotten that Rodriguez et al found CD4 counts as having no bearing in progression to AIDS, except for a small percentage of individuals.

How convenient that selective memory of yours seems to be, Chris!

Posted by: Michael | October 2, 2007 12:46 AM

By the way Chris, Tony Fauci, director of NIAIDS, says you are full of crap about HIV causing a loss of CD4 T Cells. Tony Fauci says HIV infection INCREASES CD4 T-CELLS, and quite well pointed out that HIV drugs themselves cause loss of these cells:

For some reason, perhaps personal modesty, Dr Fauci had not informed the general public previously of his breakthrough in understanding, but merely communicated it to the Proceedings of the National Academy and included it in a chapter on the Immunology of AIDS he wrote for the textbook "Fundamental Immunology", edited by William E. Paul MD and published by Lippincott, Williams and Wilkins in 2003 (p. 1295):

Fauci pointed out:

"Several investigators have demonstrated that there is an increase in CD4+ T-cell proliferation in both HIV and SIV infection. In certain studies, the enhanced T-cell proliferation that was observed during active disease was significantly decreased following the initiation of anti-retroviral therapy, and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals".

What Fauci confirmed to the few graduate students and working scientists who perused this book was that the result of HIV arriving in the human body was to touch off and maintain proliferation of T-cells, rather than killing them off.

What happens is that for a 56 fold (5600 per cent) gain in HIV early on CD4 T-cells drop maybe 6% but CD8 T-cells rise 20 per cent. The net increase is there until drugs are provided, in which case this beneficial effect is wiped out. If the drugs are stopped, then the benefit is once again felt.

The total outcome is hidden in the complexity of the immune system - there are other major factors involved in the standard and rather misleading T-cell count, such as rate of production, redistribution, longevity of cells, level of apoptosis and activation induced cell death - but these trends are clear.

Thanks to http://www.scienceguardian.com/blog/how-fauci-solved-aids.htm

Posted by: Michael | October 2, 2007 12:58 AM

However, you forgot to mention that this only happens in a small percentage of the HIV diagnosed. And quite far from all of them.

In studies where cohorts have been followed only a small proportion do not show progressive depletion of CD4+ cells. LTNPs are a minority.

Even DT, the avowed HIV negative HIV believer and AIDS clinician admitted to personal CD4 counts that varied greatly, including as low as 400, and was even free of HIV infection.

CD4+ counts vary from individual to individual and from time to time. In non HIV infected people the average CD4+ count is much higher and the distribution goes to zero at around 200.

In HIV negative people some low CD4+ cell counts occur but these are transient. In comparison CD4+ counts in HIV infected people start in the normal range and decrease progressively over time. Eventually CD4+ counts progress to single digits.

The fact is, CD4 counts are seldom ever even tracked in any other diagnosis other than HIV, so who knows what CD4 counts anyone would have with or without any other known or unknown infections of any other viruses or diagnoses.

Furthermore Chris, you seem to have conveniently forgotten that Rodriguez et al found CD4 counts as having no bearing in progression to AIDS, except for a small percentage of individuals.

I am yet to hear a single HIV "rethinker" accurately describe this paper. Your version here bears no resemblance to the paper at all. What are you talking about? Have you read the paper?

How convenient that selective memory of yours seems to be, Chris!

I can't remember things that never were.

However, I do remember you promising to give up your Denialism if the Parenzee appeal failed.

Posted by: Chris Noble | October 2, 2007 1:06 AM

What Fauci confirmed to the few graduate students and working scientists who perused this book was that the result of HIV arriving in the human body was to touch off and maintain proliferation of T-cells, rather than killing them off.

Michael, unlike you, I have actually read this chapter. It takes a high level of arrogance, ignorance, dishonesty and stupidity on Liversedge's part to misinterpret the chapter in this manner.

The actual text and the references cited do not support Liversedge's contorted misrepresentation.

Several investigators have demonstrated that there is an increase in CD4+ T cell proliferation in both HIV and SIV infection. In certain studies, the enhanced T cell proliferation that was observed during active disease was significantly decreased following the initiation of anti-retroviral therapy, and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals.

Mathematical models of lymphocyte turnover derived through analysis of immediate changes in circulating CD4+ T-cell counts in individuals following the initiation of HAART led to estimates that approximately 2 × 109 CD4+ T cells are destroyed, and replenished, each day (21,288). However, studies utilizing a variety of techniques to measure lymphocyte proliferationdincluding Ki-67, BrdUrd, and 2H-glucosedto evaluate the effects of HIV on T-cell turnover have yielded mixed results. Several investigators have demonstrated that there is an increase in CD4+ T-cell proliferation in both HIV and SIV infections (289-297). In certain studies, the enhanced T-cell proliferation that was observed during active disease was significantly decreased following the initiation of antiretroviral therapy (289,291,295), and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals (289). These data suggest that HIV infection results in a high turnover of CD4+ T cells, perhaps as a consequence of destruction of CD4+ T cells through certain of the mechanisms reviewed above. However, several investigators have had contrary results and have suggested that HIV replication blocks the ability of new CD4+ T cells to regenerate (294,296-298).

289. Lempicki RA, Kovacs JA, Baseler MW, et al. Impact of HIV-1 infection and highly active antiretroviral therapy on the kinetics of CD4+ and CD8+ T cell turnover in HIV-infected patients. Proc Natl Acad Sci U S A 2000; 97: 13778 - 13783

290. Mohri H, Bonhoeffer S, Monard S, et al. Rapid Turnover of T Lymphocytes in SIV-Infected Rhesus Macaques. Science 1998; 279: 1223 - 1227

291. Zhang ZQ, Notermans DW, Sedgewick G, et al. Kinetics of CD4+ T cell repopulation of lymphoid tissues after treatment of HIV-1 infection. Proc Natl Acad Sci U S A 1998; 95: 1154 - 1159

292. Sachsenberg N, Perelson AS, Yerly S, et al. Turnover of CD4+ and CD8+ T lymphocytes in HIV-1 infection as measured by Ki-67 antigen. J Exp Med 1998; 187: 1295 - 1303

293. Rosenzweig M, DeMaria MA, Harper DM, et al. Increased rates of CD4(+) and CD8(+) T lymphocyte turnover in simian immunodeficiency virus-infected macaques. Proc Natl Acad Sci U S A 1998; 95: 6388 - 6393

294. Hellerstein M, Hanley MB, Cesar D, et al. Directly measured kinetics of circulating T lymphocytes in normal and HIV-1-infected humans. Nat Med 1999; 5: 83 - 89

295. Hazenberg MD, Stuart JW, Otto SA, et al. T-cell division in human immunodeficiency virus (HIV)-1 infection is mainly due to immune activation: a longitudinal analysis in patients before and during highly active antiretroviral therapy (HAART). Blood 2000; 95: 249 - 255

296. McCune JM, Hanley MB, Cesar D, et al. Factors influencing T-cell turnover in HIV-1-seropositive patients. J Clin Invest 2000; 105: R1 - R8

297. Fleury S, Rizzardi GP, Chapuis A, et al. Long-term kinetics of T cell production in HIV-infected subjects treated with highly active antiretroviral therapy. Proc Natl Acad Sci U S A 2000; 97: 5393 - 5398

298. Fleury S, de Boer RJ, Rizzardi GP, et al. Limited CD4+ T-cell renewal in early HIV-1 infection: effect of highly active antiretroviral therapy. Nat Med 1998; 4: 794 - 801

299. Folks TM, Kessler SW, Orenstein JM, et al. Infection and replication of HIV-1 in purified progenitor cells of normal human bone marrow. Science 1988; 242: 919 - 922

Posted by: Chris Noble | October 2, 2007 1:23 AM

"In studies where cohorts have been followed only a small proportion do not show progressive depletion of CD4+ cells."

Prove it Chris, with a cite, so I can take down your cite by showing all of the drug addicts and all of the people taking ARV's which are proven to lower CD4 counts, and all of the other cofactors to CD4 loss and poor immune system health in every cohort cite that you present.

"LTNPs are a minority."

Really? They had no problem rounding up a thousand of them in short order in Boston recently. And that they found that many when the vast majority of Long Term NonProgressors's refuse to have anything to do with HIV drugs or HIV doctors and researchers is fairly amazing.

LTNP's and even HIV positives who take the AIDS drugs are not displaying any immune problems or any low CD4 counts unless they have other cofactors of self destructive behaviors and other factors, including some of the HIV drugs.

"CD4+ counts vary from individual to individual and from time to time."

Exactly. So why are you trying to attribute it to HIV.

I can't remember things that never were.

How convenient to decide that things that go against your propaganda and preaching "never were". But your memory lapses do not erase Rodriguez et al from the books, now do they.

Furthermore, Chris, you conveniently have also forgotten the very recent CD4 mathematical modelling study that also shows CD4 counts to be impossible to being due to HIV.

Posted by: Michael | October 2, 2007 1:37 AM

Michael,

Once again you demonstrate your ignorance.

Unlike the blind men and the elephant, your ignorance is voluntary. You are the ostrich and the elephant, burying your head in the sand while trying to describe that which your refuse to see.

The full text of the PNAS paper you refer to is available free of charge to anyone who is interested.

This paper does not demonstrate that "HIV infection INCREASES CD4 T-CELLS," as you falsely claim. Nor does the paper show that "HIV drugs themselves cause loss of these cells."

This paper shows an increase in the proliferation of CD4 T-cells in HIV-infected patients, even though the level of CD4 T-cells declines.

Hmmmmm? How could the number of cells decline even if cell proliferation increases? Oh, I get it, the cells are dying!

The finding that HIV RNA plasma levels correlate with levels of T cell proliferation strongly suggests that polyclonal lymphocyte activation and T cell division are driven by the level of viral replication. Blocking HIV-1 replication with HAART leads to decreased immune activation, cell division, and cell death. By treating HIV-1 infection with HAART, although one sees decreases in CD4+ T cell division, there is an increase in the CD4+ T cell count as the rate of CD4+ T cell production (although now decreased) exceeds the rate of cell death. Conversely, after cessation of HAART, although one sees increases in CD4+ T cell division, T cell counts decline as cell death exceeds cell production as the viral load rebounds.

Michael, in this case you are copying-and-pasting from what, I guess, passes as a leading Denialist Web Site--and they got the science completely wrong. Compare the actual paper to the distortion from the Denialist Web Page--Such a distortion cannot possibly be an honest mistake. It can only be a lie by individuals with a baltant disregard for the truth.

I can see why youget along with them so well.

Posted by: Franklin | October 2, 2007 1:59 AM

A couple more:
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17641065&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

"Programmed death 1 expression on HIV-specific CD4+ T cells is driven by viral replication and associated with T cell dysfunction"

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=16917489&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

"Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction."

Seriously Michael, go to one of the above links, read the paper and then follow the links on the side to more papers and stop reading the denialist websites.

As for "you are full of crap about HIV causing a loss of CD4 T Cells" read these and again, please follow the links and read up.

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=9028959&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

"Role of Fas ligand and receptor in the mechanism of T-cell depletion in acquired immunodeficiency syndrome: effect on CD4+ lymphocyte depletion and human immunodeficiency virus replication"

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=16046522&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

"CD4+ T-cell death induced by infectious and noninfectious HIV-1: role of type 1 interferon-dependent, TRAIL/DR5-mediated apoptosis"

Posted by: Jim | October 2, 2007 2:13 AM

Really? They had no problem rounding up a thousand of them in short order in Boston recently

Ummm. They still appear to be recruiting. Have they gotten 1000 elite controllers yet. They report that they are attempting to find 1000. Are you sure that you aren't -- misreading something?

They also state that they estimate that 1 in 300 HIV infected people are elite controllers

Posted by: Chris Noble | October 2, 2007 3:17 AM

If 10 people had a headache, and the cause in 5 was a virus, and the other five it was stress IT DOES NOT MEAN THAT THE VIRUS IS NOT THE CAUSE OF THE HEADACHE IN THOSE 5 PEOPLE, JUST BC THERE ARE OTHER PEOPLE WITHIN THE SAME GROUP WITH THE SAME SYMPTOMS. WITH CFS ITS THE SAME, JUST BC THE SYMPTOMS ARE SOMEWHAT SIMILAR DOESNT MEAN THE CAUSE IS THE SAME IN EVERY PATIENT. SO THEY SHOULD NOT BE GROUPED TOGETHER, THEY SHOULD BE DIVIDED BASED ON THE CAUSATION, WITH SOME IT COULD BE DEPRESSION , OTHERS MYCOPLAMSA INCOGNITUS, OTHERS METABOLIC DISORDERS...........ETC

So what you are saying is that Mycoplasma fermentans(incognitus) does not fulfil Koch's postulates.

Posted by: Chris Noble | October 2, 2007 3:45 AM

quite the opposite, just like the virus that caused the headache in 5 of 10 people with the same symptoms, while in the other 5 it was stress, you take those 5 people with virus induced headache and classify them in a new disease category, which is the same thing that should be done for those people with complex multi organic infectious like symptoms that are positive for Lo's pathenogenic mycoplasmas.

Those who test postitive for mycoplasma penetrans/incognitus should be given a put in a new disease category, they should be labeled as being mycoplasma penetrans positive, much like hiv positive people, they get diagnosed on basis of causation, not similar sharing symptoms, for if we used that method hiv could not be the cause of AIDS bc the symptoms vary greatly from one person to another, some get dementia, some dont etc etc.

Posted by: cooler | October 2, 2007 7:41 AM

Michael:

The point of my post had nothing to do with whether HIV-1 had produced AIDS in this patient. (I'm assuming it had.) The key item was this:

Phylogenetic analysis of viral sequences obtained during the follow-up has permitted the identification of superinfection with 2 strains and the appearance of a recombinant virus in the viral population.

This means that the genetic diversity of HIV-1 (and presumably any other sort of HIV) will increase through both point mutation and recombination.

Posted by: AK | October 2, 2007 9:56 AM

Cooler says I lie about Lo and the mycoplasma. The guy who says they didn't find data recorders in Pennsylvania!

Lo said he found a new AIDS virus in 1986. He didn't give more details for three years! He didn't give other scientists his materials so they could verify it. He still said it was a virus in 1989. He was wrong for at least three years. He had EMs and he called it a virus. Cooler calls him a genius.

HEres an article from 1989 when Lo still said it was a virus. New york Times Lawrence K. Altman, "The Doctor's World; AIDS Finding piques curiosity, but scientists are wary" April 11, 1989

Dr. Lo has apparently not provided crucial biological reagents to other researchers. Such reagents include molecular probes that can detect genetic material in viruses. In addition, Dr. Lo has been remarkably reticent, declining to discuss his studies recently with reporters or to participate in the usual give and take with scientists.

Even though he acted like that to people other people were still interested in his stuff.

More than a dozen AIDS researchers said Dr. Lo's work was provocative. In general, they agree with Dr. David Baltimore, the Nobel Prize-winning virologist, who said the findings were "interesting and ought to be followed up."

But so scientists who looked at the EMs thought it didn't look like a virus but they couldn't check it because Lo wouldn't give it out like scientists are supposed to do.

Scientists have cited several limitations in Dr. Lo's paper, including the poor quality of the photographs of the virus taken through an electron microscope. Some critics contend that the photos do not show a virus.

Everyone wanted more info. Like Dr. Fauci.

Dr. Anthony S. Fauci, an AIDS expert who directs the National Institute of Allergy and Infectious Disease, said that Dr. Lo had given a seminar at the National Institutes of Health about his research. But Dr. Fauci said he had to ask Dr. Lo about six times before he agreed to do it, and he came only under the stipulation that no one from Dr. Gallo's laboratory could be there. "That is ridiculous for a scholarly person," Dr. Fauci said, "and he turned off a lot of people."

Six times. He refused. Then he complains no ones interested in his research. But they were, even after that Gallo still said good things about the research.

Cooler says Fauci does "GENOCIDE" all caps. What asking a dude to present his stuff six times is genocide? I think you do all caps at Lo not Fauci.

article from later,
Lawrence K. Altman, "The Doctor's World; Unusual Microbe, once dismissed, is now taken more seriously" January 16 1990 New York Times

A guy whose suppressing stuff to do GENOCIDE doesn't say stuff like this,

"We have an open mind and we are trying to see if we can settle this one way or the other over the next several months," said Dr. Anthony S. Fauci, who heads the National Institutes of Allergy and Infectious Diseases. "If it is an important pathogen, then let's see what we can do about it. And if not, let's move on."

And what happened at that meeting in 1990

"The pathology data was solid and convinced us that the agent is in the tissues," Dr. Baseman said. The ability of M. incognitus to cause a fatal wasting disease in monkeys and mice persuaded most participants that the microbe "has the potential to cause disease in humans," Dr. Baseman said, although solid proof is lacking.

Solid proof lacking.

Twenty years now and still not much good evidence the Nicolson studies and Los studies are with small numbers. Some people don't find the mycoplasmas in CFS like the Vernon et al study. A Japanese lab and a English lab did experiments and they didn't think the Lo mycoplasma was unique. STill today a lot of people think it was contaminants. Montagnier was really interested in this thing but his lab found mycoplasmas by PCR in healthy people and sick people at low rate, Kovacic et al JCM 1996, and weren't statisticly different. Montagnier found some reasons to think penetrans is a OI in AIDS patients and it could make progression faster.

Cooler looks at this stuff and he speculates and he says it causes all these different diseases when even Lo doesn't say that. Cooler thinks like this. If Nicolson or Lo finds mycoplasma in tissue with antibodies then the antibodies are fine. But if Lo doesn't find it with antibodies then well the government was forcing him to lie or the antibodies don't work. If Nicolson finds it in blood with PCR then PCR is great. But when Lo doesn't find it in blood then it's the government again or the top Armed Pathology generalissimo has a lab where they don't store blood right. If other labs like Vernon et al don't find it in blood with PCR then they should of looked in cells or in tissues with the antibodies that don't work or do work depending whose using them. But when Montagnier, Kovacic et al JCM 1996 looks in cells its there in like ten percent of healthy people and less of people with HIV.

Maybe Mycoplasma does something in "CFS" or "GWS" and maybe its another OI in AIDS but if you read all this papers your thinking well what the hell. This is lots of contradiction and not very much proof. Defanitely much much weaker then the papers for HIV and AIDS. It kinda helps to be a conspiracy theorist I guess.

Posted by: Adele | October 2, 2007 12:33 PM

Also look up HIV infection and T cell apoptosis, as mechanisms for cell death have also been described.

Posted by: Jim | October 2, 2007 1:27 PM

a patient complains of diahrrea, mild fatigue, painful urination, memory loss, joint pain she claims its slowly worsening. All tests are normal, except for an abnormal spect scan, and some lymph node swelling.

Most doctors write it off as stress, one gave her a diagnosis of CFS, another lupus, another complicated depression w mild paranioa, all the while she has Lo's mycoplasma penetrans in her blood.

The patient repeatedly goes to the doc saying the symptoms are worsening. Patient feels suicididal and does not respond to antidepressents...........................

HOW DARE YOU NOT LET HER KNOW ABOUT LO'S RESEARCH AND THAT SHE IS PCR POSITIVE FOR MYCOPLASMA PENETRANS, a microbe that causes aids like symptoms in chimps and kills every other animal inoculated ARE YOU PEOPLE SICK TO NOT INFORM HER OF THIS?

Posted by: cooler | October 2, 2007 7:40 PM

HOW DARE YOU NOT LET HER KNOW ABOUT LO'S RESEARCH AND THAT SHE IS PCR POSITIVE FOR MYCOPLASMA PENETRANS, a microbe that causes aids like symptoms in chimps and kills every other animal inoculated ARE YOU PEOPLE SICK TO NOT INFORM HER OF THIS?

Are you referring to yourself in the third person?

Posted by: Chris Noble | October 2, 2007 9:23 PM

Sorry Roy, sometimes your comments leave me a little confused, were you being merely ignorant, totally dishonest, or completely full of shit when you questioned above, my statement that D4T was related to DDT?

dideoxythymidine (ddT) and didehydrothymidine (d4T)

Posted by: Michael | October 2, 2007 9:49 PM

no, MY SISTER SON, DONT GET INVOLVED IN MY PERSONAL LIFE, fully recovered with abx, no thanks to the peices of garbage who gatekeep the scientific establishment,(drug companies and hacks AND LOSERS like fauci and all of their sycophants who troll these blogs, YOU PEOPLE ARE RESPONSIBLE FOR THESE ILLNESSES, IF FAUCI HAD A PRESS CONFERENCE OR MERCK HAD AN AD YOUD BE SINGING "MYCOPLASMA") YOU PEOPLE want to see people like that die.

other scientists are confirming nicolsons results........

SHYH CHING LO STARTED IT ALL , THE ONLY MICROBE DISCOVERED IN RECENT DECADES TO KILL SICKEN EVERY ANIMAL INJECTED. BOW YOUR HEAD.

Posted by: cooler | October 2, 2007 10:45 PM

vojandi, these scientists in Europe
Endresen GK.
Department of Rheumatology, The National Hospital, University of Oslo, Forskningsvn. 2-Block B, 0027, Oslo, Norway. gerhard.endresen@rikshospitalet.no

Chronic fatigue syndrome (CFS) and fibromyalgia syndrome (FMS) are characterised by a lack of consistent laboratory and clinical abnormalities. Although they are distinguishable as separate syndromes based on established criteria, a great number of patients are diagnosed with both. In studies using polymerase chain reaction methods, mycoplasma blood infection has been detected in about 50% of patients with CFS and/or FMS, including patients with Gulf War illnesses and symptoms that overlap with one or both syndromes. Such infection is detected in only about 10% of healthy individuals, significantly less than in patients. Most patients with CFS/FMS who have mycoplasma infection appear to recover and reach their pre-illness state after long-term antibiotic therapy with doxycycline, and the infection can not be detected after recovery. By means of causation and therapy, mycoplasma blood infection may permit a further subclassification of CFS and FMS. It is not clear whether mycoplasmas are associated with CFS/FMS as causal agents, cofactors, or opportunistic infections in patients with immune disturbances. Whether mycoplasma infection can be detected in about 50% of all patient populations with CFS and/or FMS is yet to be determined.

PMID: 12879275 [PubMed - indexed for MEDLINE]

Posted by: cooler | October 2, 2007 11:15 PM

here is a single blind, although it was single blind, patients reported a greater than 50% improvement, much more than what you would expect from a placebo accrding to the authors based on a previous studies

pilot study that showed much improvement with abx in cfs
http://www.translational-medicine.com/content/4/1/34

The gwi study was conducted 14 years after the gulf war, any infection treated that late will probably not show improvement also it was conducted by people with competing interests,
Department of Veterans Affairs
Pfizer
Department of Defense

all of these entities who conducted the study had conflicts of interest, the dept of defense repeatedly said it was stress, and they are sponsering the study? after all if they improved, then their would be a national scandal, for how did the mycoplasma get in their blood? They did improve in the first since months according to nicolson, but when those results were embarrasing they sabotaged the study, what else would you expect when adversaries are the judge?

Posted by: cooler | October 2, 2007 11:25 PM

first 6 months

Posted by: cooler | October 2, 2007 11:26 PM

Interesting you should bring that up Chris, considering EVERYONE DOES show as HIV positive on HIV elisa tests unless the sera is diluted 400 times

Michael are you incapable of registering new information. The fact that tests do not work properly when used incorrectly is of surprise to no-one except Denialists.

There are several HIV antibody tests that uses straight serum with no dilution. It is not true that they all test positive.

Other tests use diluents with agents such as BSA to block non-specific binding. If you don't use the diluent then you will get non-specific binding. What surprise!

Furthermore it is also interesting because EVERYONE DOES SHOW a registered HIV "VIRAL LOAD" on PCR tests. The quantity for most people is in the low range, in what is called "undetectable" but the FACT is that PCR is detecting something in everyone at the lowest ranges. Don't take my word for it, go send a sample of your own blood for a "viral load" test, and take a look. The system will have a count, however low, under viral load.

Viral load tests typically have a sensitivity of around 50 copies/ml. This is the limit of the accuracy of the test. A HIV- person would get a reading of

But how could you possibly know that unless every human being on earth has had their own dna unraveled. Just because a few have been, does not mean that significant differences won't be found in variance in small percentages of the worlds population.

If HIV were a recent addition to the human genome, ie. it was an exogenous retrovirus that incorporated itself into the human genome of an individual and passed itself onto the descendants of that person, then there would be a clear hereditary pattern. There isn't.

Posted by: Chris Noble | October 3, 2007 12:18 AM

here is a single blind, although it was single blind, patients reported a greater than 50% improvement, much more than what you would expect from a placebo accrding to the authors based on a previous studies

It isn't single blind. There was no placebo control group.

The GWI was a better controlled study and showed no improvement. Stop making ad hoc excuses to ignore it.

Posted by: Chris Noble | October 3, 2007 12:38 AM

Michael:

I don't have time to spend debating the paradigm. Just out of open-mindedness, I took a look at the link you offered me, and I found this quote from Duesberg:

"There cannot be a slow virus," Duesberg maintained. "If there is one, whoever proves it deserves the Nobel Prize in virology and in biochemistry.... A virus replicates like a biological chain reaction. It doubles its template every 20 minutes. This is not a process you can slow down or stop.... There's no way this thing could be delayed for 10 years.... They keep dancing around [the issue], with guys like [Pawel] Liberski inventing 'slow viruses,' but it's a term for not knowing what happened."

Any "scientist" who uses the phrase "there cannot be" is immediately suspect of not being a scientist, whatever his credentials. I'll allow for rhetorical hyperbole, but examination of what he deem "impossible" shows his ignorance.

The entire paradigm for retroviruses allows for "slow viruses". Many of these exist and have been isolated, including several forms of herpes.

I have myself suffered from shingles, known to be a form of chicken pox, which is caused by a retro-virus. (Yes, I know of the relationship with stress.)

Retroviruses are thoroughly embedded in the evolutionary paradigm used to examine evolution, so statements like the above put Duesberg in the same camp as the creationists/ID'ers. After all, there are many creationists with PhD's and other credentials as well.

Tara:

Can you easily point me to a reliable Web resource that describes the mammalian immune system in complete detail, along with how HIV-1 is thought to attack it, preferably in language an educated amateur can understand? That would be great!

Posted by: AK | October 3, 2007 9:23 AM

ad hoc excuses? Treat a syphillis patient 10 yrs later and see how much success you have/

ad hoc excuses, no such thing as conflicts of interest? then deusberg should conduct a study to see whether or not hiv causes aids, no one would claim any conflicts of interest, right lol?

vojandi replicated nicolsons study and found the same correlation. pub med him, or scroll back for the study.

Mycoplasma inconitus/penetrns kills/sickens every animal inoculated, including mice/primates and causes "aids like symptoms" in chimps, im sorry your pet microbes like hiv, hpv, hep c do nothing in virtually every animal. Stop making ad hoc excuses to deny reality.

Posted by: cooler | October 3, 2007 12:49 PM

Lo didnt reveal much bc he said he wanted to wait until he published, gallo was never interested in his work.

Posted by: cooler | October 3, 2007 12:54 PM

Dear Noble,

You said :

"Viral load tests typically have a sensitivity of around 50 copies/ml. This is the limit of the accuracy of the test. A HIV- person would get a reading of ..."

Could you tell if the noise in the assay is due to the sample or the machine ? If you run a sample of synthetic plasma (cannot have any HIV particle) do you still have the noise or no ?

If you dont have noise with synthetic plasma, but you have it with HIV-, Michael could still be right.

You also said :

"If HIV were a recent addition to the human genome, ie. it was an exogenous retrovirus that incorporated itself into the human genome of an individual and passed itself onto the descendants of that person, then there would be a clear hereditary pattern.".

If the HIV amount is so low that it cannot be measured, as Michael imply, you can not have any measured pattern per definition.

Thanks for clarifying, I have seen that you are an erudite scholar in the matter.

Posted by: Braganza | October 3, 2007 1:10 PM

Braganza very technical quesiton! OK!!

Could you tell if the noise in the assay is due to the sample or the machine ? If you run a sample of synthetic plasma (cannot have any HIV particle) do you still have the noise or no ?

Good assays shouldn't have "noise" the standard just goes down to 50. So below that its not noise really you just say undetectable or negative. Its all the standard you use if you have a good standard curve you can go down to 1 copy but thats very hard to be that good.

How it works is, you use a pure HIV reference nucleic aced and you know exactly how much you have and in different amounts. So you put them in your experiment and read them and you make a standard curve and you fit your unkown samples to it. So if your standards is
10 000 000
1 000 000
100 000
10 000
1 000 copies
Than your cutoff is a thousand copies bc you don't have any thing below it in your standard. If you get a number like 700 for a patient then you can't say 700 bc you don't know for sure without a standard below 1000. You can gues but its not good enough. But if you have 100 and 50 too than your cuttoff is 50 now so 700 is good. or 70 or 51.

A good tech how does this all the time with good reagents they make themself can go lower than 50 copies like I said down to 5 or 1 copy for some PCRS.