Seed Media Group

Discovering Biology in a Digital World

My thoughts on biology, teaching, life, and exploring the living world via the digital one. Only my opinions are represented by these postings, they do not represent the viewpoints of any funding agency or Geospiza, Inc.

Profile

Sandra Porter I am a microbiologist and molecular biologist turned tenured biotech faculty turned bioinformatics scientist turned entrepreneur. My passion is developing instructional materials for 21st century biology (Geospiza Education).

Search this blog

Learn about DNA with molecular models

Exploring DNA Structure


Subscribe to Geospiza Education News


e-mail digitalbio at gmail.com


DigitalBio Favorites

Molecular Momentos


Recent Posts

Recent Comments

Archives

Categories

Blogroll

Science Education Groups

Science Blogs School Fundraiser



Keep up to date

Awards

Red Orbit

Digital Bio at Blogged


Add Digital Bio to your Technorati Favorites!

Interesting places

  • xkcd
  • The Tangled Bank
    MicrobeWorld Radio

    « Accession numbers for primer design | Main | Gadget Lust »

    Test PCR primers with blastn

    Category: Chautauqua 2007
    Posted on: June 28, 2007 5:25 PM, by Sandra Porter

    When we make primer sequences for an assay, two characteristics we're concerned with are the specificity of the primers and the sensitivity.

    We can use blastn to evaluate whether or not our primers are likely to work.

    Specificity: The specificity of a primer set is related to whether the primers are binding only to the sequences that we want to detect or to additional sequences. If our primers bind to lots of sequences - or even unrelated sequences- then they are probably not specific enough. If we made primers that were complementary to a polyA addition site or to an Alu sequence, we would have problems since the primers might bind to many sites in a genome.

    Sensitivity: The sensitivity of a primer set is related to whether or not the primers detect the sequences that we want to detect. If they do not detect the sequences that we wish to see, then the test isn't sensitive enough.

    We are going to blastn to test two sets of primers that might be used in a PCR experiment and try to determine the following things:

    1. What sequence do the primers detect?

    2. Do the primers detect more than one sequence and does this make sense based on what you can learn about the sequences?

    3. How big would you expect the PCR product to be? - if multiple sequences were detected, find the sizes for the two of the amplification products.


    Here are two sets of primers:

    1. Set 1
    Forward 5' CAACTCGCCTGCATGAAGC 3'
    Reverse 5' GGGAATCTCCGGATCTATGCT 3'

    2. Set 2
    forward 5' CAGCAGCTTTCATTGGAAACAC 3'
    reverse 5' GTAGGGAAGTAGGTTGAGGTCG 3'

    Instructions
    1. Go to the NCBI.
    2. pick blastn
    3. enter your primer sequences in this format:

    forwardprimerNNNNNNNNNNNNNNNNNNNNNNNNreversecomplementofreverseprimer

    click BLAST


    Comments

    #1

    I would use Jim Kent's hgPCR rather than blast...

    Posted by: Pierre | June 29, 2007 2:58 AM

    #2

    That looks nice! I especially like that it will make the reverse complement for your second primer.

    The downside that I see with this web service is that the database selections are pretty limited. If you're working on Drosophila or one of the genomes in the list, you'll be fine.

    If you're working on bacteria or plants or any of the several thousands of species that aren't on the list, you're out of luck.

    Posted by: Sandra Porter | June 29, 2007 9:59 AM

    Post a Comment

    (Email is required for authentication purposes only. Comments are moderated for spam, your comment may not appear immediately. Thanks for waiting.)





    Having problems commenting? (UPDATED)

    Blogs in the Network

    Advertisement

    Top Five: Most Active

    1. Priorities 07.23.2008 · PZ Myers
    2. Evolution happens 07.23.2008 · PZ Myers
    3. Idiot of the Century? 07.23.2008 · Ed Brayton
    4. Against Theoretical Archaeology 07.23.2008 · Martin R
    5. Enough with Radovan Karadzic, already! (Or, the mini-Hitler Zombie dodged) 07.23.2008 · Orac

    Search All Blogs

    Top Science Stories

    powered by SEED - seedmagazine.com