hit counter joomla

Here’s a fun puzzler for you to figure out.

The blast graph is here:

i-02f5f2aaa95bc8ab8660ebaba090a49e-graph.png


The table with scores is here, click the table to see a bigger image:

i-c6f0f4e4fc0d3b6f0f299d302de71acd-smaller_table.png

And here is the puzzling part: Why is the total score so high?

If you want to repeat this for yourself, go here.

You can use this sequence as a query (it’s the same one that I used).

>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA
CACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTG
ATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGAGGAGG
AAGGCATTGTGGTTAATAACCGCAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAAC
TCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAA
AGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCA
TTCGAAACTGGCAGGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAAT
GCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTC
AGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT
GTCTATTTGAAGGTTGTTCCCTTGAGGAGTGGCTTTCGGAGCTAACGCGTTAAATAGACCGCC
TGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTG
GAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAC

And change the database to Reference genomic sequences.

I’ll post the answer next Friday.

Comments

  1. #1 Gustavo
    March 7, 2008

    The total score is the sum of the scores of all the HSPs (alignments). In this case there are lots of HSPs, because this sequence appears many times in the target genomes.

  2. #2 Sandra Porter
    March 9, 2008

    You got it.

The site is currently under maintenance and will be back shortly. New comments have been disabled during this time, please check back soon.