Myrmecos
Archives for April, 2010
A pleasingly pink pea aphid (Acrythosiphon pisum) A long time ago, on a host plant far, far away, an aphid became infected with a fungus. And then it did something unusual: it incorporated some fungal genes into its own genome. New research by Nancy Moran and Tyler Jarvik, published yesterday in the journal Science, used…
Podabrus sp. Soldier Beetle Urbana, Illinois Last week we featured a larval soldier beetle. Today we have an adult of the same family (Cantharidae), in the genus Podabrus. photo details: Canon EOS 50D camera Canon MP-E 65mm 1-5x macro lens ISO 100, f/13, 1/250sec
Blog posts are long, thin things. One could, for example, use a blog to post a high-resolution map of Chile. Or a single strand of spagetti. Any image up to 500 pixels wide, for as long as it goes. In that vein, here’s a Cephalotes varians turtle ant: Just wait until I find a stick…
Yesterday, Antweb posted its first images of Anomalomyrma workers, and I’ve been staring at them ever since. This is a strange ant indeed, a member of the ancient subfamily Leptanillinae that is potentially a sister lineage to the remaining extant ants. It’s ostensibly a subterranean predator in the forests of tropical Asia, but beyond that…
What was that dazzling sequence of nucleotide bases? Here’s a more holistic view: Aedes albopictus, the Asian Tiger Mosquito The gene was ribonucleotide reductase, which is essential for DNA synthesis. If you followed the BLAST results back through to the paper where this sequence was published, you’ll see that the researchers were interested in this…
The U.K.-based film company Ammonite has been blogging their ant-filming experiences in Costa Rica and Spain. The glamor of making nature documentaries apparently includes skin parasites and volcano-related travel limbo. The journal Myrmecological News has a trio of new articles, including descriptions of two new myrmicine species. Ted MacRae thinks ant taxonomy is entirely too…
I apologize for the slow blogging this weekend. We took a little road trip up to beautiful Madison, Wisconsin and were too busy with bratwurst, cheese, beer, and roller derby to bother with the internet. Atta cephalotes in the fungus garden The University of Wisconsin is home to Cameron Currie, whose lab is at the…
This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…
You’re in luck! Antweb has added an excellent blog to handle submitted questions. The answer squad is headed by myrmecologists at the Chicago Field Museum, and so far they’ve fielded queries about what ants do in winter, whether fire ants will reach the northern U.S., the difference between ants and termites, and several others. Send…
From “Life in the Undergrowth“, perhaps the finest insect documentary ever made, a scene featuring Australia’s intertidal ants: A few years back I traveled through northern Queensland with myrmecologists Phil Ward and Gary Alpert. Having heard about the aquatic abilities of these ants, we searched for them in a mangrove forest just outside the Cairns…