Fun

Myrmecos

Category archives for Fun

Playwright Tom Stoppard retells Shakespeare’s Hamlet as an absurd comedy from the perspective of two minor characters. The brilliant Gary Oldman and Tim Roth star in Stoppard’s own film adaptation (1990). Here’s an excerpt:

Monday Night Mystery

This looks like it could be painful. What is it? Five points to the first person to name the organism, and five for the structure. The cumulative points winner for the month of May will win either 1) any 8×10 print from my insect photo gallery, or 2) a guest blog post on the (safe-for-work)…

The Boneyard Bombshells (red) take on The ‘Paign (blue) in Champaign-Urbana’s first ever roller derby bout How many rocket scientists does it take to set up a roller derby bout? Apparently, the answer is two. That’s how many were on hand Friday night to help lay the track for Champaign-Urbana roller derby‘s sold-out exhibition bout.…

The trailer for the 1977 film “Empire of the Ants“:

Monday Night Mystery

What is this odd little beast? Five points each for the first person to pick the order and the family. The cumulative points winner for the month of May will win either 1) any 8×10 print from my insect photo galleries, or 2) a guest blog post on the (safe-for-work) topic of their choosing.

The very funny Rowan Atkinson:

Monday Night Mystery

What’s this? 2 points for naming the structure, 4 for family, and 4 for genus/species. The cumulative points winner for the month of May will win either 1) any 8×10 print from my insect photo galleries, or 2) a guest blog post on the (safe-for-work) topic of their choosing.

How did they catch this footage of an ANTi-pesticide protest? Here’s a peek behind the scenes.

I apologize for the slow blogging this weekend. We took a little road trip up to beautiful Madison, Wisconsin and were too busy with bratwurst, cheese, beer, and roller derby to bother with the internet. Atta cephalotes in the fungus garden The University of Wisconsin is home to Cameron Currie, whose lab is at the…

Monday Night Mystery

This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…