Science

Myrmecos

Category archives for Science

Have an ant question?

You’re in luck! Antweb has added an excellent blog to handle submitted questions. The answer squad is headed by myrmecologists at the Chicago Field Museum, and so far they’ve fielded queries about what ants do in winter, whether fire ants will reach the northern U.S., the difference between ants and termites, and several others. Send…

Strumigenys rogeri in the leaf litter In 1982, a small journal called The Coleopterists Bulletin carried a two page note by beetle expert Terry Erwin that increased- by an order of magnitude- the estimated number of species on the planet. Erwin crunched some back-of-the-napkin numbers based on the tree specificity of arthropods he’d collected in…

E. O. Wilson was wrong!

The downside to a celebrated and prolific scientific career is that you generate enough of a paper trail for something you concluded, somewhere, to be erroneous. I happened on an amusing example this week while photographing the Caribbean turtle ants I blogged about earlier. Like most of the world’s 12,000 or so ant species, not…

Penthe pimelia (Tetratomidae) Illinois, USA A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity. As I’m not a Coleopterist, I spent most of my time lost…

Answer to the Monday Night Mystery

Plega sp. (Mantispidae) Who was the source of Monday’s DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae. 10 points to Aaron Hardin, who guessed it first. For future reference, these genetic puzzles are only slightly more complicated than a…

Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil: Having trouble?  I’ve arranged a Formica specimen to model the pose: In the comments below, Vincent provides his perspective:

Monday Night Mystery

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence: ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA What sort of organism did it come from? Ten points to the first person who can pick the genus.

Taxonomy Fail

Today’s breaking news in Ant Science is this: Newly discovered pieces of amber have given scientists a peek into the Africa of 95 million years ago, when flowering plants blossomed across Earth and the animal world scrambled to adapt. Suspended in the stream of time were ancestors of modern spiders, wasps and ferns, but the…

Above the Ant Line

[a guest post by myrmecologist Andrea Lucky] Andrea & her intrepid field team in New Guinea It was a dark and stormy night… …actually, it was a dark and stormy morning.  The dawn of the 7th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week…

New Species: Myrmicocrypta camargoi

Myrmicocrypta camargoi Sosa-Calvo & Schultz 2010 Brazil The world’s ant fauna continues to yield new treasures. Myrmicocrypta camargoi, described in a new paper by Jeffrey Sosa-Calvo & Ted Schultz, is the largest species in this fungus-growing genus. source: Sosa-Calvo, J., Schultz, T.R. 2010. Three Remarkable New Fungus-Growing Ant Species of the Genus Myrmicocrypta (Hymenoptera: Formicidae),…