dna

Myrmecos

Tag archives for dna

Monday Night Mystery

This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…

Bees in the DNA

This photo was ultimately rejected for a journal cover (it was the wrong shape!) but I shot it to accompany a research article that used museum specimens of midwestern bumblebees to compare current levels of genetic diversity with previous decades.  Since this image won’t appear in print anytime soon, I thought I’d share it here…