dna
Myrmecos
Tag archives for dna
Monday Night Mystery
Posted by Alex Wild on April 26, 2010
(9)
This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…
Bees in the DNA
Posted by Alex Wild on March 6, 2009 This photo was ultimately rejected for a journal cover (it was the wrong shape!) but I shot it to accompany a research article that used museum specimens of midwestern bumblebees to compare current levels of genetic diversity with previous decades. Since this image won’t appear in print anytime soon, I thought I’d share it here…