genetics

Myrmecos

Tag archives for genetics

Monday Night Mystery

This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…

Monday Night Mystery

In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence: ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA What sort of organism did it come from? Ten points to the first person who can pick the genus.

Bees in the DNA

This photo was ultimately rejected for a journal cover (it was the wrong shape!) but I shot it to accompany a research article that used museum specimens of midwestern bumblebees to compare current levels of genetic diversity with previous decades.  Since this image won’t appear in print anytime soon, I thought I’d share it here…

A beetle genome

Tribolium castaneum – Red Flour Beetle The genome of the red flour beetle Tribolium castaneum was published today in Nature. This latest insect genome is interesting not for what it says about beetles but for what it says about another model species, the venerable fruit fly. The more we learn about other insect genomes- the…

Making the Cover

The smallest insect I’ve ever photographed made the cover of the scientific journal Genetics this week. Encarsia pergandiella, an aphelinid wasp not even a millimeter long, was the subject of a study by Perlmann, Kelly, and Hunter documenting the reproductive consequences of infection by bacterial parasite. The wasp lab is downstairs from ours, so it…