mystery

Myrmecos

Tag archives for mystery

Monday Night Mystery

This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…

Monday Night Mystery

Alright, Sherlock.  What’s going on here? Five points each for the identity of the big round thing, for the insect at the top, and for the insect at the side. Ten points for describing the story. And a freebie point to anyone who comes up with an idea for what to do with all these…

Update on the oddity

I hadn’t anticipated that my keen readers would try to guess the *species* of the aforementioned oddity, but since the guessing has headed in that direction I’ll post this hint, which shows the much more commonly seen worker caste of our little mystery bug. Stakes are now at, um, 15 points. Yeah.

An oddity

This odd little beast crawled out of a leaf litter sample from a mesic oak/pine forest in Florida. Ten points to the first person who picks what it is. (Not sure what you’ll do with ten points.  But hey.  You’re all a creative lot.)

Mystery Myrmecophile

I photographed this weird…sluggy thing, I guess you could say, in an ant nest in subtropical Argentina.  Ten points to the first person who picks what it is.