mystery
Myrmecos
Tag archives for mystery
Monday Night Mystery
Posted by Alex Wild on April 26, 2010 This week we delve into the genes of the mystery organism. Here’s a short snippet of DNA: ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA 5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study. I’ll post the answer tomorrow. Since we’ve…
Monday Night Mystery
Posted by Alex Wild on March 8, 2010 Alright, Sherlock. What’s going on here? Five points each for the identity of the big round thing, for the insect at the top, and for the insect at the side. Ten points for describing the story. And a freebie point to anyone who comes up with an idea for what to do with all these…
Update on the oddity
Posted by Alex Wild on June 29, 2009 I hadn’t anticipated that my keen readers would try to guess the *species* of the aforementioned oddity, but since the guessing has headed in that direction I’ll post this hint, which shows the much more commonly seen worker caste of our little mystery bug. Stakes are now at, um, 15 points. Yeah.
This odd little beast crawled out of a leaf litter sample from a mesic oak/pine forest in Florida. Ten points to the first person who picks what it is. (Not sure what you’ll do with ten points. But hey. You’re all a creative lot.)
Mystery Myrmecophile
Posted by Alex Wild on May 20, 2009 I photographed this weird…sluggy thing, I guess you could say, in an ant nest in subtropical Argentina. Ten points to the first person who picks what it is.