Oscillator

Your Name in Protein

Posted by Christina Agapakis on September 22, 2010
(4)
More »

Thanks to the internet, you can find out your pirate name and your Jersey Shore name, and now thanks to the EMBL-EBI learning tools, you can find your protein name too!

i-56b4be169b9300bc69843e0238e66ba2-decode-thumb-510x92-56078.pngWhen you type your name into the box, the program reads the letters of your name as if they were the single-letter codes for amino acids. Since there are only 20 amino acids, if you have a B, J, O, U, X, or Z in your name the program reads it as “X” which just means any amino acid could go in that spot.

i-0c67972e7d973d10a9b37dfa87582d3b-aminoacidcodes.pngThe amino acids are then translated back into one of the possible three-letter DNA codes for each amino acid, and that DNA sequence is searched against the genome databases for the protein that has the closest match to your name.

i-71c25520f21df22392a8ac954c9f840a-genetic code.jpgMy name becomes TGCCACAGAATCAGCACCATCAACGCCGCCGGCGCCCCCGCCAAGATCAGC
in DNA, and the closest protein match is Phosrestin from fruit flies (apparently they allow a lot of gaps in the search), a protein involved in the fly photoreceptor.

i-d27dd965cd7ee94548bb8b97d1f1c2d2-proteinname.pngSynthetic biologists like Craig Venter sometimes like to code their own “watermark” into artificially synthesized DNA sequences as a way to sign their work, so it’s fun to be able to turn it around and search for words already there (btw, Craig Venter’s closest protein name match is Fructose-bisphosphate aldolase 1 from the garden pea).

What’s your protein name?

via @christianbok, the DNA poet.

Keywords: , , , , , ,
(4)
More »

Comments

  1. #1 Plinthy the Middling
    September 22, 2010

    You shouldna done dis. You doan unnerstan: I coulda had class — on the Jersey Shore, dey call me da T’rill. I coulda been a contender — the pirate Machete Rupert Mango-Terwilliger. I coulda been SOME body … instead of a heat shock protein in Salmonella paratyphi A, which is what I am.

  2. #2 Sean
    September 23, 2010

    Well, I appear to work on digesting insects on behalf of a bacteria (Photorhabdus luminescens) that lives in symbiosis with a parasitic nematode worm. I’d always suspected as much.

  3. #3 TBnSuch
    September 24, 2010

    50S ribosomal protein in Wigglesworthia glossinidia brevipalpis, a microbe that carves out a living as an endosymbiont in the gut of a tsetse fly. Damn it, now people are going to start calling me Wigglesworth.

  4. #4 Ryan
    October 4, 2010

    You could take it one step further and turn your protein name into music:
    http://www.doe-mbi.ucla.edu/cgi/pettit/gene2musicweb
    Who knows, you might be able to fist pump to the situation’s protein name. They have some example protein jams on the site as well. However, I don’t recommend the Huntingtin protein; the trinucleotide repeat music even sounds like a disease.