Seed Media Group

Pharyngula

Evolution, development, and random biological ejaculations from a godless liberal

Search

Profile

pzm_profile_pic.jpg
PZ Myers is a biologist and associate professor at the University of Minnesota, Morris.
zf_pharyngula.jpg …and this is a pharyngula stage embryo.
a longer profile of yours truly
my calendar
Nature Network
RichardDawkins Network
facebook
MySpace
Twitter
Atheist Nexus
the Pharyngula chat room
(#pharyngula on irc.synirc.net)

I reserve the right to publicly post, with full identifying information about the source, any email sent to me that contains threats of violence.

tbbadge.gif
scarlet_A.png
I support Americans United for Separation of Church and State.

Random Quote

(Complete listing)

The Christian view that all intercourse outside marriage is immoral was, as we see in the above passages from St. Paul, based upon the view that all sexual intercourse, even within marriage, is regrettable. A view of this sort, which goes against biological facts, can only be regarded by sane people as a morbid aberration. The fact that it is embedded in Christian ethics has made Christianity throughout its whole history a force tending towards mental disorders and unwholesome views of life.

[Bertrand Russell]

Recent Posts

A Taste of Pharyngula

(Complete listing)

Recent Comments

Archives

Blogroll

(Complete listing)

Other Information

Subscribe via Email

Stay abreast of your favorite bloggers' latest and greatest via e-mail, via a daily digest.

Sign me up!

« I need to take a shower after reading that | Main | Wednesday Cephalopod: In flagrante delicto »

GFP wins Nobel Prize!

Category: Science
Posted on: October 8, 2008 11:21 AM, by PZ Myers

The Nobel in Chemistry this year goes to Osamu Shimomura, Martin Chalfie, and Roger Tsien for the discovery of Green Fluorescent Protein, GFP. That's well deserved — GFP is a wonderful tool, a simple protein that fluoresces. There are lots of fluorescent compounds out there, and most of them require some kind of artificial injection or application to get them into cells — they basically allow you to determine that "a needle was stuck in here", and also to allow us to visualize the morphology of individual cells, which is all very useful, and there's quite an industry built around making new probes of this sort. GFP is different. It allows one to use the molecular biology of the cell to generate your green glowing compound. If you want to know when and where a particular gene of interest is expressed, for instance, you just make a construct that couples the regulatory elements of that gene to a GFP gene, and presto, where ever the gene you're following is turned on, so is GFP, and the cell lights up like a little Christmas tree decoration. That's powerful stuff: it gives us a tool to follow patterns of gene expression visually, in real time, in living cells.

squid.gif

Wave those arms in praise of MSKGEELFTG VVPVLVELDG DVNGQKFSVS GEGEGDATYG KLTLNFICTT GKLPVPWPTL VTTFSYGVQC FSRYPDHMKQ HDFFKSAMPE GYVQERTIFY KDDGNYKTRA EVKFEGDTLV NRIELKGIDF KEDGNILGHK MEYNYNSHNV YIMGDKPKNG IKVNFKIRHN IKDGSVQLAD HYQQNTPIGD GPVLLPDNHY LSTQSALSKD PNEKRDHMIL LEFVTAARIT HGMDELYK!

    1 atgagtaaag gagaagaact tttcactgga gtggtcccag ttcttgttga attagatggc 
   61 gatgttaatg ggcaaaaatt ctctgtcagt ggagagggtg aaggtgatgc aacatacgga 
  121 aaacttaccc ttaattttat ttgcactact gggaagctac ctgttccatg gccaacactt 
  181 gtcactactt tctcttatgg tgttcaatgc ttctcaagat acccagatca tatgaaacag 
  241 catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatattttac 
  301 aaagatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 
  361 aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 
  421 atggaataca actataactc acataatgta tacatcatgg gagacaaacc aaagaatggc 
  481 atcaaagtta acttcaaaat tagacacaac attaaagatg gaagcgttca attagcagac 
  541 cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 
  601 ctgtccacac aatctgccct ttccaaagat cccaacgaaa agagagatca catgatcctt 
  661 cttgagtttg taacagctgc taggattaca catggcatgg atgaactata caaa

Comments

#1

Posted by: Rev. BigDumbChimp, KoT, OM | October 8, 2008 11:28 AM

MY EYES!!!!!!1111

#2

Posted by: Nerd of Redhead | October 8, 2008 11:31 AM

When I first read about GFP I thought it would be a great tool for biochemists. Good to see the discovery rewarded.

#3

Posted by: Cuttlefish, OM | October 8, 2008 11:31 AM

... like I'm supposed to be able to rhyme that.

#4

Posted by: Glen Davidson | October 8, 2008 11:40 AM

Makes critters psychedelic, too.

Glen D
http://tinyurl.com/2kxyc7

#5

Posted by: Blake Stacey | October 8, 2008 11:44 AM

Their protein had a healthy green glow,
A fluorescence which they found could show
The expression of an exon
(if you've your micro-specs on)
So now it's off to Stockholm they go!

#6

Posted by: Dr. Whore | October 8, 2008 11:49 AM

I use this protein everyday for electrophysiological studies on hypothalamic neurons.

As marine biologist by training, I have used GFP as good example to counter the argument that the only good science worth funding should be human-health related. If it weren't for those damn marine biologists, GFP technology would never had happen.

#7

Posted by: Confused | October 8, 2008 11:54 AM

Look in Coral, and you find some even more funky fluorescent proteins like Kaede - a protein that can be irreversably changed from green to red using UV light.

Probably unlikely to win a Nobel prize, though.

As a side note, there's a facility that generates GFP transgenic chickens about two hours away from where I work. Besides being useful, they're really cute, and as a bonus - no need to genotype!

#8

Posted by: Nate | October 8, 2008 11:54 AM

This totally makes up for the Nobel committee robbing the graphene group* yesterday. I think I weirded out my first boss when I once suggested after a lab meeting that we try to create cats and dogs with some sort of GFP or derivative marker in their skin and sell glowing pets.

*nerd fight!

#9

Posted by: Patricia | October 8, 2008 11:56 AM

That must be some real fine science. I didn't understand a damned word of it. ;o)

#10

Posted by: Nate | October 8, 2008 11:58 AM

This totally makes up for the Nobel committee robbing the graphene group* yesterday. I think I weirded out my first boss when I once suggested after a lab meeting that we try to create cats and dogs with some sort of GFP or derivative marker in their skin and sell glowing pets.

*nerd fight!

#11

Posted by: Paul Lundgren | October 8, 2008 12:07 PM

The green, it burns!

#12

Posted by: dNorrisM | October 8, 2008 12:08 PM

I decyphered it out to the the first pair ot EE aminos, shrugged my shoulders and assumed the rest is correct- why don't you biologists group the base pairs in multiples of 3?

#13

Posted by: Desert Son | October 8, 2008 12:27 PM

Won't someone please think of the color blind scientists!

Also, congratulations to the winners.

No kings,

Robert

#14

Posted by: no one | October 8, 2008 12:44 PM

Holy shit! When my biochemistry professor had assigned the definitive Tsien papers on GFP for reading, she flat-out predicted this Nobel!

#15

Posted by: Myself | October 8, 2008 12:49 PM

Ok that's all well and good, but when will I get *glowing green skin*, huh?

What use is a single cell? I want a glowing green tattoo built right into my arm!

Damn scientists. You can put a man on the moon but you can't give me a glowing green dragon permamently imprinted on my forearm.

#16

Posted by: gdlchmst | October 8, 2008 12:58 PM

Whiteside lost out again?!

#17

Posted by: Greg | October 8, 2008 12:59 PM

Is that a cipher text before the DNA sequence?

#18

Posted by: Platypus | October 8, 2008 1:02 PM

GFP is really amazing. It's the closest thing to a Babel Fish* I can think of.

("Now it is such a bizarrely improbable coincidence that anything so mind-bogglingly useful could have evolved purely by chance that some thinkers have chosen to see it as a final and clinching proof of the non-existence of God." -- Douglas Adams, Hitchiker's Guide to the Galaxy)

It's small enough and functions as an entirely self contained unit that it can be fused to your protein of interest and, most of the time, both parts continue to do their jobs well.

It's a fairly robust protein, but not so robust you can't break it with intense illumination. This has allowed for techniques like FRAP (Fluorescence Recovery After Photobleaching), which lets you break all the GFP molecules in a small spot. Then you measure how long it takes fluorescence to recover. This lets you measure how fast something is diffusing, or if your protein is statically bound to a structure.

Mutation and selection led to the development of different color variants (CFP, YFP, RFP) so you can track multiple proteins at the same time. They also have different excitation wavelengths, which allows for cool techniques like FRET (Fluorescent Resonance Energy Transfer). Illuminate CFP with a wavelength that doesn't excite YFP, and quantum resonance will allow the light emitted by CFP to excite YFP only when theyre within a few dozen nanometers of each other. So you can directly measure physical association. You can even make a molecule with CFP on one end, YFP on the other, and a phosphorylation target in the middle. When the protein is phosphorylated, it bends, inducing FRET. So it is possible to measure phosphorylation location and activity in real time live cell imaging.

You can do screens by having successful target cells express GFP, and recover those cells by flow cytometry.

You can localize it in different parts of the cell, like the cytoplasm or plasma membrane. This, with some random splicing tricks, has allowed the development of the "Brainbow", where neurons express a unique combination of colors to allow individual neuron tracking in brain tissue.

It has accelerated cell biology and is truly deserving of a Nobel. Congrats to the winners.

#19

Posted by: techskeptic | October 8, 2008 1:04 PM

#15,

Here you go.


Don't bother the biologists, they are working.

#20

Posted by: Nerd of Redhead | October 8, 2008 1:04 PM

Greg, that is the amino acid sequence in shorthand, where one letter of the alphabet stands for one amino acid. It weirded me out a little when I first saw it used.

#21

Posted by: Jon D. Moulton | October 8, 2008 1:10 PM

Here is a Morpholino oligo sequence written from 5' to 3' and complementary to your target:
TGAAAAGTTCTTCTCCTTTACTCAT

Brackets have been inserted around the mRNA target to illustrate its position in your sequence [shown below]. Note that the brackets are placed on a sense strand.
[(atg)agtaaag gagaagaact tttca]

Sorry, can't help it, you posted a targetable sequence.
Must --- design --- oligo ---

#22

Posted by: Kobra | October 8, 2008 1:12 PM

@3:

It's okay, man. You need not make a rhyme every time.

#23

Posted by: dreikin | October 8, 2008 1:15 PM

Jon D. Moulton @ #21:
Care to explain more? (eg, what makes the sequence targetable?)

#24

Posted by: madder | October 8, 2008 1:29 PM

I see that the Designer has given us some Holy Codes in the amino acid sequence. The first group of 10 includes the word EEL, so all you squid-worshippers are hugging the wrong slimy wiggly things. And at the end of the third line, there's QERTIFY, so you Dvořak-keyboard heretics better understand that the fires of hell await you.

#25

Posted by: Maria | October 8, 2008 1:30 PM

Is it wrong if all I can think of is that this discovery was used in one of the first season episodes of "The Big Bang Theory"?

#26

Posted by: Rob the Lurker FCD BMWCCA | October 8, 2008 1:34 PM

OT, but sciency...

Natural Born Fibber

It turns out that that "overhead projector" John McCain claimed Barack Obama tried to get a $3 million earmark for was actually money to rebuild Chicago's Adler Planetarium, the oldest planetarium in the United States.

McCain's "overhead projector" is the apparatus that runs the planetarium, which is a bit like calling the Palomar Observatory a new set of glasses.

--Josh Marshall


http://talkingpointsmemo.com/
#27

Posted by: morinao | October 8, 2008 1:37 PM

@17:

Greg, that is the incantation to summon Cthulhu (pictured) and make him glow green, one of the flashier examples of GFP's ubiquity in modern bioscience. A well-deserved Nobel Prize.

#28

Posted by: Jon D. Moulton | October 8, 2008 1:46 PM

@dreikin #23,

A steric-blocking antisense oligo like a Morpholino can prevent translation when targeted to the 5'-UTR through the start codon. This sequence is only for the coding region, starting with the start AUG (written as ATG in the cDNA sequence). A Morpholino can block translation as long as it covers the start codon, so there is one available target for this sequence (the one I selected).

If an oligo complementary to the target has bad characteristics, I wouldn't call the sequence targetable. Important parameters include the G content (too high and the oligo won't be water soluble), the presence of stable self-complementarities (which can make the oligo dimerize and lose activity), and the target affinity. The target affinity is a Goldilocks parameter -- with affinity too high the oligo will have subsequences with enough affinity to interact with short complementary regions of off-target mRNA, with affinity too low the oligo won't bind strongly enough to the target to inhibit the progression of the ribosome. The CG content of this oligo is 32%, on the low side but OK for cool-temperature creatures like zebrafish or Xenopus frogs. The Tm is calculated to be 83% at 10 uM, high enough that as long as the GFP is not expressed from a very strong promoter, the oligo should bind strongly enough to block translation. A strong viral promoter could probably swamp the oligo with transcripts, but usually GFP is expressed from weaker conditional promotors, so that should work out OK. Bottom line: this transcript is a good candidate for a knockdown.

#29

Posted by: The Chemist | October 8, 2008 1:53 PM

Damn you biologists! You be all up in our nobel committees stealin' our prizez!!!11!!one!

#30

Posted by: The Chemist | October 8, 2008 1:57 PM

Damn you biologists! You be all up in our nobel committees stealin' our prizez!!!11!!one!

#31

Posted by: JVF | October 8, 2008 2:01 PM

Co-creator of the yeast GFP library, here. Congrats to Prof. Tsien and colleagues! We couldn't have done it without ya....

#32

Posted by: cody | October 8, 2008 2:02 PM

I just made some N. benthamiana glow green with this little protein a few days ago. Nice to see it recognized; hopefully somebody near me will ask, "So I saw they gave a Noble for the discovery of Green Fluorescent Protein; what does that do?" because *I'll* be able to answer them!

[Sidenote: when will agrobacterium get its Noble? And I don't mean the discoverers of agrobacterium; I mean the bug itself -- it's proven itself to be a most competent genetic engineer.]

#33

Posted by: llewelly | October 8, 2008 2:05 PM

Damn scientists. You can put a man on the moon but you can't give me a glowing green dragon permamently imprinted on my forearm.
They never gave us consumer jetpacks or disintegrator rays either. Those bastards.
#34

Posted by: Nerd of Redhead | October 8, 2008 2:08 PM

Unfortunately, there is no Nobel prize in biology. So great research in biology has to be shoehorned into either chemistry or medicine. Chemistry lost out this year.

#35

Posted by: Masks of Eris | October 8, 2008 2:09 PM

Er, how soon can I get a GFP nightlight hamster?

Or a bunny? A red-eyed, green-hued critter in whose emerald glow I can read as the dark Finnish nights get darker.

#36

Posted by: James F | October 8, 2008 2:17 PM

#35

GFP bunny? Here it is.

#37

Posted by: W. Kevin Vicklund | October 8, 2008 2:20 PM

Bah! From the scientific background pdf:

The technical revolution resulting from the discovery of GFP relates to a miraculous property of the chromophore that is responsible for its fluorescence.

miraculous?!

#38

Posted by: Raynfala | October 8, 2008 2:28 PM

"Oh my God... it's full of CAT's"

#39

Posted by: Emmet Caulfield | October 8, 2008 2:46 PM

why don't you biologists group the base pairs in multiples of 3?

The only correct grouping is surely in 4's so that each group of 4 can be represented neatly and without overhead in a single hexadecimal digit... and I'll have none of your guff about codons.

#40

Posted by: Facehammer | October 8, 2008 3:16 PM

I put a GFP gene into a tobacco plant a couple of years ago. Interesting stuff.

Platypus (#18), that's all incredibly clever.

#41

Posted by: Brad D | October 8, 2008 3:19 PM

Cool, I want to have all my pancreatic beta cells to glow green!

That is if my immune system would stop killing them first ;)

#42

Posted by: Randall | October 8, 2008 3:30 PM

GFP is fine and all, but if you want to do really fun stuff you need its cousins, RFP, YFP, and CFP (the latter being cyan). And since GFP is too similar to both YFP and CFP, you can't actually use it for such experiments.

#43

Posted by: Neoriceisgood | October 8, 2008 3:46 PM


I don't know what fascinated me more;

The article or the fact that PZ Myers decided to stick in a random Lufia II enemy squid sprite.


Didn't they use this to create glowing green pigs though? I remember something like that.

#44

Posted by: JWC | October 8, 2008 3:58 PM

When I was a little kid and I told my parents I wanted to be a scientist, they always worried that I would end up playing with some glowing green goo. Now I'm a biochemist, and thanks to GFP their worries came true!

#45

Posted by: Rick T | October 8, 2008 4:17 PM

When can we see a GFC Jebus (green flourescent cracker Jebus)? That way we can transubstantiate the effect that cracker boy has on our souls. At least we would be able to see our poop glowing in the dark. How cool would that be?

#46

Posted by: Thinker | October 8, 2008 4:21 PM

First, a tame one:

From a spark to a flash to a glow
The best of ideas surely grow
Versatile and resilient,
This one is brilliant,
In fact, it's quite literally so!


More importantly: with GFP, who needs a plethysmograph ?

Fuse male hormones to GFP:
in old fundies who can't stand to see
any girls past their low teens;
green fluorescent proteins
show that, to his shame and our glee!


Of course, if the effect is more localized, it could lead to comments such as: "Is that a flashlight in your pocket, or are you just happy to see me?"

#47

Posted by: dNorrisM | October 8, 2008 4:28 PM

The only correct grouping is surely in 2's so that each group of 2 can be represented neatly and without overhead in a single hexadecimal digit...

Fixed it for you Emmett ;-)

(Actually I thought they were grouped by 8's until I counted them- Really we should group them by 3's and use 64 digits.)

#48

Posted by: Emmet Caulfield | October 8, 2008 5:34 PM

Thus spake dNorrisM:

The only correct grouping is surely in 2's so that each group of 2 can be represented neatly and without overhead in a single hexadecimal digit...

Yes, of course, dammit, I hate making mistakes like that. I was thinking of a byte and somehow "forgot" that it takes two nybbles. My (exceptionally lame and contrived) excuse is that since I started doing VMX/SSE recently, I now think wider than I used to ;o)

#49

Posted by: SoMG | October 8, 2008 5:37 PM

GFP is not the most impressive of Roger Tsien's discoveries/inventions. He also invented dyes which change color, or fluoresce, in the presence of calcium ions.

VERY important for studying many things, like muscle contraction, and sperm-egg fusion.

#50

Posted by: SoMG | October 8, 2008 5:39 PM

GFP is not the most impressive of Roger Tsien's discoveries/inventions. He also invented dyes which change color, or fluoresce, in the presence of calcium ions.

VERY important for studying many things, like muscle contraction, and sperm-egg fusion.

#51

Posted by: davem | October 8, 2008 5:43 PM

Nate: "that we try to create cats and dogs with some sort of GFP or derivative marker in their skin and sell glowing pets. "

Damned good idea. Put the stuff in cats so that the local birds can see them coming at night. Domestic cats are one of the main causes of bird population decline.

#52

Posted by: The Petey | October 8, 2008 5:59 PM

This made my geek hurt

#53

Posted by: Kraid | October 8, 2008 6:00 PM

Three cheers for GFP!

I'm a Cell and Molecular Biology grad student, and I use GFP fusion proteins almost daily for determining protein localization, FRAP, as well as something fairly simple yet very handy: in the worm C. elegans, you can use GFP as a coinjection marker to determine which worms are carrying whatever DNA construct you're trying to express.

Here's an image I made of two C. elegans embryos expressing GFP fused to a cell-cell junction protein. Both embryos are just completing epiboly (top one is a dorsal view, bottom one is ventral view).
http://i174.photobucket.com/albums/w101/fetalerror/Science/embryos.jpg

#54

Posted by: Brad D | October 8, 2008 6:02 PM

There was an article about this on my local paper's website (San Diego Union Tribune), the comments section is full of idiots decrying wasteful government spending, the cost and technical issues the LHC has had, and denying the big bang in favor of biblical literacy. I have to remind myself to:

1- Avoid looking at my local paper's website, it's not much better than Fox news.

2- If 1 fails, keep the comments blocked.

3- If 1 and 2 fail, avoid trying to chime in with a defense of science.

4- If 1, 2, and 3 fail, remember that although this is the home of UCSD, it is also the the home of ICR and you can't fix stupid.

#55

Posted by: Diego | October 8, 2008 6:07 PM

When I worked in a molecular genetics lab I got to cook up transgenic algae with GFP and mosquito hormone genes. Good days. Good days.

Hurray for GFP!

#56

Posted by: Diego | October 8, 2008 6:11 PM

When I worked in a molecular genetics lab I got to cook up transgenic algae with GFP and mosquito hormone genes. Good days. Good days.

Hurray for GFP!

#57

Posted by: Emmet Caulfield | October 8, 2008 6:12 PM

This made my geek hurt

Give it a massage.

#58

Posted by: Diego | October 8, 2008 6:12 PM

When I worked in a molecular genetics lab I got to cook up transgenic algae with GFP and mosquito hormone genes. Good days. Good days.

Hurray for GFP!

#59

Posted by: Cassidy | October 8, 2008 6:45 PM

We tag tons of stuff with GFP in my lab...one of the first things I learned how to do was amplify it to see if our cloned pigs were transgenic :)

Even my mother called me up today to make sure I heard the glowing green guys won!

#60

Posted by: James F | October 8, 2008 7:02 PM

Randall @42 wrote:

GFP is fine and all, but if you want to do really fun stuff you need its cousins, RFP, YFP, and CFP (the latter being cyan). And since GFP is too similar to both YFP and CFP, you can't actually use it for such experiments.

Tsien's lab has developed an entire "fruit salad" of colors. It's great: honeydew, orange, tomato, tangerine, strawberry, cherry, grape, raspberry, plum....

#61

Posted by: Spero Melior | October 8, 2008 7:21 PM

And one of the first things Chalfie did after winning? He endorsed Obama:

http://sefora.org/2008/10/08/2008-chemistry-nobelist-endorses-obama-bringing-the-number-to-63/

#62

Posted by: Silver Fox | October 8, 2008 7:44 PM

I'm not sure what it is that shimomura did. My wife, a biology teacher, says its quite incredible but she doesn't know how he attaches to the target protein. She understands the injection process but this is different.

#63

Posted by: Silver Fox | October 8, 2008 7:49 PM

I'm not sure what it is that shimomura did. My wife, a biology teacher, says its quite incredible but she doesn't know how he attaches to the target protein. She understands the injection process but this is different.

#64

Posted by: BioinfoTools | October 8, 2008 7:53 PM

@17 -

It is the amino acid sequence for the protein given in single-letter codes. You can translate it from the DNA sequence below. The triplet 'atg' codes for methionine, which is 'Met' in the three-letter code and 'M' in the single letter code. The triplet 'agt' codes for Serine = Ser = S. And so on...

#65

Posted by: minimalist | October 8, 2008 8:02 PM

SilverFox (#62):

It can be made like any other protein. What you do is, if you have a protein of interest that you want to localize, you find the sequence of the gene that codes for it.

Then, using various techniques, you splice in the DNA sequence coding for GFP, either at the beginning of the gene of interest, or at the end (before the stop codon, of course).

Depending on the organism and technique, you can either directly modify the chromosomal DNA, or introduce a plasmid (small circular loop of DNA) with your gene + the GFP sequence.

Then the organism does the rest: it makes the protein itself with the additional GFP "tag" at one end.

It's a beautifully elegant system, well deserving the prize.

#66

Posted by: Silver Fox | October 8, 2008 10:18 PM

I'm not sure what it is that shimomura did. My wife, a biology teacher, says its quite incredible but she doesn't know how he attaches to the target protein. She understands the injection process but this is different.

#67

Posted by: Epikt | October 8, 2008 10:41 PM

Myself:

Damn scientists. You can put a man on the moon but you can't give me a glowing green dragon permamently imprinted on my forearm.

I know of somebody who can arrange a nice cross-shaped burn for you.

#68

Posted by: Shawn | October 8, 2008 10:56 PM

I have been a proponet of widespread use of GFP in babies to make them easier to see during halloween when they grow older. Just insert it next to the gene for melanin! I want glowing children!

#69

Posted by: Jim1138 | October 9, 2008 12:36 AM

Shawn: You need to develop GPP or Green Phosphorescent Protein GFP requires a UV light for excitation. Or you can just insert an assortment of firefly genes...

#70

Posted by: JakeS | October 9, 2008 1:56 AM

So I'm watching CNN right now, and the news ticker announces that the prize for chemistry was given out to "one japanese and two americans for the discovery of the mysterious green glow jellyfish gene"

I'm so pissed. The important concept of the gene is it's application, not the fact that they unraveled a "mysterious" jellyfish gene. I'm so pissed that the media decided that they should leave this out on the one-sentence ticker. I don't know what I'm more upset about. That the news considers the nationality of the researchers more important than the research that was made possible by the discovery, or the fact that this feeds into the whole "scientists wasting time and money researching another useless thing likejellyfish" mentality that I hear from some of my luddite friends.

#72

Posted by: BioinfoTools | October 9, 2008 4:49 AM

@71: Instead of the blue man, we have the green man? :-)

#73

Posted by: clear as mud | October 9, 2008 6:57 AM

Back when I used it, I remember one of the best things about GFP was that fusing it to other proteins of interest often caused little disruption in the normal activity of the protein we wanted to observe. Sometimes it gummed it up, but far less often than other fusion options.

We assumed (no clue if it's confirmed) that it's very tight globular form helped make it relatively unobtrusive.

I forgot how big a deal that was - plus the ease of observation.

#74

Posted by: LisaJ | October 9, 2008 9:23 AM

Waita go GFP! A well deserved award, for sure. This little protein has definitely enriched my life in the lab, and has done alot of great things for science.

#75

Posted by: troll allergy | October 9, 2008 1:57 PM

Is it just me or is the (see new scientist article) GFP'ing of the disease inflicted monkeys cruel? I guess it's efficient but ick.

Who will be the first to GFP their kids? Maybe some celebrity will step up.

#76

Posted by: troll allergy | October 9, 2008 1:59 PM

Is it just me or is the (see new scientist article) GFP'ing of the disease inflicted monkeys cruel? I guess it's efficient but ick.

Who will be the first to GFP their kids? Maybe some celebrity will step up.

#77

Posted by: MikeyM | October 9, 2008 3:07 PM

http://www.npr.org/templates/story/story.php?storyId=95545761

The researcher who isolated this gene got bypassed:

Morning Edition, October 9, 2008 · The Nobel Prize in chemistry was awarded this week to three scientists working in the United States with a jellyfish protein that glows in the dark. But the scientist who found the gene for that protein, and gave it to the eventual Nobel winners, is no longer working in the field. He now drives a shuttle bus for an auto dealership.

(I don't think he's working at Kieffe and Sons Ford.)

#78

Posted by: MikeyM | October 9, 2008 3:12 PM

http://www.npr.org/templates/story/story.php?storyId=95545761

The researcher who isolated this gene got bypassed:

Morning Edition, October 9, 2008 · The Nobel Prize in chemistry was awarded this week to three scientists working in the United States with a jellyfish protein that glows in the dark. But the scientist who found the gene for that protein, and gave it to the eventual Nobel winners, is no longer working in the field. He now drives a shuttle bus for an auto dealership.

(I don't think he's working at Kieffe and Sons Ford.)

#79

Posted by: mandydax | October 9, 2008 6:25 PM

I'm laughing my ass off listening to my text-to-speech read the protein and genetic codes to me. XD

#80

Posted by: Bevans | October 9, 2008 8:10 PM

Is that the registration number for Spore?

#81

Posted by: Alex Dodge | October 10, 2008 1:32 PM

Yeah! UCSD!

#82

Posted by: Sky | October 11, 2008 7:02 PM

This was the most wonderful news that I got to hear.....right before i went to spend 10 hours at confocal looking at live macrophages with GFP and mCherry conjugated proteins (gotta love those red fruits) eat IgG coated beads.

But hey, best tool ever. Go GFP!

Post a Comment

(Email is required for authentication purposes only. Comments are moderated for spam, your comment may not appear immediately. Thanks for waiting.)





Having problems commenting? (UPDATED)

Blogs in the Network

Advertisement

Top Five: Most German