Now on ScienceBlogs: Rhodes Secretary: Wall Street Megabonuses Draining Our Young Talent

Seed Media Group

Collective Imagination

Pharyngula

Evolution, development, and random biological ejaculations from a godless liberal

Search

Profile

pzm_profile_pic.jpg
PZ Myers is a biologist and associate professor at the University of Minnesota, Morris.
zf_pharyngula.jpg …and this is a pharyngula stage embryo.
a longer profile of yours truly
my calendar
Nature Network
RichardDawkins Network
facebook
MySpace
Twitter
Atheist Nexus
the Pharyngula chat room
(#pharyngula on irc.synirc.net)

• Quick link to the latest endless thread




I reserve the right to publicly post, with full identifying information about the source, any email sent to me that contains threats of violence.

tbbadge.gif
scarlet_A.png
I support Americans United for Separation of Church and State.

Random Quote

No man is so foolish but he may sometimes give another good counsel, and no man so wise that he may not easily err if he takes no other counsel than his own. He that is taught only by himself has a fool for a master.

Hunter S. Thompson

Recent Posts


A Taste of Pharyngula

Recent Comments

Archives


Blogroll

Other Information

« I am Pro-Test | Main | Minnesota once again embarrassed by Michele Bachman »

Moral DNA?

Category: ReligionStupidity
Posted on: April 24, 2009 11:43 AM, by PZ Myers

Please, someone, tell the priests to go tend to their rituals and quit pretending to ha have any understanding of reality. A new archbishop has tried to use biology to argue for his archaic moral position, and I just want to slap him.

Archbishop Timothy Dolan yesterday said advocates of gay marriage "are asking for trouble," arguing that traditional, one-man/one-woman marriage is rooted in people's moral DNA.

"There's an in-built code of right and wrong that's embedded in the human DNA," Dolan told The Post in an exclusive, wide-ranging interview, a week after becoming the New York Archdiocese's new leader.

"Hard-wired into us is a dictionary, and the dictionary defines marriage as between one man, one woman for life, please God, leading to the procreation of human life.

Every word an ignorant lie. There is no genetic basis for a moral code except, perhaps, in the broadest sense of intrinsic rewards for social behavior — Catholicism is not biologically heritable. There is nothing in us that hardwires simplistic monogamy — human cultures have had a wide range of different patterns of sexual behavior. And gay people do not have desires in defiance of their biological impulses, but as consequences of them.

Ah, well, I'm sure Timmy Dolan will go far in the Catholic hierarchy — it doesn't reward intelligence or knowledge, and he's got neither.

Share this: Stumbleupon Reddit Email + More

TrackBacks

TrackBack URL for this entry: http://scienceblogs.com/mt/pings/107884

Comments

#1

Posted by: Kobra | April 24, 2009 11:53 AM

The ignorance just drips off the page there.

#2

Posted by: Blake Stacey | April 24, 2009 11:57 AM

Solomon was a mutant!

#3

Posted by: Louis | April 24, 2009 11:57 AM

Ahhh the naturalistic fallacy....wait....that's completed my entire Fundy Fuckwit Fallacy card....BINGO!!!! HOUSE!!!

What do I win?

Louis

#4

Posted by: PeterKarim | April 24, 2009 11:58 AM

Where are the Ken Millers of this world when such non-sense is spewed by a catlick professional ignoramus ?

#5

Posted by: Qwerty Author Profile Page | April 24, 2009 11:58 AM

Since I am gay, I wonder if the bishop would think I have immoral DNA. After all, my Baptist grandma was a boot-legging whore. (My mother was a Catholic convert.)

#6

Posted by: whitebird | April 24, 2009 11:59 AM

He must mean American DNA, not that mutated-within-an-inch-of-our-species Dutch DNA or whatever. He has a point, though - throughout history, humans have always inherently known what is right and what is wrong and it's the exact same for every culture on Earth since the beginning of time.

#7

Posted by: JD Author Profile Page | April 24, 2009 12:02 PM

That's why I love this ol' classic video: http://www.youtube.com/watch?v=qCzbNkyXO50

#8

Posted by: skyotter | April 24, 2009 12:03 PM

wait, is morality hard-wired into us, or is it revealed from gods? i'm so confused. he seems to be saying we could be moral without gods; or even worse that we *gasp* ARE moral, by our very nature, with or without gods

#9

Posted by: Abbie | April 24, 2009 12:05 PM

"Hard-wired into us is a dictionary, and the dictionary defines marriage as between one man, one woman

Quick, someone tell Noam Chomsky! Not only is syntax innate, but our lexicon too!

#10

Posted by: James Sweet | April 24, 2009 12:07 PM

@Whitebird #6: I was thinking the same thing, and it's a very subtle argument, I think... As a humanist, I believe that there is an objective component to morality (though clearly there are all kinds of subjective components as well, like this ridiculous anti-gay notion). It also follows that at least some of what determines objective morality is based on imperatives that are a result of our DNA. So one could *almost* say that morality is in our DNA, although I would think that is a rather unguarded and imprecise statement.

The key here is that the esteemed witch doctor said that a moral code was inherent in our DNA. This is not even just imprecise, it's rubbish. Even if we assume that morality stems largely from genetics, who said anything about a moral code? The codification of morality is strictly an invention of society (though probably most non-anarchists would view it as a good invention).

To make the leap from "morality is determined by our genetics" (an imprecise and speculative statement to begin with) to "a moral code is written in our genetics" is kind of like the leap from "We have dedicated portions of our brain to enable speech" to "We have dedicated portions of our brain to enable us to speak Swahili".

#11

Posted by: JD Author Profile Page | April 24, 2009 12:08 PM

Molesting little boys in church stalls is hard-wired in the priesthood. Did I say hard? Ewwww...

#12

Posted by: Morgan | April 24, 2009 12:08 PM

I haven't seen the metaphorical language of DNA so stretched to make a dodgy philosophical point since I last watched Neon Genesis Evangelion. Kind of appropriate it would come from a Catholic bishop.

I'm inclined, though, to think the good bishop was just abusing a metaphor to recast the old "everyone really knows God's will deep down, and offenses against it are conscious or unconscious rebellion, never honest disagreement" nonsense. He wasn't actually claiming that the DNA molecule encodes a set of moral precepts including references to same-sex marriage. ...I hope.

#13

Posted by: Silver | April 24, 2009 12:09 PM

So, if morality is hardwired into us, does that mean that buggering little boys is hardwired into the DNA of Catholic clergy? What about anti-semitism? Misogyny? General douchebagism?

I think so...

#14

Posted by: stephanie | April 24, 2009 12:10 PM

considering that people under 30 are far more likely to accept and are even willing to fight for gay marriage, according to mr bishop we must have had some massive mutation in our moral DNA in the last couple decades.

#15

Posted by: Voldemort13 Author Profile Page | April 24, 2009 12:11 PM

JD love the video.

#16

Posted by: Rev. BigDumbChimp | April 24, 2009 12:12 PM

My moral DNA is telling me that Archbishop Timothy Dolan is a fuckhead.

#17

Posted by: the pro from dover | April 24, 2009 12:12 PM

I love the smell of genetic determinism in the morning!

#18

Posted by: Holbach Author Profile Page | April 24, 2009 12:13 PM

Can we expect the religion infested mind to reason otherwise? The more they try to refute evolution and rational development, the more they entrench themselves as god drenched morons. If the animals were able to reason and not possess the nonsense as we do, they would regard us as evolutions's joke and religion as the pie in the face.

#19

Posted by: Chris Davis Author Profile Page | April 24, 2009 12:13 PM

It amazes me how many bigots try to claim that homosex is wrong because pooves don't reproduce. Gosh, yes - just look how the human population is dwindling!

The other side of that coin is that if homosexuality was indeed having any significant impact on its own genetics, it might well be selected against. But it isn't, and I like the hypothesis that the genes involved, when expressed in women, may result in superwomen with unusually high numbers of healthy offspring that offset any losses from their male counterparts. And they're good with colours too, presumably.

#20

Posted by: daveau Author Profile Page | April 24, 2009 12:14 PM

If ignorance is bliss, Archbishop Dolan must be very happy.

#21

Posted by: the pro from dover | April 24, 2009 12:15 PM

I love the smell of genetic determinism in the morning! On a more humerous note check the shouts and murmurs piece in this weeks New Yorker mgazine

#22

Posted by: Carpworld Author Profile Page | April 24, 2009 12:16 PM

Hmm, i just looked up "homophobic liar" in my hard-wired dictionary and it says "Archbishop Timothy Dolan"


#23

Posted by: Hank Fox | April 24, 2009 12:16 PM

I just wonder, what if you're born in the US, but your hardwired dictionary is in ancient Etruscan?

Suddenly I think I understand why my brother was so bad at spelling.

#24

Posted by: AF Comm Guy | April 24, 2009 12:18 PM

I maybe wrong on this but doesn't this smack of Lysenkoism? My knowledge of biology is mainly from high school so I apologize if I am way off the mark on that. Anyone care to comment? If it does go along the same lines as with Lysenkoist biology then I find it highly ironic that a catholic witch doctor (ie archbishop) would put forth an idea from one of the U.S.S.R.'s most hardline communistic eras.

#25

Posted by: Voldemort13 Author Profile Page | April 24, 2009 12:18 PM

I personal would not want scientists to find a gay gene because If that happened I would not be surprised if the christian fundamentalists will start pushing for programs to eradicate homosexuality.

#26

Posted by: Richard Dawkins Author Profile Page | April 24, 2009 12:19 PM

Not that it has any moral significance (any more than the bishop's fatuous pronouncement does), a significant majority of human cultures is polygynous, and only a minority is monogamous (and a very small minority indeed is polyandrous).

#27

Posted by: Equisetum | April 24, 2009 12:20 PM

Dolan yesterday firmly defended traditional Catholic values, even while arguing that "we can't allow ourselves to give ammo to our enemies who want to picture us as just this stern, mean, naysaying church."

You can't help but give us ammo, because you are this stern, mean, naysaying, and might I add, ignorant, church. And you're just not that good at lying.
And, to echo a few other comments, if morality is hard-wired in our DNA, then what the fuck kind of mutagens are in that sacramental wine you guys drink?!

#28

Posted by: James Sweet | April 24, 2009 12:21 PM

Of course, one can trump the whole thing by asking, "Who cares what our genes tell us to do?" If it were proved that our DNA gave us a 'neophobic instinct' that caused us to have an innate fear of people who looked different from most other people we had previously come in contact with (which I suspect may be the case, but it is certainly not proven), would that make it okay to be racist, as long as you didn't spend much time around the people you were prejudiced against? Dolan might as well continue on saying: "Well, my genes tell me I should be afraid of that which is unusual, and there are not a lot of eskimos living in my town... so therefore I must be fearful of the evil eskimos, and if I don't then I will be 'asking for trouble'!"

#29

Posted by: Carpworld Author Profile Page | April 24, 2009 12:21 PM

Also, i just checked and my hard-wired dictionary doesn't have the word "sausage" - what does that mean?

#30

Posted by: Holbach Author Profile Page | April 24, 2009 12:22 PM

the pro from dover @ 21

Yes, good stuff there.

#31

Posted by: Morgan | April 24, 2009 12:23 PM

@26:
But of course, all those people were sinners rebelling against what they knew in their hearts was God's will. What does it matter if they constitute a majority of all humans who have ever lived, if you're starting with the idea that humans are fallen and wretched anyway?

#32

Posted by: Robotczar | April 24, 2009 12:25 PM

If a god placed genes for moral behavior in our DNA, then we don't need books, priests or even a god to tell us what is moral.

#33

Posted by: lose_the_woo Author Profile Page | April 24, 2009 12:26 PM

Hard-wired into us is a dictionary...

That's right up there with "The Internet is a series of tubes...".

#34

Posted by: Jason A. Author Profile Page | April 24, 2009 12:26 PM

Hard-wired into us is a dictionary, and the dictionary defines marriage as between one man, one woman for life, please God, leading to the procreation of human life.

Obviously the good archbishop is just as vehemently opposed to heterosexual marriages in which one of the partners is sterile, because if he wasn't, that would make him a hypocritical piece of shit.

#35

Posted by: John Kusters | April 24, 2009 12:32 PM

I read comments like those of the priest, and I begin to think that there are some people who don't understand that science has moved well beyond the philosophical approach it had hundreds of years ago, back when science consisted of competing philosophies instead of the scientific method. Inventing a concept like "moral DNA" fits right into that school of "rational inquiry" that was popular in Victorian parlour rooms and debating halls, back when science was genteel. Then I begin to wonder how many of those people we call crackpots are also still stuck in that model. Perhaps understanding that will help us understand how to cope with them. Just food for thought.

#36

Posted by: azqaz | April 24, 2009 12:32 PM

@daveau

I think in his case it is, "If ignorance is bliss, he must be orgasmic."

#37

Posted by: Louis | April 24, 2009 12:33 PM

@Richard Dawkins #26:

Polygynous you say? Excuse me a moment...

{Sound of scampering feet}

{Sound of hasty explanation of data to wife}

{Sound of wife explaining naturalistic fallacy with a frying pan}

She said no. This polyandry lark, however, seemed of interest. I'm off to make dinner and generally do as I'm told.

I'm struggling to take the bishop and his ilk seriously. If only they weren't, well, everywhere. I know, perhaps someone should say something about this...

Louis

#38

Posted by: Defender | April 24, 2009 12:36 PM

So, by extension, my desires to go out drinking, gambling and whoring are also embedded in the DNA, so archbishops have no right to judge me. Cool! Thanks!

#39

Posted by: Rev. BigDumbChimp | April 24, 2009 12:37 PM

So, by extension, my desires to go out drinking, gambling and whoring are also embedded in the DNA, so archbishops have no right to judge me. Cool! Thanks!

No those are encoded on the dark black matter that is taking up the space where your soul should be.

#40

Posted by: llewelly | April 24, 2009 12:40 PM

Carpworld April 24, 2009 12:21 PM:


Also, i just checked and my hard-wired dictionary doesn't have the word "sausage" - what does that mean?

Check your hard-wired dictionary for the word 'bum burner'. If you find it, you probably have Australian ancestors.

#41

Posted by: James Sweet | April 24, 2009 12:40 PM

@38: No no no, the problem with whoring is that, you see, there is no genetic basis for the concept of currency. Since scientists have recently discovered chimps trading sex for food, there MAY be a genetic basis for you giving the prostitutes a hamburger for payment or something, but even this is uncertain... no no no, play it safe, and just rape them, like in the good old days. Then you are covered either way!

#42

Posted by: lose_the_woo Author Profile Page | April 24, 2009 12:45 PM

...there MAY be a genetic basis for you giving the prostitutes a hamburger ...

You can has cheesburgur?

#43

Posted by: Ranson Author Profile Page | April 24, 2009 12:52 PM

On that note, Alex, has anyone else seen today's Wondermark (guest written/drawn by Randall Munroe)?

#44

Posted by: Chris mankey | April 24, 2009 12:55 PM

"Catholicism is not biologically heritable."

Perhaps it is!

http://www.youtube.com/watch?v=qCzbNkyXO50

#45

Posted by: James Sweet | April 24, 2009 12:55 PM

@Alex #42: I dunno, aren't cheeseburgers uncomfortably close to that whole "boiling a baby goat in its mothers milk" thing? The Bible is a little vague on this point, but I still think the point remains: When Good Christians trade food for sex, they NEVER mix meat with dairy!(TM)

#46

Posted by: Rev. BigDumbChimp | April 24, 2009 12:56 PM

I dunno, aren't cheeseburgers uncomfortably close to that whole "boiling a baby goat in its mothers milk" thing?

When's dinner?

#47

Posted by: Geoff | April 24, 2009 12:57 PM

Not even the most idiotic statement on this subject from a Catholic prelate.

In Spain, a certain percentage of social welfare funding goes to various churches based on how many members they have. A movement has grown up where many ex-Catholics are renouncing their membership in the church and demanding that these funds go to secular organizations. The response of the Cardinal Archbishop of Madrid- "That is impossible-baptism alters permanently your DNA and you are a Catholic forever".

#48

Posted by: Johan Stuyts | April 24, 2009 12:58 PM

Here are a few examples of this hardwiring of wrong and right:
- tying a stone around someone's ankle and throwing her in a lake to determine if she is a witch
- a sheik abusing and torturing a farmer because they suspected him from withholding grain
- waterboarding prisoners to obtain reliable information
- a guy skinning living, conscious animals
- punishing women because they spoke with a men
- not allowing interracial marriages

It's all in our DNA! But I guess that in the cases above the excuse is that it was the work of the devil.

I am pretty sure the people who treated humans and animals in a way that is immoral to most of us today, thought they were 100 % right and did not have any feelings of guilt at all. If you look at our history you will find that you can give people any sense of wrong and right.

In this case the right thing to do is to allow any two consenting adults to get married to each other.

#49

Posted by: daveau Author Profile Page | April 24, 2009 1:00 PM

Ranson @ 43

Wouldn't that be friggin' awesome (thx Carl) to have Ceiling Cat in the Sistine Chapel? Hilarious!

#50

Posted by: Eric | April 24, 2009 1:06 PM

My furry feline friends are a bit offended by the continued association of cats with catholicism (e.g., "catlick"). They assure you that the only thing they believe in is their next meal, a clean catbox and an occasional "nip."

Thank you,

:)

#51

Posted by: smanda | April 24, 2009 1:06 PM

A moral dictionary with only A,T,G and Cs would mostly be about actor cats that play tag.

#52

Posted by: Jeff D | April 24, 2009 1:06 PM

If the likes of Fr. Dolan were to get their wish and to have a federal constitutional amendment or a blanket of state constitutional provisions that would limit marriage to "one man and one woman," what would happen to the thousands of individuals in each U. S. state who have intersex conditions -- who are genetically a mixture of male and female or who have significantly ambiguous genetalia? If an intersex adult who appeared mostly "male" wanted to marry another intersex adult who appeared mostly or somewhat "female," would that be permitted? What about another intersex couple where both members are genetically female but where one outwardly appears more male?

#53

Posted by: Qwerty Author Profile Page | April 24, 2009 1:10 PM

Apparently there is faulty wiring for this moral code as the bishop came down against abortion. The code doesn't seem to keep Catholics (and others) from having abortions. And you can't have Obama speak at Notre Dame cause he's proabortion and his moral DNA has been corrupted by liberal politics!

#54

Posted by: RichVR | April 24, 2009 1:15 PM

I live in NYC and have been following (on the news, not stalking him) this glad handing moron. He's Egan's replacement and is supposed to make the RC church more accessible to the "average" Catholic.

He's making the rounds and is always portrayed as a smiling friendly aw-shucks type of guy.

Just another pedophile apologist in a black dress as far as I can see.

#55

Posted by: SourBlaze | April 24, 2009 1:15 PM

I wonder how that "moral DNA" worked to stop ancient cultures (the Hebrews included) from engaging in polygamy and cousin marriage.

I wonder how that "moral DNA" never got around to telling humanity that slavery was wrong until about 150 years ago.

I wonder how that "moral DNA" told Pope Benedict that condom use spreads AIDS.

I wonder how that "moral DNA" didn't stop those Catholic preists from harming children, and in fact also didn't stop the hierarchy from transferring them around (known as "passing the trash").

Wait! I know! Moral DNA doesn't exist! Morality has to be taught! And it is simple: Don't cause others harm!

#56

Posted by: SourBlaze | April 24, 2009 1:17 PM

I wonder how that "moral DNA" worked to stop ancient cultures (the Hebrews included) from engaging in polygamy and cousin marriage.

I wonder how that "moral DNA" never got around to telling humanity that slavery was wrong until about 150 years ago.

I wonder how that "moral DNA" told Pope Benedict that condom use spreads AIDS.

I wonder how that "moral DNA" didn't stop those Catholic preists from harming children, and in fact also didn't stop the hierarchy from transferring them around (known as "passing the trash").

Wait! I know! Moral DNA doesn't exist! Morality has to be taught! And it is simple: Don't cause others harm!

#57

Posted by: cicely Author Profile Page | April 24, 2009 1:19 PM

I wonder, at what point was this bug-fix retrofitted into human DNA? Obviously, it has to have been some time after the Old Testament patriarchs, since "one man and one woman" does not appear to have been worthy of condemnation.

As bug-fixes go, this one would appear to be Fail.

#58

Posted by: cicely Author Profile Page | April 24, 2009 1:22 PM

*sigh*

And that's what happens when two choices of phrasing train-wreck between brain and fingers. That should read, "violating the 'one man and one woman' rule does not appear to have been worthy of condemnation.

#59

Posted by: Rob J | April 24, 2009 1:25 PM

"There's an in-built code of right and wrong that's embedded in the human DNA,"

Wait a second, I was under the impression that our morals came from faith in god, does this mean atheists can be moral after all?

#60

Posted by: Matt Heath | April 24, 2009 1:31 PM

Wait a second, I was under the impression that our morals came from faith in god, does this mean atheists can be moral after all?
Strictly speaking, Catholics aren't meant to do the "non-believers can't have morals schtick anyway". They have a doctrine of "natural good". They are meant to think that all the natural good in the world won't get you into heaven though.
#61

Posted by: Dr. Matt | April 24, 2009 1:32 PM

Ahhh the naturalistic fallacy...

More like he's trying for the naturalistic fallacy, but failing to get there owing to a lack of understanding of nature.

#62

Posted by: Matt Heath | April 24, 2009 1:34 PM

@60. I fail quotation marks forever

...are meant to do the "non-believers can't have morals" schtick anyway.

#63

Posted by: dNorrisM | April 24, 2009 1:36 PM

A commenter at the NYP said:

"Its Homophiles who seek out the Church so they can have sex with little boys. The Homophiles are the problem- they have besmirched the Church....."

facepalm

#64

Posted by: Hank Fox | April 24, 2009 1:39 PM

We're all meat robots programmed by Jesus!

(And why does the phrase "hard-wired" make me imagine a porn film starring a Steve Wozniak lookalike?)

#65

Posted by: cicely Author Profile Page | April 24, 2009 1:40 PM

No. wait! If God is the only source of morality, and God encodes your moral code on your DNA, and your behavior reflects the imperatives coded on your DNA, then each of our moral choices is moral, for a given value of "moral". Axe murder, baby raping, whatever. If you want to do it, then that's what God wants you to do! Score!

Well, using arguments neither more or less specious than some I've heard from theists, rationalizing this or that Edict From On High.

#66

Posted by: Matt Heath | April 24, 2009 1:40 PM

OT, Why are some but not all of the scienceblogs.co.br blogs listed in the "Blogs in the network" list here. It's weird.

#67

Posted by: Abdul Alhazred Author Profile Page | April 24, 2009 1:45 PM

What's especially interesting about this story: The concept of "moral DNA" is much more stupid and trivial than the official doctrine of his church.

"Original sin" may be false and evil, but it does have a level of moral seriousness above cheap talking points.

#68

Posted by: Alexis Author Profile Page | April 24, 2009 1:52 PM

Hard wired for one man, one woman for life: Abraham married to half sister Sarah, buggered her slave Hagar, cast Hagar and son to the wind.
Hard wired for one man, one woman for life: Lot - offers two daughters to be raped and abused in lieu of male visitors. Daughters are so greatful to be in such a wonderful family, each bear sons to besotted daddy. The family that plays together stays together.
Hard wired for one man, one woman for life: Jacob married cousin Leah and cousin Rachel and buggers their slaves Bilhah and Zilpah.
Hard wired for one man, one woman for life: David - I lost count. I don't have that many fingers.
Hard wired for one man, one woman for life: Solomon - Oh my gosh, I don't have that many fingers and toes and neither does Jacobs whole family...

#69

Posted by: Rev. BigDumbChimp | April 24, 2009 1:54 PM

(And why does the phrase "hard-wired" make me imagine a porn film starring a Steve Wozniak lookalike?)

Because you are a sick sick man

#70

Posted by: Ahnald Brownshwagga the Monkey Author Profile Page | April 24, 2009 1:56 PM

Moral DNA, lmao. This clown knows nothing of morals or DNA. But because he is a virgin, calls himself "priest", and wears a black robe and slippers we get to read to his nonsense in print.

#71

Posted by: Abdul Alhazred Author Profile Page | April 24, 2009 1:58 PM

How do you know he's a virgin? :)

#72

Posted by: whitebird | April 24, 2009 1:58 PM

@James Sweet, #10...D'oh, if only I could post comments in comic sans...I guess I've been sarcasto-blocked by the internets? Yeah, for the most part, people don't kill within their clan, but as far as I've seen, ides about morality range from "it's ok to marry as many girl children as you can" (FLDS) to "it's not OK to even procreate" (Oneida weirdos, extinct). And that's just in the last 200 years in the Anglo USandA.

Hello, honor killing? Selling your children? Fatal exorcisms? That stuff even happens today.

#73

Posted by: DaveB | April 24, 2009 1:59 PM

There's an in-built code of right and wrong that's embedded in the human DNA

So morality doesn't come from the bible then? Good to hear the church taking a stance on that.

#74

Posted by: Donnie B. | April 24, 2009 2:02 PM

Archbishop Dolan is exactly correct. I checked for myself, and it seems that "ACCTGTACGTTGAACATGGT" translates to "Boys mustn't do the nasty with other boys", and "GAAACACATTACATGACCATTC" means "Girl-on-girl is incredibly hot, er, I mean, uh, also really really wrong."

#75

Posted by: Thomas R. Holtz, Jr. Author Profile Page | April 24, 2009 2:04 PM

Wow. Just think of the implications:

Are there transposons, duplcations, and/or deletions of moral DNA?

How far out down the tree does the moral DNA extend? Are these sequences found in chimps? Mice? Actinopts? Demosponges?

Might there be horizontal transfer of moral DNA, and if so has this morality popped over to our pets, livestock, food crops, or parasites?

Whole new fields of "moralnomics" are now possible! Think of the research grants!!

Also, Carpworld @#29: that's what you get when you use good old Dr. Samuel Johnson's dictionary.

#76

Posted by: eric | April 24, 2009 2:05 PM

Cicely:

No. wait! If God is the only source of morality, and God encodes your moral code on your DNA, and your behavior reflects the imperatives coded on your DNA, then each of our moral choices is moral, for a given value of "moral".

No, you've got it all wrong. God encoded morality in your DNA, then gave you a set of rules that conflicts with your DNA, then he punishes you forever for not following both at the same time. Because he's both good and merciful. See how it works?

#77

Posted by: tom | April 24, 2009 2:09 PM

I am overwhelmed with a sense of relief every time one of these nitwits opens their mouth that I went over the wall almost 50 years ago and haven't looked back.

#78

Posted by: Rev. BigDumbChimp | April 24, 2009 2:10 PM

Because he's both good and merciful. See how it works?

And loving. You forgot loving.

#79

Posted by: ArchangelChuck | April 24, 2009 2:16 PM

If morality is coded in our DNA, who the hell needs religion?

#80

Posted by: Screechy Monkey | April 24, 2009 2:16 PM

Hey Archbishop, aren't you supposed to stay in your own magisterium?

#81

Posted by: Not that Louis | April 24, 2009 2:20 PM

Excuse me, PZ, but shouldn't part of that been in Comic Sans?

#82

Posted by: abb3w | April 24, 2009 2:21 PM

The "for life" makes for a nice touch; what is it, 40% of US (first) marriages that end in divorce?

#83

Posted by: Brian Smith | April 24, 2009 2:21 PM

"Hard-wired into us is a dictionary, and the dictionary defines marriage as between one man, one woman for life, please God, leading to the procreation of human life.

Did this dictionary get updated at some point? The Bible is pretty clear that marriage was one man, many woman for quite a long period of time, and says God was pleased with many of the men who lived in that arrangement.

Also, since marriage is defined as being "for life", I'm sure all the people currently protesting gay marriage spend just as much time crusading to outlaw divorce.

#84

Posted by: Matt Heath | April 24, 2009 2:23 PM

How do you know he's a virgin? :)
Actually IIRC there's a reasonable chance he isn't. I think there was a survey of new priests a while back and a large proportion freely admitted that they had had sex before taking their vows (which I guess counts as a sin, but less so than breaking the vow or whatever).

#85

Posted by: Ariel | April 24, 2009 2:25 PM

The assumption that homosexuality is somehow "unnatural" because it doesn't lead directly to procreation just shows that he has no understanding of natural selection at all.

Kin selection totally resolves this issue. If we have to look at homosexuality in terms of evolution, (which I find faintly insulting for some reason), inclusive fitness can explain it. Inclusive fitness is the individuals fitness, plus the fitness of their relatives in proportion to how related they are. It's one of the ways we explain altruism, because helping your kin is phenotypically altruistic, yet genotypically selfish.

The hypothesis is that gay men may help their relatives care for their offspring because they will have more resources available with no offspring of their own. Whether this arguement is actually true doesn't really matter, it just helps to shut up the homophobes who try to say how it is unnatural, and use a faulty understanding of evolution, genes, etc. as a weapon for their homophobia.

#86

Posted by: ffrancis | April 24, 2009 2:26 PM

If we've got dictionaries hard-wired into us, shouldn't somebody let the OED folks know? Lotta wasted effort there...

#87

Posted by: blueelm | April 24, 2009 2:34 PM

I think my hard-wired dictionary must have a genetic abnormality. My spelling is awful.

#88

Posted by: Tim H | April 24, 2009 2:40 PM

So, if morality is hardwired into us, does that mean that buggering little boys is hardwired into the DNA of Catholic clergy? What about anti-semitism? Misogyny? General douchebagism?

I protest. Douchebagism can't possibly be a word. Wouldn't the proper term be douchebaggery?

#89

Posted by: Your Name's Not Bruce? Author Profile Page | April 24, 2009 2:42 PM

So these are the fruits...er...um I mean RESULTS of the Catholic Genome Project? So what's next, the Papal Infallibility gene?

#90

Posted by: Matt Heath | April 24, 2009 2:42 PM

No ones going to come and defend this idiocy, are they? Pity; could have been fun

#91

Posted by: Defender | April 24, 2009 2:46 PM

No those are encoded on the dark black matter that is taking up the space where your soul should be.

Wow! You didn't honestly take that seriously, did you? Holy crap!

#92

Posted by: Hank Fox | April 24, 2009 2:53 PM

Do evangelical Christian biologists abbreviate moral DNA as mDNA?

And why do Republicans like Dick Cheney have faulty mDNA? I'm thinking there must be good-evil alleles, and Cheney carries two copies of the evil gene.

Some of us are GG, most of us are Ge, but then there are those like Cheney who are solid ee.

And now I'm wondering if there's such a thing as e-dar, so they can recognize each other on sight? It might account for the moral makeup of the Republican Party.

#93

Posted by: TheNaturalist | April 24, 2009 2:55 PM

#6: "There are two kinds of people I hate: those who are intolerance of other cultures and the Dutch."

#94

Posted by: Onotheo | April 24, 2009 2:57 PM

The archbishop is merely stating his position on evolution, in that he agrees evolution is correct. What used to be a one-man/many-woman genetic code has evolved into a one-man/one-woman code.

The question is, how was he able to discover this gene?

:D

#95

Posted by: dinkum Author Profile Page | April 24, 2009 3:06 PM

Douchebaggism is the philosophy.
Douchbaggery is the expression thereof.

#96

Posted by: dNorrisM | April 24, 2009 3:07 PM

"Do evangelical Christian biologists abbreviate moral DNA as mDNA? "

Sure enough.

#97

Posted by: Woody | April 24, 2009 3:07 PM

Ah, well, I'm sure Timmy Dolan will go far in the Catholic hierarchy — it doesn't reward intelligence or knowledge, and he's got neither.

As an Arch-bishop, he's gone about as far as he can go. If he's really a flying-monkey/wackloon/fascist, he might get appointed Cardinal, but he'd have to have sone REAL leverage: fotos of Ratzi, the Nazi, in flagrante, f'rinstance...

#98

Posted by: dNorrisM | April 24, 2009 3:11 PM

I meant to include the money quote:

More logically, the points that show proteomics overlapping between different forms of life are more likely to be interpreted as a reflection of a single common fingerprint initiated by a mighty creator than relying on a single cell that is, in a doubtful way, surprisingly originating all other kinds of life.
#99

Posted by: Angel | April 24, 2009 3:13 PM

Just when I think I have seen how low and ignorant the Catholic Church (or Christians in general for that matter) can go, I have you to thank, PZ (can I use first name?) for pointing out yet another lower level in their depravity. If nothing else, it makes me glad I left religion behind (raised Catholic, Catholic school survivor, so to speak). The more I learn, the more I ask, "how can people follow these repressed ignorant clowns around?"

So we have a dictionary hardwired into us? Funny, I still have to use one every so often to check word spellings and such. How do they (the religious powers that be) get off thinking if you don't follow their religion, you have to be immoral. All we have to do is point at plenty of decent people who are not religious, and then point back at them for all their sick acts (to put it mildly).

Best, and keep on blogging.

#100

Posted by: kamaka | April 24, 2009 3:13 PM

Gotta love the cardinals...real flamers in those red dresses...

#101

Posted by: Anonymous | April 24, 2009 3:33 PM

@Ariel #85: Some evolutionary biologists completely reject this kin selection hypothesis. Dawkins, in fact, is pretty down on the notion of group selection, if I recall.

I only point this out because it re-emphasizes the difference between science and religion: When there is insufficient information to draw a definitive conclusion, scientists can have widely differing theories and still have a healthy, lively debate. We don't have Kin Selectionists running around with bombs strapped to their chests and detonating themselves in Selfish Genist marketplaces.

(Although, I think I did once see a vi user try to crash a plane into a building full of emacs users, but that's not really science either...)

#102

Posted by: Chris | April 24, 2009 3:36 PM

I think you have to be intentionally obtuse to make such a criticism of the archbishop's reference to DNA. He was obviously alluding to something like the "ius naturale". He wasn't making a biological argument; he was using a biological metaphor.

#103

Posted by: Richard S. Lentini Author Profile Page | April 24, 2009 3:37 PM

Of course, Dolan's comments are pure nonsense! But I am a Biologist and I believe there is a "slight" genetic basis (i.e., propensity) for liberalism vs. conservatism. This would be hard to prove because cultural, environmental, and educational factors can override the minor genetic effects. And, as usual, several genes would be involved and they would likely be connected to overall intelligence, or the way one thinks. The reason I believe this is because Democrats and Republicans, in lockstep, seem to think so differently!! That is, their worldview is so different. And people usually don't switch sides throughout life.

Does anyone agree this might be the case??? Or is my thinking just as crazy as Dolan's???

#104

Posted by: Alyson Miers | April 24, 2009 3:46 PM

Papal Infallibility Gene: take the acronym and you've pretty much summed up Mother Church's moral capacities.

Now, Archbishop Dolan, what part of our "moral DNA" says it's a good idea to tell large numbers of people to swear off sex entirely and then give them the power to tell the rest of the populace what to do with their erogenous parts?

The nonsense, it burns.

#105

Posted by: geneticdictionary | April 24, 2009 3:47 PM

Some dictionaries have better editors than others.

#106

Posted by: Red Skeleton | April 24, 2009 3:57 PM

I have a dictionary hardwired into me but I usually just use it to look up dirty words.

My DNA also makes me a short white guy, I'm just afraid God will one day declare both of those things immoral.

#107

Posted by: C Nelson | April 24, 2009 3:58 PM

He's not so wrong, is he? Our senses of right and wrong and all that are, to some extent, a function of our genetics, aren't they? -- According to the social Darwinism view, anyway (our behaviors – our thoughts - are evolved, dictated by our DNA).

Of course the way he said it was twisted and too literal. And homosexuality is natural, too, so one could counter that it is also “hard wired” into some of us. I know, people like him and the sentiments he’s trying to convey are idiotic, but I think it is interesting that he’s acknowledging, at least, that we are run by our DNA.

#108

Posted by: Steve_C | April 24, 2009 3:58 PM

Funny... who you are attracted to is gender wise is almost entirely biological... so the Cardinal was just being a douche with his "metaphor"?

That's what I thought too... the Cardinal was being a douche.

#109

Posted by: Ariel | April 24, 2009 4:03 PM

@ 101, Kin selection is in no way group selection. It was actually part of the sociobiology movement largely spearheaded by Dawkins "The Selfish Gene," which actually explains how altruism can evolve if it is genotypically selfish.

Many species can only be understood through inclusive fitness. For example, social insects such as ants and bees where only a very small proportion of the population reproduces, but since the workers share more DNA with their sisters then their potential offspring (males are haploid, so workers share 75 % of their genes with their sisters), they are more 'fit' if they support the colony then if they had their own offspring.

#110

Posted by: DonRocko | April 24, 2009 4:05 PM

I think this is yet another example of religion trying to claim sovereignty over all morals. I think it would be a hell of a thing to prove morality is genetic, especially from an evolutionary perspective. It would gut religious doctrines.

Really, that's all religion has left to hold on to - a set of memetic morals that scientists have yet to comprehensibly explain from a biological perspective. If scientists could, it would be a major boon to secularism.

#111

Posted by: Ariel | April 24, 2009 4:05 PM

Sorry I do not know how to link stuff, but if you google 'Kin Selection' a Dawkins article comes up which explains how it is often misunderstood as group selection. It's called "Twelve Misunderstandings of Kin Selection"

#112

Posted by: Glen Davidson Author Profile Page | April 24, 2009 4:06 PM

I know that my DNA is very well behaved, and thus presumably moral.

Just thought you should know.

Glen D
http://tinyurl.com/6mb592

#113

Posted by: Alli | April 24, 2009 4:08 PM

Richard, I'm curious about your theory about a genetic basis for liberalism vs. conservatism. I grew up in a pretty conservative, religious family. As far as I know, my parents, grandparents, and aunts and uncles are all creationists and conservative, rightwing Republicans. My mom in particular listens to Rush Limbaugh, watches Fox News, subscribes to Focus On the Family publications, and hates President Obama. (Although she has not actually voiced it yet, I am certain she thinks Obama is the Anti-Christ.)

Now, me, on the other hand - the apple didn't just fall far from the tree, I think I'm something else entirely - maybe a lemon, in their view. I grew up attending church and Christian schools and until the beginning of my sophomore year of college, I espoused very conservative viewpoints myself - for example, I was opposed to ALL abortions, for ANY reason.

Around age 19, though, it just fell apart for me. I started realizing that on at least two issues - feminism and gay rights - I could not reconcile what I truly felt to be true with what the church taught, and it was just a brief slide from there to agnosticism and very quickly, outright atheism. Now I'm about as leftwing as they come in my political views, and, again, am really the ONLY one in my family. I have wondered endlessly why this is - generational differences? My upbringing wasn't different from anyone elses, and I certainly had lots of Christian influence. Why was I ultimately the only one who turned?

#114

Posted by: October Mermaid | April 24, 2009 4:08 PM

Someone mentioned Original Sin earlier. That's what I was wondering, too. If we have morality hardwired into our DNA, doesn't that kind of contradict the whole original sin thing? They're so intent on keeping marriages straight, you'd think they'd be able to keep their fantasies straight, too.

#115

Posted by: Parse Author Profile Page | April 24, 2009 4:19 PM

Hank:
"Some of us are GG, most of us are Ge, but then there are those like Cheney who are solid ee."

I think a more likely explanation is that Cheney's got the equivalent of Klinefelter Syndrome, and he managed to have a solid eee.

#116

Posted by: Becky | April 24, 2009 4:20 PM

And then the bishop went back to diddling little boys.
I don't think these people cab take the heterosexual moral position when they spent decades covering up for the diddling of little boys. I'm wondering what part of DNA is moral.
I know it's the DNA that tells you its perfectly OK to molest little kids!

#117

Posted by: clausentum Author Profile Page | April 24, 2009 4:23 PM

There's some agonising gone on before writing and posting this, because on this blog it's liable to bring the world crashing down on my head...but, truth must out, and here it is:
the bishop, whether he is one of the great luminaries of the age or not, at least has a better understanding of one of the most basic facts of biology than PZ, namely that M+ M != M + F. If you have doubts about this, you could reflect on the further basic fact that M + F => children , M + M !=> children. These inescapable facts have led to the situation that in every society at every time marriage was something which takes place between a man and a woman, and the concept of man marrying man was ludicrous. I recognise that the criminalisation of gays in the past was wrong, but when it comes to destroying the institution of marriage and the demand that society be made in their image, surely society has a right to say, sorry, we can't change biology, institutions evolved, for good reasons, to fit the norm, and it's probably dangerous to change them to accommodate something for which they were never intended?

I know on this blog political correctness takes precedence over the plain unvarnished truth - and it's really frightening how unreflected the reactions are. If you want an immediate example of what it can lead to, look at the preceding thread: truth= the use of animals in scientific and medical research is unavoidable; political correctness=stop it. You've all contributed.

#118

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 4:29 PM

Clausentum, you haven't demonstrated how gay marriage will cause the marriage of the Redhead and me (30+ years) to be any less than it is at the moment. Using your logic, no marriage can occur if procreation won't result. I call that idiocy.

#119

Posted by: A=A | April 24, 2009 4:30 PM

namely that M + M != M + F.

Could we use F + F instead? KTHX!

M + M !=> children

However, F + F + Turkey Baster = children. So there.

it's really frightening how unreflected the reactions are.

Er... we could set up some mirrors or something.

#120

Posted by: Numad | April 24, 2009 4:31 PM

"If you have doubts about this, you could reflect on the further basic fact that M + F => children , M + M !=> children. These inescapable facts have led to the situation that in every society at every time marriage was something which takes place between a man and a woman, and the concept of man marrying man was ludicrous."

Reflect on the "inescapable facts" that only fertile F + fertile M => children and that heterosexual marriage including an infertile partner !=> "the destruction of marriage."

After this reflection, kindly and Politically Incorrectly if you wish shut the fuck up.

#121

Posted by: Hank Author Profile Page | April 24, 2009 4:37 PM

Qwerty #5 says:

"After all, my Baptist grandma was a boot-legging whore. (My mother was a Catholic convert.)"

Please, Qwerty, when you meet new folks or start a new relationship, don't tell them about--your Catholic mother!

#122

Posted by: Charmed Quark | April 24, 2009 4:38 PM

And people usually don't switch sides throughout life.

Stick to biology, Richard. Or meet more people. Just about everyone I have known has altered their views over time, many times quite dramatically. You also need to abandon the concepts of "sides". Not everyone is as ideologically pathological as you see on blogs and their comment sections. There's a complicated gradient between all the extremist POVs where most folks live at any given time in their lives.

#123

Posted by: Numad | April 24, 2009 4:38 PM

"[Only] fertile F + fertile M => children[...]"

Following Clausentum's own narrow terms, and thus excluding any sort of outside factor, of course.

#124

Posted by: Tulse Author Profile Page | April 24, 2009 4:40 PM

These inescapable facts have led to the situation that in every society at every time marriage was something which takes place between a man and a woman

Actually, in the Bible and many other societies it was often between a man and several women, and the man often had concubines as well. I presume you will join me in fighting against the unnatural laws of monogamy in the US, and return it to the historical and biologically natural definition of marriage.

#125

Posted by: bluescat48 Author Profile Page | April 24, 2009 4:41 PM

What kind of wine has this archbishop been drinking? It seems to have warped his mind.

#126

Posted by: SocraticGadfly | April 24, 2009 4:41 PM

So, is celibacy also hardwired into DNA? What a doofus.

#127

Posted by: CJO | April 24, 2009 4:41 PM

There's some agonising gone on before writing and posting this

There was your mistake. Should have tried thinking.

destroying the institution of marriage and the demand that society be made in their image

WTF is this shit? Did extending the franchise to women and racial minorities destroy the institution of voting? I cannot understand this wingnut refrain about how extending an institution to the benefit of more people destroys it. If I thought you were remotely honest, or even capable of the most basic of analysis, I'd ask you to explain. As it stands, I won't waste my breath.

I know on this blog political correctness takes precedence over the plain unvarnished truth

Why is it that lackwits who can't formulate their opinions in any other terms than disingenuous authoritarian talking points are always the first to cry "political correctness"?

Actually, I think that sentence answers its own question.

#128

Posted by: The Very Reverend Battleaxe of Knowledge | April 24, 2009 4:41 PM

Ain't no use in preachers preaching

When they don't know what they're teaching.

Wish I was strong as Samson.

#129

Posted by: Qwerty Author Profile Page | April 24, 2009 4:42 PM

Hank # 121 - She is still kicking at 93 years of age. And I am sure the bishop would approve of her moral DNA as she is a convert. And converts actually believe all the Catholic claptrap.

I did finally tell her I was gay in a letter. (I was in San Francisco and it was October, coming out month.) She hasn't disowned me but we've never discussed my gayness or the letter. I know she got it because she hugged me after the vacation and said, "You know I love you."

So, she suffers from the Catholic woo, but she isn't all bad.

#130

Posted by: AdamK | April 24, 2009 4:44 PM

Clausentum, your narrow minded bigotry screams out with the phrase "destroying the institute of marriage." How is marriage "destroyed" by people getting married? Are you too fucking stupid to see the utter illogic of that? Has marriage been "destroyed" in Massachusetts?

You're an idiot, and fuck you.

Yours in Christ,
Adam

#131

Posted by: cicely Author Profile Page | April 24, 2009 4:47 PM

clausentum @ 117:

I know on this blog political correctness takes precedence over the plain unvarnished truth - and it's really frightening how unreflected the reactions are.

I think, if you'll ask around, our individual opinions are very well reflected (assuming that what you mean is that we've given them a lot of thought). It's just that they don't agree with your no doubt well reflected opinion.

Out of curiousity, is it the use of the word "marriage" in same-sex relationship contexts that causes you to balk? Does "civil union" work for you? Is this over semantics? Or do you object to the relationships themselves, or the social legitimisation of these relationships?

As far as the procreative aspect of marriage is concerned, as others have pointed out, many heterosexual pairings are, for whatever reason, incapible of producing children; those fertility clinics wouldn't exist without a market for their services. Yes, those couples can adopt; but so could a same-sex couple. And, if the anit-abortion lobby were to get it all its own way, there would be all those unwanted, neglected kids just begging for homes---after all, the existence of couples desperate to adopt is so often offered as a reason what those unwed mothers should be required to carry to term; there just aren't enough unwanted babies to fill the demand.

#132

Posted by: C Nelson | April 24, 2009 4:51 PM

I don't know what the M + F ! = > etc. equations mean.

Also, when we hear the kind of “unvarnished truth” Clausentum provides, it seems to always conclude with something asinine. In Clausentum’s case it is that gay marriage will destroy the institution of marriage and demand that society be made in their image (be made gay, I guess).

Acceptance = destruction somehow. (A = D!)

#133

Posted by: cicely Author Profile Page | April 24, 2009 4:55 PM

Tulse @ 124:

I presume you will join me in fighting against the unnatural laws of monogamy in the US, and return it to the historical and biologically natural definition of marriage.

No! Nononono! I demand the right to have a brace of Trophy Husbands!

_______

Another item to pitch in with the fertile man + fertile woman argument---if capacity to reproduce is required to qualify a relationship as a "marriage" then, obviously, marriage ends at menopause, hysterectomy, vasectomy, or informal and sloppy non-surgical removal of fertility by accident.

#134

Posted by: Mr Question Mark | April 24, 2009 5:03 PM

It was a metaphor, obviously.

However, since you've dismissed a "moral DNA," or, more simply, an encoded sense of morality, where do you propose that human morality, or right and wrong, are derived?

The scientific method?

I'd always that that the only recourse that non-theists had when posed with the "why not kill everybody and rob their stuff in a meaningless universe" was to appeal to some sort of evolutionary construct that demands things like charity for race survival. But PZ denies this idea, apparently, as far as to ridicule it.

So, honest question: can someone give me a cogent (and scientific) answer as to where (or if) the morality of the next three statements is derived:

It is wrong for a human to kill another human. (for the sake of arguement, two healthy, non-warring neighbors in Cleveland.)

It is wrong for a human to take another humans property (the same two neighbors.)

It is wrong for a human to rape another human (the aforementioned humans.)

Answers derived from proven science only please. No speculation.

Thanks!

#135

Posted by: Brownian, OM Author Profile Page | April 24, 2009 5:04 PM

These inescapable facts have led to the situation that in every society at every time marriage was something which takes place between a man and a woman, and the concept of man marrying man was ludicrous.

Read an anthro text (any anthro text), you lying fuckhead.

#136

Posted by: Richard S. Lentini Author Profile Page | April 24, 2009 5:07 PM

#113 and #122 Thanks for your comments and taking me seriously. I suppose Charmed Quark is probably right in that there is not a genetic link. I have to say one thing, however, that is in my favor. There was a study done (I think it was peer reviewed -- I shall try to find it today on the Web) with several hundred identical twins vs. fraternal twins that did show a very significant genetic effect between liberal vs. conservative viewpoints as adults. I knew I was putting myself out to possible ridicule, especially since I am a biologist. But I wanted to see what others thought.

#137

Posted by: Richard S. Lentini Author Profile Page | April 24, 2009 5:13 PM

For those reading # 136 please refer to #103 since I obviously think Fr. Dolan's ideas are crazy.

#138

Posted by: cicely Author Profile Page | April 24, 2009 5:14 PM

Mr. Question Mark, I think it's worth noting that many (most? nearly all? I'm no anthropologist) cultures have something very like the Golden Rule, which I see as arising very handily from pragmatic self-interest. If you aren't interested in being murdered, stolen from, or raped as a tag-back on the part of the family and friends, or even the self-interested by-standers, of your victims, then don't invite it by murdering, stealing from or raping your neighbors. This should work especially well in small, widely-spaced bands and communities where everyone knows everyone else, and the perp can't just vanish into the crowd. Sure, he can flee alone into the wilds, but I don't think that would enhance his own survival chances against an uncaring world.

#139

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 5:18 PM

Mr. Question Mark, Will you please provide physical evidence for your imaginary deity that will pass muster with scientists, magicians, and professional debunkers as being of divine, and not natural, origin. Until this is done, your questions are meaningless.

#140

Posted by: C Nelson | April 24, 2009 5:22 PM

#134

I don't know who dismissed that morality is encoded in DNA because I think that it is. #134, your question seems to be based on the premise that morality couldn't be part of a godless creature's behavior - and if anyone thinks that it is, let's have the scientific proof of it! - therefore it must come from God.

Why can't morality be natural (godless)? You know, the thinking is that the practice of "morality" is adaptive - it helps humans to live and have kids. It is simple minded to assume that taking and killing and doing whatever one wants would be the best way to survive. Think about it.

PS It isn't fair to demand scientific proof of an idea in order to consider it

#141

Posted by: Brownian, OM Author Profile Page | April 24, 2009 5:22 PM

Here's a link to what those who have actually studied other societies and marriage think, in the likely event Clausentum is interested in truth rather than support for his uneducated opinions.

At any rate, Clausentum provides another data point for the Dunning-Kruger effect.

#142

Posted by: Mr Question Mark | April 24, 2009 5:24 PM

Nerd
I certainly didn't raise the specter of a god, so I find it strange that you use one to cop out of answering the question. I would certainly welcome a non-cowardly answer from you though.

Cicely:
There are plenty of examples of rugged individualists who do just fine. Furthermore, you didn't answer the question. Is the "urge to merge" into groups embedded genetically? And if so, is the counter-urge not to murder embedded as well? And if so, does that mean that there is a "moral DNA?"

#143

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 5:32 PM

Mr. Question Mark, I could see where you were headed. Show the physical evidence or go away.

#144

Posted by: MrFire Author Profile Page | April 24, 2009 5:33 PM

Mr Question Mark:

Nice name, silly post.

All the transgressions you mention would completely de-stabilize any society in which they were permitted. Therefore, such societies do not exist.

That's my hypothesis. I think it's more reasonable, informative, and workable than "God says so". Scientific method for you.

By the way, you do know that all those crimes were positively endorsed in the bible, don't you?

#145

Posted by: Rev. BigDumbChimp | April 24, 2009 5:34 PM

However, since you've dismissed a "moral DNA," or, more simply, an encoded sense of morality, where do you propose that human morality, or right and wrong, are derived?

Evolving social interactions with consequences.

#146

Posted by: C Nelson | April 24, 2009 5:34 PM

Mr Question Mark,

It is not a copout or cowardly to fail to jump through your ridiculous questions that demand proofs hoops. It is silly to set up such a "test" so you can say "See!" when they are ignored. I'll show you what I mean.

Please give a cogent (and scientific) answer to the following:

It is wrong for a human to kill another human. (for the sake of arguement, two healthy, non-warring neighbors in Cleveland.)
It is wrong for a human to take another humans property (the same two neighbors.)
It is wrong for a human to rape another human (the aforementioned humans.)
Answers derived from proven science only please. No speculation.


#147

Posted by: CJO | April 24, 2009 5:39 PM

There are plenty of examples of rugged individualists who do just fine.

That's moronic. "Rugged individualist" does not equate to "hermit living life devoid of human interaction." Our nervous systems do not function properly after long periods of isolation. This is a simple fact. We are not social by choice. We evolved under circumstances in which to be alone was to die. Look there for the beginnings of the evolution of the innate revulsion by neurologically normal persons against murder, theft and rape.

But something tells me you're looking for an "absolute" reason why these actions are wrong. If so, you'll be waiting a long time for your answer, because the question is incoherent.

#148

Posted by: Mr Question Mark | April 24, 2009 5:42 PM


Mr Question Mark:

"All the transgressions you mention would completely de-stabilize any society in which they were permitted. Therefore, such societies do not exist."

Many acts of copulation amongst other animal populations would be considered rape by human standards. And many human populations have much looser standards of rape than western cultures. Why are animal populations and say, militant Islamic populations destabilized by rampant rape?

Anecdote: my black cat constantly steals food from my calico cat, mostly through brute force. If it weren't for me physically separating them, she would probably die of starvation. Is this situation, what I would call "survival of the fittest," abnormal in the animal populations at large? If not, does it destabilize non-human societies?

I'll let you think about the murder one.

Can someone give me a decent answer? I'm unacquainted with atheist moral philosophy. Thanks!


#149

Posted by: tim Rowledge Author Profile Page | April 24, 2009 5:46 PM

"[Only] fertile F + fertile M => children[...]"
Worse - it has to more like f(F,M) = children where F is a person with female primary sexual characteristics and M is a person with primary male sexual characteristics and f(x,y) is function of mutual fertility and time (at least, maybe more). Two people that are mutually fertile with other people may not be mutually fertile together.

And it has nothing whatsoever to do with any legal/religious/cultural/blah institution being involved. Ask any of the women that have found themselves becoming mothers due to rape or other abusive situations. Or even the (probably much, much, smaller number of) men who have become fathers in analogous manner.

Sigh. Why do we end up arguing about stupid religious nonsense all the time? Oh - of course, it's encoded in our DNA ;-)

#150

Posted by: Mr Question Mark | April 24, 2009 5:46 PM

"That's moronic. "Rugged individualist" does not equate to "hermit living life devoid of human interaction." Our nervous systems do not function properly after long periods of isolation. This is a simple fact."

Please link to some peer-reviewed studies of desert hermits or wilderness men having nervous-system failure from lack of communication. What level of human interaction keeps the nervous system intact? Could raping and killing be enough interaction to keep the nervous system intact?

Thanks!

#151

Posted by: Brownian, OM Author Profile Page | April 24, 2009 5:47 PM

In the (probably unlikely, based on past evidence) event that Mr. Question Mark is genuine in such queries, I suggest Marc Hauser's excellent book Moral Minds: How Nature Designed Our Universal Sense of Right and Wrong.

In a nutshell, Hauser argues for the hypothesis that a 'universal moral grammar' exists hard-wired in our brains, much as Chomsky's 'universal linguistic grammar' does. What this means is not that certain rules are hard-encoded--and how could they be? In nearly every culture that holds "Do not murder" as a moral tenet, murders do occur, and are even sometimes called justifiable)--but that the necessary framework to adopt the morality of the culture in which an individual is born is. For a simple example, consider the emotion of revulsion. Most everyone experiences the feeling of revulsion on occasion, particularly when confronted with other culture's food choices. Yet, barring the ingestion of poisons (and even those are ingested by nearly every culture, albeit in small, usually non-lethal doses), is there a universal truth about what should and shouldn't be eaten? But the feeling is there, and serves to strengthen in-group bonds as well as enforce culturally-specific food choices, many of which (though not all) came about through cultural adaptation to local conditions.

#152

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 5:47 PM

Can someone give me a decent answer? I'm unacquainted with atheist moral philosophy. Thanks
Start with the one thing xian thinking appears to have overlooked for years. It's called the golden rule. This is backed up by gaming theory, which shows essentially the same thing. And you still haven't show your imaginary god exists with physical evidence, so you can't use him in an argument.
#153

Posted by: 'Tis Himself, OM Author Profile Page | April 24, 2009 5:51 PM

Can someone give me a decent answer?

Read posts #138, #140, #144 and #147 for answers to your question.

If you think you're the first goddist to ask about the basis for atheistic morality, please disabuse yourself of that delusion.

#154

Posted by: RBH | April 24, 2009 5:51 PM

Anonymous @101 wrote

@Ariel #85: Some evolutionary biologists completely reject this kin selection hypothesis. Dawkins, in fact, is pretty down on the notion of group selection, if I recall.
Kin selection and group selection are not synonyms. Group selection is iffy; kin selection is not, and in fact is explained (in part) by the 'selfish gene' approach.

#155

Posted by: cicely Author Profile Page | April 24, 2009 5:55 PM

Mr. Question Mark @ 142:

There are plenty of examples of rugged individualists who do just fine. Furthermore, you didn't answer the question. Is the "urge to merge" into groups embedded genetically? And if so, is the counter-urge not to murder embedded as well? And if so, does that mean that there is a "moral DNA?"

True. I didn't say that it isn't possible for a loner to survive, even flourish, alone in the wilderness; just that it helps to have others to, for instance, split watches for dangerous animals, or split the hunting and gathering chores, or help tide you over if you get sick or injured, or for that matter rescue your behind if you fall down a sinkhole or bite more than you can chew in any number of ways.

Myself, I suspect that there are both inherited and environmental aspects to pretty much any behavior (human or otherwise). Someone with an inherited tendancy (chemical imbalance, critically bad impulse control, or whatever) to violently murder anyone who crosses him is likely to get editted out of the local genepool by the community (read, environment) which isn't much interested in living with a violent murderer. I don't, however, see any need for a deity to deliberately implant any imperitive to get rid of the socially non-adaptive, whether for inherited or cultural rasons. What works well, gets passed down, what doesn't work quite as well, not as much, what is positively deleterious doesn't get passed down; and what is irrelevant to current conditions, gets conserved or dropped willy-nilly, and may become relevant in some other conditions. Or not.

As for "urge to merge" into larger groups, I think that it's conditional on environmental conditions. How many people can the local grazing support? Do we need a larger group to help drive off some other group? How many hunters are sensible to have on hand for the size of the local preferred game? How many of the group are related (assuming that family tends to "clump", since they have the most investment in you)? Is the group more or less cooperative as the head count rises? Fertility, disease resistence, external weather features, cultural features (religious dissent and political differences come to mind). I'd say that the "urge to merge" is regulated by comparing the perceived advantages and the perceived disadvantages.

I may want to come back and tidy this up later; 5:00 approaches, so I'll just have to hit "send", and hope for coherency. :)

#156

Posted by: kamaka | April 24, 2009 5:56 PM

Why is anyone engaging in alleged dialogue with this smug, self-righteous asshat?

mr? doesn't want an answer, he wants to win.

#157

Posted by: Mr Question Mark | April 24, 2009 6:01 PM

Thank you Brownian for providing a civil, non-confrontational, and not-too-paranoid answer.

I've heard of Hauser's book, but it seemed too speculative for my tastes.

My big question is: if food choices result in "revulsion," why not sexual habits?

Further, what is the difference between revulsion at food choices and revulsion at sexual habits, at root? Is there a hierarchy to the "universal moral grammar?" And how do we decide which imperative is worth keeping or discarding?

Let's take homosexuality, for instance.

Objectively, there is nothing biologically worthwhile about a creature that self-destructs by not breeding, except perhaps in the model of the sexless workers in a bee-hive. Couldn't "revulsion" at homosexual practices (as an indication of being biologically worthless (i.e., non-breeding) in fact be as hard-wired (and perhaps even more so) than revulsion at food? Things like differences in food seem way more abstract, in fact, then homosexuality does.

Why or why not?

#158

Posted by: BdN | April 24, 2009 6:05 PM

Anecdote: my black cat constantly steals food from my calico cat, mostly through brute force. If it weren't for me physically separating them, she would probably die of starvation. Is this situation, what I would call "survival of the fittest," abnormal in the animal populations at large? If not, does it destabilize non-human societies?

Two cats don't make a "society". To use an easy example that doesn't not necessitate human like morality (even though similar behaviors preclude it), if you look at a macaque society, where females are resident, they tend to form matrilineal coalitions because of nepotism. A mother will defend her daughters against members of other matrilineal groups and transmit her rank in the hierarchy. The system extends to other members of the family. Ecological factors also play a great role in it. For example, one of the reasons why there is less female coercion by males in pan paniscus than pan troglodytes is because females can form alliances because they are not in competition for food. They then tend to dominate males.

#159

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 6:05 PM

Yawn, Mr. Question, either your omnipotent god made a mistake with gays, or he likes gays since he made them. Either way, you lose.

#160

Posted by: shonny Author Profile Page | April 24, 2009 6:05 PM

But being a pedophile, lying, selfrighteous, godfucking prick is that in the catlicking clergy's DNA?
Or does it just come from the bad influence? Or the incision-free lobotomy called faith??

That 'moral' DNA must come in one helluva lot of flavours, and one of the strangest one must be the catlickers' one, because the morality they cling to hasn't got much do do with any desirable, altruistic morals.

And MQM #134, look up 'definitions,' http://www.thefreedictionary.com/definitions 3.a because your demands display a lack of even the most elementary understanding of the different concepts you want someone to explain to you.

#161

Posted by: 'Tis Himself, OM Author Profile Page | April 24, 2009 6:06 PM

Please link to some peer-reviewed studies of desert hermits or wilderness men having nervous-system failure from lack of communication.

Richard Byrd's Alone describes how he spend almost six months by himself at an Antarctic weather station. In the beginning Byrd was enthusiastic about spending that much time alone. In the end, he was almost immobilized by mental depression.

#162

Posted by: Marcus | April 24, 2009 6:08 PM

So, one man and one woman for life. That implies the man is not necessarily a man for life. So a woman and a post-op transexual lesbian relationship would be OK?

#163

Posted by: Brownian, OM Author Profile Page | April 24, 2009 6:11 PM

Why is anyone engaging in alleged dialogue with this smug, self-righteous asshat?

mr? doesn't want an answer, he wants to win.

Oh, we know. The begging-the-question style of argumentation combined with an exhortation to provide peer-reviewed papers that directly answer his questions in the way he asks them are dead giveaways.

Nonetheless, anthropology remains one of my favourite subjects, and I'm happy to share links and information with those here who are genuinely interested.

Anybody else here read R. Borshay Lee's "Eating Christmas in the Kalahari" or Laura Bohannan's "Shakespeare in the Bush"? Both are classic examples of the variation inherent in cultural norms and mores and include subtle descriptions of the ways in which such mores are behaviourally enforced. Besides, they're both excellent reading.

#164

Posted by: Woody | April 24, 2009 6:14 PM

I have read where a sense of 'fairness' can be detected in critters as diverse as humans, dogs, mice, and birds.

A sense of fairness, in the first-person, at least, must/might well be the origin of the idea of 'morals.'

#165

Posted by: Mr Question Mark | April 24, 2009 6:15 PM

Thanks Cicely for your thoughtful and thought provoking responses.

"Myself, I suspect that there are both inherited and environmental aspects to pretty much any behavior (human or otherwise). Someone with an inherited tendancy (chemical imbalance, critically bad impulse control, or whatever) to violently murder anyone who crosses him is likely to get editted out of the local genepool by the community (read, environment) which isn't much interested in living with a violent murderer. I don't, however, see any need for a deity to deliberately implant any imperitive to get rid of the socially non-adaptive, whether for inherited or cultural rasons. What works well, gets passed down, what doesn't work quite as well, not as much, what is positively deleterious doesn't get passed down; and what is irrelevant to current conditions, gets conserved or dropped willy-nilly, and may become relevant in some other conditions. Or not."

Ok, let's (hopefully, someday) select out the serial killers and the mass-murderers. What about the casual or occasional murderer? There seem to be plenty, and the history of human civilization has never been short of the one-off murderer. They haven't, in other words, been selected out. What's the problem with them? I can't see much of one in your proposed, or perceived system. A guy who kills his wife's lover doesn't seem like much of a threat to the stability of the structure. The amount of unsolved murders attest to this. This isn't a question so much as a hesitant statement: if morality is a simple coding, then there is leeway in the coding to encompass some diversity, and at the end of the day, the random murderer really isn't much of an issue, and his random murder is pretty pointless and meaningless in the scheme of the system. Am I about right? I'm thinking of the Woody Allen film Match Point.

"As for "urge to merge" into larger groups, I think that ... perceived advantages and the perceived disadvantages."

Makes sense to me, thanks.

#166

Posted by: RichVR | April 24, 2009 6:18 PM

Mr? If people here actually thought that you seriously wanted to learn, you would get a lot more detailed answers. But since you are obviously trolling, be glad for the answers that you have gotten so far and stop being such an asshole.

Yeah. I know. That isn't your thing. You're to assholy for that.

#167

Posted by: Mr Question Mark | April 24, 2009 6:18 PM

"Richard Byrd's Alone describes how he spend almost six months by himself at an Antarctic weather station. In the beginning Byrd was enthusiastic about spending that much time alone. In the end, he was almost immobilized by mental depression."

Like my cats, an anecdote does not a case make.

#168

Posted by: CJO | April 24, 2009 6:18 PM

This literature, as well as my own observations, has demonstrated that, deprived of a sufficient level of environmental and social stimulation, individuals will soon become incapable of maintaining an adequate state of alertness and attention to the environment. Indeed, even a few days of solitary confinement will predictably shiftthe electroencephalogram (EEG) pattern toward an abnormal pattern characteristic of stupor and delirium. This fact is not surprising. Most individuals have at one time or another experienced, at least briefly, the effects of intense monotonyand inadequate environmental stimulation. After even a relatively brief period of time in such a situation an individual is likely todescend into a mental torpor or “fog,” in which alertness, attention, and concentration all become impaired. In such a state, after a time,the individual becomes increasingly incapable of processing external stimuli, and often becomes “hyperresponsive” to such stimulation.
It has long been known that severe restriction of environmental and social stimulationhas a profoundly deleterious effect on mental functioning; this issue has, for example,been a major concern for many groups of patients including, for example, patients inintensive care units, spinal patients immobilized by the need for prolonged traction, andpatients with impairment of their sensory apparatus (such as eye-patched or hearingimpaired patients). This issue has also been a very significant concern in militarysituations and in exploration - polar and submarine expeditions, and in preparations forspace travel.

Quotations from papers By Stuart Grassian, MD.

There's plenty of literature out there in support of the contention that social isolation is the worst kind of bad for you. We don't just need each other for division of labor, protection, all the pragmatic reasons. We just flat need each other.

#169

Posted by: Brownian, OM Author Profile Page | April 24, 2009 6:19 PM

My big question is: if food choices result in "revulsion," why not sexual habits?

Further, what is the difference between revulsion at food choices and revulsion at sexual habits, at root? Is there a hierarchy to the "universal moral grammar?" And how do we decide which imperative is worth keeping or discarding?

Let's take homosexuality, for instance.

Objectively, there is nothing biologically worthwhile about a creature that self-destructs by not breeding, except perhaps in the model of the sexless workers in a bee-hive. Couldn't "revulsion" at homosexual practices (as an indication of being biologically worthless (i.e., non-breeding) in fact be as hard-wired (and perhaps even more so) than revulsion at food? Things like differences in food seem way more abstract, in fact, then homosexuality does.

Why or why not?

You got it, sort of, but my point was that the revulsion we feel at food choices are relatively arbitrary and culturally-constrained, much in the same way that the feelings that some of us get when confronted with different sexual mores are. For instance, there is/was a tribe in S. America in which young boys lived with the men of the village, and were encourage daily to fellate the older men as the ingestion of their semen was necessary to grow up big and strong and fertile. Revolting to us, to be sure, but not them. So, is it universally wrong, or just locally?

As for self-destruction by non-breeding, you'd do well to consider the examples of self-sacrifice and altruism that occur in nearly every social species, humans included. Read up on the Grandmother hypothesis to understand how non-breeding members of human villages and tribes contribute to the success of the tribe as a whole.

#170

Posted by: Mr Question Mark | April 24, 2009 6:21 PM

"I have read where a sense of 'fairness' can be detected in critters as diverse as humans, dogs, mice, and birds.

A sense of fairness, in the first-person, at least, must/might well be the origin of the idea of 'morals.'"

Ok, Woody, let's talk about fairness.

Is it fair that able-bodied people have to work to keep non-able bodied people alive?

The "fairness" studies you are talking about describe not a sense of empathy for other creatures, but a profound, innate sense of "I'm getting screwed." If we're talking about the same study.

#171

Posted by: Ariel | April 24, 2009 6:22 PM

Mr. Question Mark, I already explained that homosexuality can be understood through Kin selection. It can still lead to a higher fitness for the individual, as inclusive fitness still results in the increased proportion of certain genes in the next generation. See post # 85.

#172

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 6:24 PM

And still the inane questions from the non-thinker. Your god is useless for anything. Not needed for any explanations, or for morals, which were decided by man for thousands of years before Yahweh was invented by men. Learn to use the golden rule. Then you can answer your questions.

#173

Posted by: Ariel | April 24, 2009 6:24 PM

Brownian, I was going to mention the Grandmother hypothesis. I sense a fellow anthropologist? (I'm finishing a primatology degree)

#174

Posted by: CJO | April 24, 2009 6:27 PM

Brownian, I read both of those in undergrad Anthro courses.

#175

Posted by: MrFire Author Profile Page | April 24, 2009 6:28 PM

@148:

You couched your scenarios in a human-human context. To counterpoint with examples of cats and (presumably) orangutans in disingenuous. Please provide examples of cats giving one another food, or orangutans understanding consensual, egalitarian sex, before you accuse them of violating a standard. In any case, these societies do not exist at anything more than a relatively primal level.

With regards to some societies endorsing rape, and other atavistic behaviour: first, see where it has gotten them. Your own contrast to 'western cultures' betrays that very point. Second, these societies do not condone rape, murder and theft on the streets, which your scenarios described. They have justified it to themselves through - guess what - religious/tribalistic reasoning, and carry it out in an often ritualistic fashion.

And murder. I thought about it for you. I don't like being killed - it's very inconvenient. I think I shall extend that courtesy to others, as they extend it to me, and we can all exist more easily knowing that we are in common contract. I think that's a reasonable agreement between two non-warring Cleveland neighbours.

So, one more time, with feeling: We consider these actions wrong, because we're not happy when they're done to us, and if we all agree to not do it to each other, we can contribute to a complex, sophisticated society.

Don't dare to smirk and loftily demand 'decent answers', by the way, without providing your own, well-reasoned arguments - and scattershot trolling does not count.

Thanks!

#176

Posted by: Brownian, OM Author Profile Page | April 24, 2009 6:35 PM

Mr. Question Mark, I think the question of why aberrant individuals such as serial killers haven't been selected out hasn't been (and probably won't be, any time soon) answered, but I'd suggest the answer lies in population biology. Single locus traits with multiple alleles don't always lead to one allele 'winning' out over another, and the case is even more so for multi-locus and multi-gene behaviours.

I'll give you a few speculations (which may or may not be satisfying to you, but they are grounded in evidence from other species):

Sociopaths are present at low enough levels that they tend not to destabilise the populations they are present in but at high enough levels that their genes continue to be added to the pool. We do know that non-lethal but deleterious genes can become fixed in a population at low levels;

Sociopathy comes with other, advantageous traits, that allow them to be reproductively successful (see this or last month's Scientific American Mind for a discussion of how a tendency to anorexia for some (not all) individuals in a population can be advantageous in lean times;

We do know that sociopathy tends to come with certain environmental triggers, so one who might be a sociopath under certain conditions won't under others.

These are just a few semi-educated guesses, although sociopathy isn't my forte. Anyone else?

#177

Posted by: Brownian, OM Author Profile Page | April 24, 2009 6:38 PM

Brownian, I was going to mention the Grandmother hypothesis. I sense a fellow anthropologist? (I'm finishing a primatology degree)

Anthro was my first undergrad major, and my first love. I honestly don't understand how any aspect of human behaviour can be studied without at least a grounding in that field. But that's just me talking out of my bias(s).

#178

Posted by: flora_y_fauna | April 24, 2009 6:46 PM

hey, I really enjoyed this blog and I would like to translate things to spanish, would you agree on that? we could open another blog with the same name but in spanish...I'm from Argentina.. let me know what you think, a huge hug

#179

Posted by: Blake Stacey | April 24, 2009 6:50 PM

Some evolutionary biologists completely reject this kin selection hypothesis. Dawkins, in fact, is pretty down on the notion of group selection, if I recall.

If by "down on the notion of group selection" you mean "consistently opposed to the notion of group selection", then yes, you are correct.

There is a horrible terminological confusion in this corner of science. Field biologists argue with computer modelers who argue with microbiology experimentalists, while physicists fool themselves into thinking they can make real contributions, when in fact their points were made by ecologists years before. Some of the things called group selection turn out to be mathematically equivalent to some of the things called kin selection. (See, e.g., Lion and van Baalen, "Self-structuring in spatial evolutionary ecology" Ecology Letters 11, 3.)

#180

Posted by: Brownian, OM Author Profile Page | April 24, 2009 6:54 PM

Mr. Question Mark wrote:

Is it fair that able-bodied people have to work to keep non-able bodied people alive?

Grandmother hypothesis again. We're a social species who are successful because of our ability to transmit knowledge and experience to each other. There's a very good reason why hunter-gatherers will continue to support the elderly long after their ability to participate in food-procuring activities is largely gone.

It seems that even hunter-gathers know that there's more to life than food and other forms of material wealth. Libertarians would do well to crack an anthro text or two as well.

#181

Posted by: Hank Fox | April 24, 2009 6:58 PM

I didn't read all the comments; maybe this has already been said. But ...

Who the hell is stupid enough to think EVERYONE has to have children?

I don't have any, and I really don't think I miss 'em. Even if there were three billion people like me, something tells me there would still be plenty of children.

The archbishop just hates gays because the only way he can get more people into his idiot religion is to administer brainwashing before the potential victims are too old to be suckered into it.

It's like Amway — if you don't recruit new members, you don't get the big bucks. To an archbishop, Gays are bad because they don't produce new Catholics.

#182

Posted by: windy | April 24, 2009 7:01 PM

Is it fair that able-bodied people have to work to keep non-able bodied people alive?

No, it's not. Eat the babies!

#183

Posted by: nothing's sacred Author Profile Page | April 24, 2009 7:12 PM

There is no genetic basis for a moral code except, perhaps, in the broadest sense of intrinsic rewards for social behavior

Marc Hauser and Steven Pinker would disagree. Not to say they are necessarily right, but it's easy enough to counter a fool like Dolan without making sweeping claims in return.

#184

Posted by: 'Tis Himself, OM Author Profile Page | April 24, 2009 7:13 PM

I'm sure Timmy Dolan will go far in the Catholic hierarchy

The guy's an archbishop of a major city. That means he's already gone far in the hierarchy. If he keeps his nose clean, makes the appropriate dogmatic noises, and doesn't get caught hiding too many pedophile priests, he'll make cardinal in a year or five.

#185

Posted by: Dr. Strangelove Author Profile Page | April 24, 2009 7:15 PM

Oh boy...

#186

Posted by: nothing's sacred Author Profile Page | April 24, 2009 7:21 PM

So, honest question: can someone give me a cogent (and scientific) answer as to where (or if) the morality of the next three statements is derived:

It is wrong for a human to kill another human. (for the sake of arguement, two healthy, non-warring neighbors in Cleveland.)

It is wrong for a human to take another humans property (the same two neighbors.)

It is wrong for a human to rape another human (the aforementioned humans.)

From the need for social cohesion. Societies turn these strictures into memes which they transmit in various ways.

Answers derived from proven science only please. No speculation.

There's no such thing as proven science. And even if there were, there's no basis for your limitation. Certainly your answer is unproven and speculative.

#187

Posted by: The Very Reverend Battleaxe of Knowledge | April 24, 2009 7:22 PM

If he keeps his nose clean, makes the appropriate dogmatic noises, and doesn't get caught hiding too many pedophile priests, he'll make cardinal in a year or five.
Little pessimistic, don't you think? Ratzi the Nazi was rewarded with the tiara for engineering the coverup and shuffling around to safe dioceses of the pedophile priests.
#188

Posted by: MadScientist | April 24, 2009 7:27 PM

@Qwerty:

Don't worry, I've got demon DNA - it's a cross between amoral, immoral, and just plain whacko. Gay DNA is pretty tame in comparison; the problem with the preacher is that he won't admit to having the same DNA. He does want his flock of sheep to breed and supply him with kiddies to fiddle with though.

#189

Posted by: momus Author Profile Page | April 24, 2009 7:31 PM

I can't stand the suspense. Could the archbishop at least tell us which chromosome the "moral DNA" is located on?

#190

Posted by: David Marjanović, OM | April 24, 2009 7:33 PM

{Sound of wife explaining naturalistic fallacy with a frying pan}

:-D :-D :-D

I think I did once see a vi user try to crash a plane into a building full of emacs users

ROTFLMAO!!!

Also, since marriage is defined as being "for life", I'm sure all the people currently protesting gay marriage spend just as much time crusading to outlaw divorce.

Indeed, the Catholic Church does not recognize divorce, and equates remarrying after divorce to adultery. Such people are not allowed to receive communion. "What God has connected, man shall not separate" – and, as we all know, the mere presence of a (Catholic) priest forces God to perform a marriage...

I think there was a survey of new priests a while back and a large proportion freely admitted that they had had sex before taking their vows (which I guess counts as a sin, but less so than breaking the vow or whatever).

Nope, doesn't count as a sin, if done when married. That's right, married Roman Catholic priests exist; they have married first and Heard the Call of God™ later.

The hypothesis is that gay men may help their relatives care for their offspring because they will have more resources available with no offspring of their own. Whether this arguement is actually true

It isn't. It's completely stupid for failing to take into account that homosexuality isn't unique to humans, for crying out loud!!! How does this hypothesis cope with homosexual ducks?

There's published evidence for the hypothesis mentioned in comment 19: male homosexuality correlates with increased fertility in the women in the same family.

I think you have to be intentionally obtuse to make such a criticism of the archbishop's reference to DNA. He was obviously alluding to something like the "ius naturale". He wasn't making a biological argument; he was using a biological metaphor.

He was trying to make up a biological metaphor, and failed embarrassingly, in ways that expose his ignorance and make it shine so bright it completely eclipses his (very, very wrong) point.

I think a more likely explanation is that Cheney's got the equivalent of Klinefelter Syndrome, and he managed to have a solid eee.

B-)

However, since you've dismissed a "moral DNA," or, more simply, an encoded sense of morality

We don't dismiss innate empathy. It's just that the bishop went much, much farther than that, making claims that are nothing but ridiculous. "Innate dictionary" my ass!

Anecdote: my black cat constantly steals food from my calico cat, mostly through brute force. If it weren't for me physically separating them, she would probably die of starvation. Is this situation, what I would call "survival of the fittest," abnormal in the animal populations at large?

Unlike humans, cats are individualists.

(Still not to as large a degree as bears, though. For example, cats can communicate their mood; bears can't, apart from outright attacking or going away.)

Couldn't "revulsion" at homosexual practices [...] in fact be as hard-wired (and perhaps even more so) than revulsion at food?

Sure. I am, in fact, revulsed at homosexual practices. I think it's because of the cognitive dissonance the mixed messages produce: on the one hand, sexual practices are just that, but on the other hand, nobody who's actually sexy participates. Could be similar to how it's disgusting when I watch or contemplate someone eating stuff that I consider to be not food.

I think this reaction is very widespread. I also think it's the reason why (usually fake) lesbian porn is so popular among hetero men, and why Brokeback Mountain is so popular among hetero women.

But, hey, nobody forces me to watch. There are plenty of heterosexual practices that I don't want or have to see either. :-|

(as an indication of being biologically worthless (i.e., non-breeding)

Look, this is just stupid. What do my genes care about the evolutionary success of other people's genes?

So, one man and one woman for life. That implies the man is not necessarily a man for life.

LOL!

Anybody else here read [...] Laura Bohannan's "Shakespeare in the Bush"?

Here it is, in any case.

#191

Posted by: mothra | April 24, 2009 7:33 PM

I think a certain Archbishop has too large a helping of moral fiber in the morning.

#192

Posted by: kamaka | April 24, 2009 7:42 PM

OT

Hey, David M! How does one do the little TM thing?

Heard the Call of God™

#193

Posted by: kamaka | April 24, 2009 7:44 PM

The standard small > thing didn't work for me

#194

Posted by: Mr Question Mark | April 24, 2009 7:45 PM

Thank you to all who gave thoughtful answers!

#195

Posted by: David Marjanović, OM | April 24, 2009 7:53 PM

And here (pdf) is "Eating Christmas in the Kalahari". Quite impressive.

#196

Posted by: David Marjanović, OM | April 24, 2009 7:57 PM

How does one do the little TM thing?

Type ™. Or, on a Mac keyboard, Alt+Shift+D.

#197

Posted by: Travis Bickle | April 24, 2009 7:58 PM

There are many tendencies that are indeed genetically hard wired - not necessarily the ones this fool is gunning for.

More to the point though, even though a tendency is hard wired doesn't make it moral. This is a perfect example of confusing that which is with that which ought to be.

#198

Posted by: The Very Reverend Battleaxe of Knowledge | April 24, 2009 8:03 PM

@ Kamaka:

The trademark thing is alt-2 on a Mac. On the 95% chance you're using a PC--sorry, can't help.

#199

Posted by: kamaka | April 24, 2009 8:09 PM

Mysteries of html...

Thanks&trade David

#200

Posted by: kamaka | April 24, 2009 8:11 PM

Freeware rules!

I use UBUNTU&trade

#201

Posted by: Kel | April 24, 2009 8:12 PM

Maybe there is moral behaviours hard-wired into our DNA, but I would love to see him demonstrate that marriage is hard-wired in there, especially given our polygamous traits. The adultery rate in the us is something like 40-60%? Yep. the one man, one woman, one mistress option must be there ;)

#202

Posted by: MosesZD Author Profile Page | April 24, 2009 8:23 PM

Now I know what's wrong with the Catholic Church... They don't have any moral DNA... What else could explain their Nazi ties, or their conspiracy to protect pedophiles (including giving their pedo-priests fresh Parrish's to plunder when exposed...).

#203

Posted by: Blind Squirrel FCD | April 24, 2009 8:23 PM

David Marjanović, OM @190

cats can communicate their mood; bears can't, apart from outright attacking or going away.)

Actually black bears can express aggression by clomping their jaws together. Very impressive; it sounds like someone slamming a suitcase shut.

BS

#204

Posted by: hje | April 24, 2009 8:32 PM

Runner up for stupid of the day, Republicans in OK hate Flaming Lips:

http://wonkette.com/408076/communist-musical-band-win-epic-oklahoma-battle-over-official-state-rock-song#more-408076

#205

Posted by: Rick R | April 24, 2009 8:47 PM

test

Evil Homo-seks-y'all Ajenda™

fun.

#206

Posted by: freelunch | April 24, 2009 8:54 PM

If, as has been said elsewhere, Dolan is one of the best young bishops of the RCC in the US, the RCC is in far worse shape than I ever imagined (though making things up has a long and honored history in the Church).

#207

Posted by: David Marjanović, OM | April 24, 2009 8:56 PM

Thanks&trade David

The semicolon is part of the code.

#208

Posted by: kamaka | April 24, 2009 9:07 PM

The semicolon is part of the code.

Understood. Thanks.

#209

Posted by: WillB Author Profile Page | April 24, 2009 9:30 PM

@169, 173, 174

I learned about those in my sociology classes.

This confused me a bit, so I asked my sociology professor what the differences were between anthropology and sociology.

Her answer was: "When and where are you as well as when and where are the people you study?"

Thank you for the reminder. That was a great class.

By the way, there was a moral relativist sort of slant to the presentation- a feel of "you shouldn't judge them because you aren't of their culture". I have since decided that it is actually insulting not to judge them the same way I judge my own society so my approach is more "you shouldn't judge them by the standards of your culture, you should judge all cultures on the same grounds or none".

So: Just as the christian churches are taking advantage of the young, so are the male elders of that tribe.

#210

Posted by: Bird Advocate | April 24, 2009 9:47 PM

"between one man, one woman for life"

He should try selling that to my exes!

#211

Posted by: Ranger_Rick Author Profile Page | April 24, 2009 10:12 PM

Moral DNA?
That says it all! This fairy-worshipper thinks and spews crap that is so disjointed, confusing and retarding to the population he should be sued for fraud (in criminal law, fraud is the crime or offense of deliberately deceiving another in order to damage them) and thrown in jail.

Really, statements of that ilk should be held up and used to demonstrate globally the church's lies, fabrications and distortions of valid facts and theories. These wack-jobs are terrorists and have caused more than enough damage to humanity through malicious spin and deceit.

#212

Posted by: Hank Fox | April 24, 2009 10:14 PM

190: "... cats can communicate their mood; bears can't, apart from outright attacking or going away."

203: "Actually black bears can express aggression by clomping their jaws together."

Bears can also make bluff charges, flee at top speed (which is damned fast), do various things with their ears, their eyes, their mouths, the position of their heads, etc., all of which can convey meaning. They also have an array of vocalizations and snorts.

Just because HUMANS can't read a bear, that doesn't mean they're not projecting meaning or mood with every little action — stuff that other bears can read. (Or dogs, come to think of it: Picture and Video.)

Side Note: I know this is not on subject, but I’m still pissed off by that idiot "documentary" that came out a few years back about the life and death of Timothy Treadwell. The theme of Werner Herzog's "Grizzly Man" was that bears are malignant killing machines and Treadwell was a crazy man with a death wish. Yet the guy lived within spitting distance of the bears — unarmed and unharmed — for 12 summers.

Herzog took the easy way out, telling a summer camp horror story about bears, rather than taking a deeper look at what was really going on between them and Treadwell for those 12 years. He contributed to demonizing wildlife by making a “them bears’ll kill yuh” movie, and that makes him a shithead in my book.

#213

Posted by: cicely Author Profile Page | April 24, 2009 10:21 PM

Mr. Question Mark,

@ 167:

What about the casual or occasional murderer? There seem to be plenty, and the history of human civilization has never been short of the one-off murderer.

I don't have enough science to give a firm answer, but it does seem to me that it would depend on whether the tendancy to, say, fly into a jealous rage and murder your spouse's lover, comes bundled with something useful, and there's an absence of anything (bundled with it or not) that would tend to put a brake on the action.

I'm going to indulge in a bit of speculation, based on my observations (admittedly not under scientifically-controlled circumstances) of males in my family with ADD and ADHD (and I'll not be indulging at this time any claims that there's no such animal). Neither is very useful in, for instance, a classroom environment; but the guys have got incredible reflexes. Fast reflexes can save your life---don't stop and think about it, just yank the wheel hard left and avoid the on-coming car; on the other hand, if you are changing your tire on a miserably hot day, and you're running late, and this jerk you don't like anyway stops and pops off his mouth at you, and you impulsively (being hyper--the 'H' in the ADHD)hit him upside the head with the jack handle without any also-reflexive check on the action, then your fast reflexes have just played you false. If the ADD/ADHD were always bundled with those awesomely-fast reflexes (not saying that it does; just speculating, remember?), you've got a good trait hitched to a good-under-the-right-circumstances trait, that may tend to persist in spite of the bad-under-the-wrong-circumstances features.

It seems to also be handy for video-gaming, but that's neither here nor there...or maybe it is, in the heirarchy-building, male-bonding exercises of the Contemporary American Male. ;)
_________
Brownian @ 180:

We're a social species who are successful because of our ability to transmit knowledge and experience to each other. There's a very good reason why hunter-gatherers will continue to support the elderly long after their ability to participate in food-procuring activities is largely gone.

And from the pragmatically self-interested point of view, not only is it useful to keep on hand the brains (taaassty braiiiins) containing knowledge that is only occasionally, under certain circumstances, useful, but I know I appreciate knowing that custom doesn't call for abandoning me to the wolves or bashing in my head in the dead of the night, just because I'm past my prime! Reduced stress, lower blood-pressure, the ability to get a good night's sleep...these are all good self-centered reasons not to be quick to jettison others. Advantage balanced against disadvantage, again.


#214

Posted by: tmaxPA Author Profile Page | April 24, 2009 10:24 PM

After many hours of effort and billions of dollars spent, I have managed to decode the moral genome.

But all it said was "BACON".

#215

Posted by: 'Tis Himself, OM Author Profile Page | April 24, 2009 11:11 PM

It appears the goddist troll decided to squat under a different bridge. Apparently people giving him reasonable answers wasn't how he wanted to play his game.

#216

Posted by: Nerd of Redhead, OM Author Profile Page | April 24, 2009 11:17 PM

But all it said was "BACON".
Hmmm... sounds like tomorrows breakfast. Must be a sign...
Apparently people giving him reasonable answers wasn't how he wanted to play his game.
We can be cruel that way. ;)
#217

Posted by: Janine, Ignorant Slut | April 25, 2009 12:21 AM

Speaking as a self destructive non reproducing dyke, I liked Question Mark much better when he hung out with the Mysterians.

#218

Posted by: Patricia, Queen of Sluts | April 25, 2009 1:09 AM

I've missed the whole bloody thing.

But I'll add blue eggs to the bacon. Anybody opposed to that can damn well piss off.

#219

Posted by: Farouche Ombre Author Profile Page | April 25, 2009 1:12 AM

Mystery Religions are more disperate than one may believe maybe it is heritable and yet owing to disestablished skeptcism incorporated as a single entity [Dawkins et al.]atributes can not be logically outside established religion.
Even yet Catholicism proper or what Persian means because of the referendum and later sic. part of the Church of England ; attachments [1920s] are like about non-conformists understood from the context of the Mysterians.

#220

Posted by: Badger3k | April 25, 2009 1:15 AM

Well, if this priest is right, then why do so many of them seem to have Pedophile Genes, as well as Holocaust Denial Genes, and even some Misogyny Genes. We could isolate these from the priests and perhaps learn to correct such birth defects as Catholicism.

#221

Posted by: Badger3k | April 25, 2009 1:24 AM

#95 "Douchebaggism is the philosophy.
Douchbaggery is the expression thereof."

I think Bilbo Douchbaggins was the best character in The Hobbit! Just look at what he did to Gollum.

#222

Posted by: Discombobulated | April 25, 2009 2:38 AM

Farouche Ombre@219:

Your Markov chains are showing.

#223

Posted by: Nigel | April 25, 2009 3:31 AM

Mr Question Mark Can someone give me a decent answer? I'm unacquainted with atheist moral philosophy.

It would appear that you are unacquainted with moral philosophy altogether, as very little of it is theistic in any very meaningful way.

Even those moral philosophers who happened to be Christians or other types of theists were generally smart enough to realize that just doing what your God says is no basis for an understanding of right and wrong. If you have no independent basis for telling right from wrong, you will have no way of telling whether the being you are worshiping is good or evil. You might be worshiping or following the Devil. And if you follow what you imagine to be the commands of your God-or-Demon just because you believe they will reward you for doing so, or punish you for not doing so, you are not being good, you are just being selfish and cowardly.

Thus essentially none of the many very sophisticated ethical systems that have been developed by moral philosophers over the last two and a half millennia or so, at least since the time of Plato (but of which Mr Question Mark seems to be totally ignorant), depend on belief in a god or gods who lays down the moral law. They apply just as well for atheists as they do for anybody else. (Neither do they depend upon evolutionary theory, or any other aspect of modern science, of course. Most were developed long before those were even dreamed of.) All these systems can also provide you with some quite convincing reasons why it is not good (that is, why it is not, in the long run, good for you) to go about raping, stealing, etc., even if you can get away without being directly punished for it.

Unfortunately, it generally takes quite a bit of study and intellectual effort to understand these reasons properly. If you really want to know, Mr Q, the works of Plato and Aristotle are still a good place to start. A few years hard study and you might even be ready to say something worth listening to about the matter.

Of course, you do not need to have a deep understanding of ethical theory in order to be a generally good person. It is enough, at a minimum, to have a decent sense of what sorts of behavior are right and wrong, and to be aware that there are good reasons for the rules or precepts of morality, and that they are not just the arbitrary decrees of either humans or gods.

#224

Posted by: 'Tis Himself, OM Author Profile Page | April 25, 2009 6:38 AM

And if you follow what you imagine to be the commands of your God-or-Demon just because you believe they will reward you for doing so, or punish you for not doing so, you are not being good, you are just being selfish and cowardly.

Fear of punishment is a lousy basis for a moral system. A small child doesn't steal from the cookie jar because he's afraid mommy will smack his bottom if he's caught. An adult doesn't steal from his coworkers because that sort of behavior is socially unacceptable. Not stealing because the gods will smack your bottom is a sign of immaturity.

#225

Posted by: Abs42 | April 25, 2009 6:55 AM

It never ceases to amaze me that people will use the "but it's icky" argument to say we must be "morally opposed" to something - don't they think the thought of their parents or grandparents, or any other relative of friend for that matter having sex is icky? I certainly think "Ewww" if I inadvertently give myself a mental picture of any of my acquaintences having sex, but I don't think that means they shouldn't! I am sure I am not at my most attractive when I am pulling my orgasm face, but I am married and am fertile and have kids, so presumably none of you should be thinking "ewww" at me giving my husband a good seeing to tonight.
I just don't get it - is going to the toilet immoral too because it is icky?
Can any Christians enlighten me on this one?

#226

Posted by: Farouche Ombre Author Profile Page | April 25, 2009 7:10 AM

That is the reason why Plato said every serious man in dealing with really serious subjects carefully avoids writing, lest thereby he may possibly cast them as a prey to the envy and stupidity of the public.: in public castigating its self.

#227

Posted by: Piltdown Man | April 25, 2009 7:20 AM

Nigel @ 223:

Even those moral philosophers who happened to be Christians or other types of theists were generally smart enough to realize that just doing what your God says is no basis for an understanding of right and wrong.


Why should humans expect to attain an "understanding" of right and wrong?


If you have no independent basis for telling right from wrong, you will have no way of telling whether the being you are worshiping is good or evil. You might be worshiping or following the Devil.


Perhaps what's needed is not a method of telling right from wrong, but of telling God from the Devil.


And if you follow what you imagine to be the commands of your God-or-Demon just because you believe they will reward you for doing so, or punish you for not doing so, you are not being good, you are just being selfish and cowardly.


Without a system of punishment and reward, no parent would be able to discipline his children and no state's criminal justice apparatus would be able to function.

"The fear of the Lord is the beginning of wisdom". It's not selfish or cowardly to refrain from putting one's hand in the fire for fear of getting burned, just an acknowledgement of reality.


'Tis Himself @ 224:

Fear of punishment is a lousy basis for a moral system. A small child doesn't steal from the cookie jar because he's afraid mommy will smack his bottom if he's caught. An adult doesn't steal from his coworkers because that sort of behavior is socially unacceptable. Not stealing because the gods will smack your bottom is a sign of immaturity.


Has the adult achieved a more mature understanding of morality, or has he just internalized the punishment-lessons he received as a child? At the end of the day, what does "socially unacceptable mean" other than "society will punish you if you do this"?


Nigel @ 223:

Thus essentially none of the many very sophisticated ethical systems that have been developed by moral philosophers over the last two and a half millennia or so, at least since the time of Plato ... depend on belief in a god or gods who lays down the moral law. ... All these systems can also provide you with some quite convincing reasons why it is not good (that is, why it is not, in the long run, good for you) to go about raping, stealing, etc., even if you can get away without being directly punished for it.


Suppose these systems' reasoning is wrong? "Quite convincing" seems a bit weak. Why should I listen to Plato or Aristotle rather than, say, Machiavelli, Nietzsche or de Sade? Reason can be used to justify anything.

In any case, people don't always listen to reason or act from rational motives. Hence the need for socially enforced taboos.


#228

Posted by: Nerd of Redhead, OM Author Profile Page | April 25, 2009 7:54 AM

Perhaps what's needed is not a method of telling right from wrong, but of telling God from the Devil.
Back to your imaginary friends Pilty. Not a sign of good mental health. God doesn't exist, so the devil is also a figment of your imagination. In any case, hominids have been figuring out right from wrong since they evolved millions of years ago, and especially since Homo sapiens developed 200,000 years ago. Your god, Yahweh, wasn't invented until about 2,500 years ago by a tribe of small farmers who needed to maintain their social identity. So you god is utterly unneeded for right and wrong, or anything else for that matter. Why worship something so useless?
#229

Posted by: Wowbagger, OM | April 25, 2009 7:59 AM

Piltdown wrote:

Reason can be used to justify anything.

Except, of course, religion. Only the absence of reason can do that.

#230

Posted by: Sauceress | April 25, 2009 8:05 AM

I'm betting Timothy isn't familiar with the concept or process of DNA recombination.

#231

Posted by: 'Tis Himself, OM Author Profile Page | April 25, 2009 8:40 AM

Piltdown Man #227

Has the adult achieved a more mature understanding of morality, or has he just internalized the punishment-lessons he received as a child? At the end of the day, what does "socially unacceptable mean" other than "society will punish you if you do this"?

There are adults who don't rob, rape and kill because they're afraid that they'll be caught and punished. I believe that these are the minority. Many adults have developed a moral system based on the golden rule and altruism. I don't steal from others because (a) I don't want people stealing my stuff, (b) because I feel that other folks expect me to respect their property, and (c) it's not a nice thing to do.

My secretary keeps candy bars in her desk. I could easily help myself to one if she was at the copier. But I don't for the reasons given above. I'm not afraid that she'll call the cops on me if I take a Butterfinger™. There is the point that I would lose some portion of her respect and friendship if I did steal from her and she caught me, but that concern is not uppermost in my mind when I walk by her unoccupied desk.

#232

Posted by: tsig | April 25, 2009 9:00 AM

He just cut the legs out from under his Church.

#233

Posted by: Abs42 | April 25, 2009 9:05 AM

I think the main reason I don't murder or rape people or steal stuff is that I have *no desire to do so*
Do you want to rape or murder people, Piltdown Man?
Maybe part of the equation is working out what is in it for you as well - I have no desire to have sex with someone who doesn't want me in return, so I don't want to rape someone, and I would gain nothing from murdering someone either.
As for stealing candy bars - well, if I want one I can buy my own!
Why can't Christians work out that on the whole people can go through their lives providing for themselves without relying on getting things from others? Is it because they expect everything to be handed to them on a plate if they pray hard enough?

#234

Posted by: David Marjanović, OM | April 25, 2009 9:39 AM

Why should humans expect to attain an "understanding" of right and wrong?

If we don't try, we'll never find out whether we should expect that.

Should humans expect to attain an understanding of what the closest relatives of the turtles are? That's part of my thesis topic.

Perhaps what's needed is not a method of telling right from wrong, but of telling God from the Devil.

Let's go one step back to the basic premise: perhaps what's needed is a method of telling whether any god and/or devil exists in the first place. As long as that question isn't answered in the affirmative, your question falls moot...

It's not selfish or cowardly to refrain from putting one's hand in the fire for fear of getting burned, just an acknowledgement of reality.

Ultimately, it is of course selfish and cowardly. There's just nothing wrong with that.

As I like to repeat at every occasion, I've always been proud to be a confessing coward. :-|

Has the adult achieved a more mature understanding of morality, or has he just internalized the punishment-lessons he received as a child?

Speak for yourself :-)

Even in a world without punishment, I'd think about whether my actions would hurt someone – and I don't want to hurt anyone, because I've got innate empathy.

In fact, there is a case of such a world without punishment. I don't comment on a blog thread without having read all of the thread first. That's because I don't want to duplicate (or quintuplicate) things that have already been said or miss important points that I hadn't thought of (forcing others to repeat them to set me straight). I don't want to do that because it would 1) make me look stupid; 2) waste bandwidth (see empathy above), increase loading times for everyone including myself, and make the thread more boring for everyone including myself. Yet there is no punishment. It happens all the time that someone makes a comment that proves they haven't read the rest of the thread (or, sometimes, even the post itself!), but all that happens is that I get angry behind my desk. PZ doesn't ban people for commenting without reading, and neither seems any other blogger.

Why should I listen to Plato or Aristotle rather than, say, Machiavelli, Nietzsche or de Sade?

Not having read any of those, I'll leave it to others to answer that question; I just wanted to point out that Machiavelli's entire book is nothing but sarcasm, based on all the quotes I've read and all I've read about Il Principe.

Nietzsche thought far, but not far enough, as far as I know. He made a few arguments from ignorance, too, because disciplines like biology and history (and his understanding of them) hadn't progressed far enough yet.

De Sade appears to have lacked innate empathy. Call it a congenital deformity. (But of course it's entirely possible I'm talking about a strawman. The issue is just not interesting enough for me to find out.)

In any case, people don't always listen to reason or act from rational motives. Hence the need for socially enforced taboos.

Most of these forbid actions that are disgusting or otherwise unpleasant to most people anyway. The small remainder needs a good reexamination...

#235

Posted by: BlueIndependent Author Profile Page | April 25, 2009 10:15 AM

"Richard Byrd's Alone describes how he spend almost six months by himself at an Antarctic weather station. In the beginning Byrd was enthusiastic about spending that much time alone. In the end, he was almost immobilized by mental depression."

He asked you to provide evidence of a nervous system failure from lack of human interaction, and you come up with, as another pointed out, an anecdote that talks about one's emotional state after time alone in the Antarctic. Aside from the fact that you used a story and not actual research, how the hell does the emotional element translate to the physical one requested?

#236

Posted by: 'Tis Himself, OM Author Profile Page | April 25, 2009 10:15 AM

A fair number of people misunderstand Machiavelli's purpose in writing The Prince. It is not a scholarly treatise on political theory. Machiavelli wrote it to show his proficiency in the art of the state, offering advice on how a prince might gain and keep power.

Machiavelli justified rule by force rather than by law. Accordingly, The Prince justifies a number of actions done solely to gain or perpetuate power. It is a classic study of power: Its acquisition, expansion, and effective use.

#237

Posted by: Don Vesmili | April 25, 2009 10:22 AM

Should humans expect to attain an understanding of what the closest relatives of the turtles are?
Hell yes, and some of us humans wish you'd hurry up about it!
#238

Posted by: IainW Author Profile Page | April 25, 2009 11:30 AM

Piltdown Man (#227):

Why should humans expect to attain an "understanding" of right and wrong?

Because if, as a rule, we didn't understand what the terms meant, communication using those terms would be impossible. And since we do successfully communicate in moral terms (occasional cultural misunderstandings aside), it is transparently reasonable to expect that human beings are generally capable of understanding how to use them in a meaningful fashion.

(And yes, I know that's probably not what you meant, but that's your own fault for asking an imprecise question.)

At a deeper level, human beings seem fairly capable of analysing the concepts they use - working out what we are doing when we use them, working out what they entail, working out what they logically presuppose etc etc. Of course, there's always plenty of scope for disagreement, but that doesn't mean that the insights or understanding attained by such analysis is completely worthless. The concepts of right and wrong are no different from any other concepts in this regard - if we can't expect to attain a deeper analytical understanding of them, then there are precious few concepts of which we can expect to attain an understanding.

(Possibly that isn't what you meant either. Let's try again.)

If we're talking about attaining an understanding of where our sense of right and wrong comes from, then that's a legitimate question for the psychological and biological sciences. There's no obvious reason why we shouldn't be able to attain just a good an understanding of morality in such terms than any other psychological disposition.

(Still no good? Please clarify the question, then).

Perhaps what's needed is not a method of telling right from wrong, but of telling God from the Devil.

I think you're misunderstanding Nigel's point, which I took to mean: if you have no independent basis for telling right from wrong, then you have no way of making a meaningful distinction between a benign and a malignant deity, i.e., of being able to say of the deity you worship that it is good or bad. After all, most Christians (the main exceptions being those with the courage to follow divine command theory to its logical conclusion) like to claim that their God is good. But in doing so, they assume (implicitly or otherwise) an independent moral criterion by which God's character can be evaluated.

Without a system of punishment and reward, no parent would be able to discipline his children and no state's criminal justice apparatus would be able to function.

Except we routinely distinguish between moral and non-moral motivations for action, and pragmatic self-interest generally falls into the non-moral category. The fact that a system of reward and punishment may be necessary to help reinforce moral behaviour does not mean that one is acting morally if one's sole (or primary) motivation is to gain the reward or escape the punishment.

And yes, a lot has been made in this thread of pragmatic self-interest as a foundation for morality, but it's important to distinguish two things: (a) an explanation of why morality exists as a social institution (i.e., because the institution benefits the individual, irrespective of whether the individual thinks in those terms when performing moral actions), and (b) the motivation for, and justification of, particular actions or policies, where one can distinguish between moral motivations ("Because it's the right thing to do") and non-moral ones ("Because God will give me a happy if I do what he says"). The fact that a social institution can be explained or justified in purely pragmatic terms does not mean that the process of justification within the institution must also have a purely pragmatic basis - the whole point of the institution may be that it provides its own distinct mode of justification. Morality being an obvious example.

Consequently, Nigel has the right of this - acting out of a desire for reward or a fear of punishment falls somewhat short of acting on the basis of moral considerations.

Reason can be used to justify anything.

True but trivially so, if you're only looking at the formal validity of an argument. Less obviously true if you're more concerned with its overall soundness.

#239

Posted by: astrounit | April 25, 2009 4:42 PM

"Hard-wired into us is a dictionary..."

If any of that idiocy was true, how in the hell would he explain the existence of people with "moral DNA" who evidently don't match HIS "moral DNA"?

I think it is justifiable to charge him with high heresy in invoking a DICTIONARY over the BIBLE to supplement his arguments.

Has this Archbishop no sense of shame encoded in his DNA? (Of course not. But he doesn't have that sense anywhere else either).

#240

Posted by: Roger Scott Author Profile Page | April 25, 2009 6:40 PM

"ignorant lie" ??? You have it wrong here, PZ. A lie is a statement the issuer knows to be false. If the maker of the statement is ignorant of what she/he speaks, can it be a lie? Like all clerics, the archbish has looked at the world, sought answers and accepted an utterly stupid story. He is profoundly ignorant. But a lier? Hmmn.

#241

Posted by: EC | April 25, 2009 8:56 PM

If we all have embedded dictionaries, why are so many people such horrible spellers?

#242

Posted by: MadScientist | April 25, 2009 10:52 PM

I think the archbishop meant "moron DNA", but you know - moron, moral - what's the difference?

#243

Posted by: Anonymous | April 25, 2009 11:21 PM

Roger Scott

"ignorant lie" [...] If the maker of the statement is ignorant of what she/he speaks, can it be a lie?
In this case, maybe not, but in general, sure. Lying is intentionally seeking to deceive by what one says, and ignorance of the topic is no impediment to that.

It's more about intent than substance, and it's hard to be charitable here.

#244

Posted by: John Morales | April 25, 2009 11:24 PM

#243 is by me.

#245

Posted by: Piltdown Man | April 26, 2009 8:23 AM

'Tis Himself @ 231:

There are adults who don't rob, rape and kill because they're afraid that they'll be caught and punished. I believe that these are the minority. Many adults have developed a moral system based on the golden rule and altruism. I don't steal from others because (a) I don't want people stealing my stuff, (b) because I feel that other folks expect me to respect their property, and (c) it's not a nice thing to do.


But suppose the cosy network of support systems that enable us to live in comfort were to fail. In the ensuing 'Mad Max' scenario, many adults might think it eminently reasonable to develop a radically different moral system.

(Of course it may not require such a drastic scenario to test the Golden Rule to breaking point. If your secretary were a strident young earth creationist who repeatedly opined that the good Lord hates fags ... maybe, just maybe, you would be pushed over the edge and steal her candy bar.)

Abs42 @ 233:

I think the main reason I don't murder or rape people or steal stuff is that I have *no desire to do so*


But other people might desire to do so. You can't base a system of morality on one person's tastes.


Do you want to rape or murder people, Piltdown Man?


No. thank God. But I'm under no illusion that what I want constitutes a basis for a moral system.


Maybe part of the equation is working out what is in it for you as well - I have no desire to have sex with someone who doesn't want me in return, so I don't want to rape someone, and I would gain nothing from murdering someone either.


Again, these are purely subjective likes and dislikes.


As for stealing candy bars - well, if I want one I can buy my own!


Perhaps if you couldn't afford one, you might be tempted to steal one.


Why can't Christians work out that on the whole people can go through their lives providing for themselves without relying on getting things from others?


"Providing for themselves"? It takes the anonymous efforts of hundreds of people just to keep you and I in candy bars, let alone provide us with food and shelter. Perhaps one day they'll wonder why they're bothering to support parasites like us.

David Marjanović @ 234:

Even in a world without punishment, I'd think about whether my actions would hurt someone – and I don't want to hurt anyone, because I've got innate empathy. ... De Sade appears to have lacked innate empathy. Call it a congenital deformity.
In fact, there is a case of such a world without punishment. I don't comment on a blog thread without having read all of the thread first. That's because I don't want to duplicate (or quintuplicate) things that have already been said or miss important points that I hadn't thought of (forcing others to repeat them to set me straight). I don't want to do that because it would 1) make me look stupid; 2) waste bandwidth (see empathy above), increase loading times for everyone including myself, and make the thread more boring for everyone including myself. Yet there is no punishment. It happens all the time that someone makes a comment that proves they haven't read the rest of the thread (or, sometimes, even the post itself!), but all that happens is that I get angry behind my desk. PZ doesn't ban people for commenting without reading, and neither seems any other blogger.


Again, I wonder what it would take to override your "innate empathy". Perhaps you're closer to de Sade than you think. Could it be that your particular example of blog etiqutette only functions without punishment because the stakes are so low?

#246

Posted by: Nerd of Redhead, OM Author Profile Page | April 26, 2009 8:44 AM

Ah Pilty, your religion isn't working for you since you don't seem to like or trust your fellow man. But then, what else is new from godbots. Your god or religion is not needed or wanted here. You have trouble with that, and keep trying to find a niche for it. We'll keep putting and your religion in its proper place, somewhere outside of society.

#247

Posted by: Wowbagger, OM | April 26, 2009 8:54 AM

You can't base a system of morality on one person's tastes

Every system of morality is the result of people's tastes, Pilty; you and your lot just delude yourselves into believing the one which a certain group of humans developed (the same way every group of humans developed it, i.e. via social evolution) came from a god.

If your god is responsible for morality why have so many moral practices, considered acceptable by Christians, changed in ways completely unrelated to the actions of said god?

We've had everything there is to know about Christianity for over 2,000 years - why was slavery only abolished in the last 150? Did your god make a pronouncement of some kind? I'm sure someone would have mentioned it if he had.

Then there's politics. Why did democracy - a far fairer and more egalitarian system than monarchy, which the bible supports - become the prevailing form of government? What happened to the Divine Right of Kings? Why did god suddenly start trusting humans to choose their own leaders? Considering how poor a job they do of that you'd have to wonder how an omniscient being didn't see that one coming and do something about it.

Let's talk gender equality. Why are women now considered equal in all civilised societies, rather than the subhuman chattel they are in the bible?

None of these resulted from Christ's teachings, otherwise they'd have been in place for well over a thousand years. Why, if your god is responsible for dispensing moral guidance, have so many of the improvements of humanity gone not only without your god's suggestion, but against much of what he is alleged to have ordered us to do via the contents of the bible?

Sexual orientation is now at the crossroads; I envisage that, within my lifetime, that Christian consensus on homosexuality will have changed, just like it changed regarding everything else that the prevailing moral zeitgeist has forced it to swallow - albeit begrudgingly. Heck, Jesus-freaks in 2050 will be claiming they led the way against atheist opposition - some things won't ever change.

Morality has nothing to do with gods, Pilty - yours or anyone else's. It's exactly the same as rainbows - our scientifically illiterate forebears didn't know why they happened, either - so they invented gods to explain it. But in these enlightened times, just as we know about refraction and reflection of the visible spectrum of radiation, we know about evolved morality.

Now it's time to wave bye-bye to your god, Pilty - we don't need him for anything anymore.

#248

Posted by: DJ | April 26, 2009 9:12 AM

I was beginning to wonder what point Piltdown Man was trying to make. All his posts just seem to be quick blockquote responses to other peoples observations just to be contrary. Doesn't seem to have anything to actually say except "you're wrong".... Then I hit refresh and see the new responses by those who've been around a long time.


I guess I shouldn't be surprised that the pointless contrariness is the response of a defensive fundie.

Always learning something here on this blog.

#249

Posted by: Piltdown Man | April 26, 2009 11:17 AM

DJ @ 248:

All his posts just seem to be quick blockquote responses to other peoples observations just to be contrary. Doesn't seem to have anything to actually say except "you're wrong" ... the pointless contrariness is the response of a defensive fundie.


I'm not trying to be contrary for the sake of it. I'm just interested in exploring the premises and implications of what people say.


Nerd of Redhead @ 246:

Ah Pilty, your religion isn't working for you since you don't seem to like or trust your fellow man.


My religion requires me to love my fellow man, not like or trust him.


Wowbagger @ 247:

Every system of morality is the result of people's tastes, Pilty; you and your lot just delude yourselves into believing the one which a certain group of humans developed (the same way every group of humans developed it, i.e. via social evolution) came from a god.


If Christian morality is as much the outcome of "people's tastes" and "social evolution" as any other system of morality, does that mean it's equally valid as any other?

Do you think the Aztecs ' practice of human sacrifice was OK because it happened to be in tune with the prevailing zeitgeist of that particular time and place? If you say yes, you have no grounds on which to condemn the Inquisition. If you say no, you are implicitly positing an objective standard of morality that transcends the zeitgeist.

Or take your examples - slavery, democracy, gender equality and homosexuality. You say "the prevailing moral zeitgeist has forced" - or is in the process of forcing - Christianity "to swallow" these developments. But how do you know the zeitgeist won't suddenly change as it did once before and turn everything on its head again? You seem to be assuming moral evolution proceeds in a particular direction - in a curious contrast to non-teleological physical evolution.


#250

Posted by: Nerd of Redhead, OM Author Profile Page | April 26, 2009 11:44 AM

Pilty, you still don't get it. Modern morality is based a lot more on the golden rule than religious dogma ever was. We won't go back to condoning slavery (allowed by the bible), since we don't want to be slaves. We don't condone rape, because we don't want our families to be raped (condoned by the bible for conquered towns). So revisions of morality aren't as likely in many of these respects. It is your morals that are out of touch with the golden rule. So you must adjust yours to follow the words of Christ. The easiest way to do so is to acknowledge that your church is corrupt. And that Yahweh doesn't exist (he's the god who make an amoral warlord look like a good guy). We don't need your religion or god to be nice to each other. And you are wrong and deluded to think so.

#251

Posted by: Lee Picton | April 26, 2009 3:36 PM

Warning - anecdotal "evidence" follows:

Empathy is innate in humans, but I suspect it is a quality that needs to be nurtured, especially in children. The spawn was only three years old, when he would fetch a blanket and cover me up if he saw that I had fallen asleep in the comfy chair. Never mind that I had to pretend to go to sleep again when he tried to insert a pillow under my head. He obviously had made the connection that being tucked in with a pillow and blanket would be as comforting to me as it was for him at night.
However, it didn't seem to apply to the family cat. That's where the "encouragement" came in. I caught him poking her in the eye (she was a trusting, loving animal), more out of curiousity than malice, I'm sure. I immediately poked HIM in the eye and when he yelped in pain, I immediately explained that was because cats felt pain just like him and she didn't like it any more than he did. He made the connection immediately and never again treated an animal as other than a feeling creature. He had made the moral connection to empathy. No god required.

#252

Posted by: N | April 26, 2009 6:32 PM

Actually, from an entirely scientific standpoint, it makes perfect sense that heterosexuality would be programmed in our DNA. Homosexuals (generally) do not reproduce; this is not a good trait for the continuation of the species.

Of course, it's no justification for banning gay marriage. Why deny the lactose intolerant some soy milk...

#253

Posted by: Ema | April 26, 2009 9:00 PM

I just threw up in my mouth a little.

#254

Posted by: Abs42 | April 27, 2009 6:32 AM

>"Providing for themselves"? It takes the anonymous efforts of hundreds of people just to keep you and I in candy bars, let alone provide us with food and shelter. Perhaps one day they'll wonder why they're bothering to support parasites like us.
What?
It may have escaped your notice, but they aren't doing that out of the goodness of their hearts - they are earning money so they can buy their own candy bars and food and shelter - same here - I work as a nurse and am constantly frustrated by idiotic patients waking up in the Recovery Room and saying "Oh, thank you god - someone up there was looking after me!" I reply "Actually, a lot of people down here were looking after you!"
That is why society works - if everyone suddenly decided to be anarchists there is nothing to stop them, but most people are reasonably happy with how society works, and just carry on because that is what we are used to.
I have no idea why you think everything would degenerate into anarchy without some sort of divine intervention, your mind obviously works in a different way to the majority of the population.
We are not denying that there is a minority of people for whom the golden rule is more a guideline to be followed if they don't want an extra candy bar or some drugs, but that doesn't prove anything about the existence of original sin or a god.

#255

Posted by: Anonymous | April 27, 2009 9:14 AM

IainW @ 238:

If we're talking about attaining an understanding of where our sense of right and wrong comes from, then that's a legitimate question for the psychological and biological sciences. There's no obvious reason why we shouldn't be able to attain just a good an understanding of morality in such terms than any other psychological disposition.


But what reason is there for believing we have attained an understanding of our "psychological dispositions"? Not so very long ago psychoanalysis was widely felt to have provided the definitive conceptual framework necessary for an understanding of human mental processes. Nowadays orthodox Freudians are as rare as orthodox Marxists.

The idea that man can make himself wholly transparent to himself ("your eyes shall be opened: and you shall be as Gods, knowing good and evil... ") strikes me as presumptuous. In the case of morality, why assume that we can always know what is best for us through the exercise of our own rationality? From a coldly rational point of view, it may indeed be impossible to formulate a coherent condemnation of consensual sodomy. But then "le cœur a ses raisons que la raison ne connaît pas."

"Better is a man that hath less wisdom, and wanteth understanding, with the fear of God, than he that aboundeth in understanding, and transgresseth the law of the most High." - Ecclesiasticus 19:21


Perhaps what's needed is not a method of telling right from wrong, but of telling God from the Devil.

I think you're misunderstanding Nigel's point, which I took to mean: if you have no independent basis for telling right from wrong, then you have no way of making a meaningful distinction between a benign and a malignant deity, i.e., of being able to say of the deity you worship that it is good or bad.


I wonder if that is necessarily the case. Perhaps one could argue that an omnipotent and omnibeneficent God would have to be more powerful than a mere fallen angel; and that therefore signs of such superior power would be sufficient to distinguish them without an independent basis for telling right from wrong.


After all, most Christians (the main exceptions being those with the courage to follow divine command theory to its logical conclusion) like to claim that their God is good. But in doing so, they assume (implicitly or otherwise) an independent moral criterion by which God's character can be evaluated.


Not if God is Himself the criterion by which 'good' is defined. (And no, that doesn't mean that divine fiat can arbitrarily turn evil into good. By definition, an omnipotent being cannot commit an evil act, since evil is an imperfection.)


we routinely distinguish between moral and non-moral motivations for action, and pragmatic self-interest generally falls into the non-moral category. The fact that a system of reward and punishment may be necessary to help reinforce moral behaviour does not mean that one is acting morally if one's sole (or primary) motivation is to gain the reward or escape the punishment.


Fair enough. But just because the Christian God rewards and punishes, it doesn't follow that this is the sole or even primary motivation for a Christian to act in a moral manner.


And yes, a lot has been made in this thread of pragmatic self-interest as a foundation for morality, but it's important to distinguish two things: (a) an explanation of why morality exists as a social institution (i.e., because the institution benefits the individual, irrespective of whether the individual thinks in those terms when performing moral actions), and (b) the motivation for, and justification of, particular actions or policies, where one can distinguish between moral motivations ("Because it's the right thing to do") and non-moral ones ("Because God will give me a happy if I do what he says"). The fact that a social institution can be explained or justified in purely pragmatic terms does not mean that the process of justification within the institution must also have a purely pragmatic basis - the whole point of the institution may be that it provides its own distinct mode of justification. Morality being an obvious example.


But if the origin of a practice is purely pragmatic, surely any subsequent justifications in non-pragmatic terms are no more than convenient fictions?


+++


Lee Picton @ 251:

I immediately poked HIM in the eye


Lex talionis!

#256

Posted by: Piltdown Man | April 27, 2009 9:24 AM

I am Anonymous.

#257

Posted by: Nerd of Redhead, OM Author Profile Page | April 27, 2009 9:32 AM

Pilty, still not seeing that your imaginary god and fictional bible aren't needed in the modern world. Time to stop the childish religion and become an adult by renouncing god and the church.

#258

Posted by: IUPAC sexual ambiguity code | April 27, 2009 9:39 AM

A portion of the invected sequence for a female Papilio dardanus:

GAG AAA GAG GAY GTA TGT ATT GTT

OMG lesbian butterflies!!

#259

Posted by: Abs42 | April 27, 2009 11:02 AM

An omnipotent god would indeed have to be more powerful than a fallen angel - by definition - however, it does not automatically follow that the same god would be omnibenevolent - indeed wouldn't an evil god benefit from deluding us into thinking they were benevolent, especially if they were all knowing as well?
Not that I believe in Sky fairies, but I think your logic is very flawed in your assumption.

#260

Posted by: Piltdown Man | April 27, 2009 12:52 PM

Abs42 @ 259:

An omnipotent god would indeed have to be more powerful than a fallen angel - by definition - however, it does not automatically follow that the same god would be omnibenevolent - indeed wouldn't an evil god benefit from deluding us into thinking they were benevolent, especially if they were all knowing as well?


Traditional Christian theology would say omnipotence is incompatible with evil since evil is an imperfection, deviation or lack, rather than a positive quality.

(And if an evil being could somehow be omnipotent it would have no need to delude us into thinking it was benevolent. Why bother if it was omnipotent?)

#261

Posted by: Gruesome Janine | April 27, 2009 12:55 PM

Posted by: Piltdown Hoax | April 27, 2009

I am Anonymous.

You should be.

#262

Posted by: Abs42 | April 27, 2009 3:40 PM

>Traditional Christian theology would say omnipotence is incompatible with evil since evil is an imperfection, deviation or lack, rather than a positive quality.

But how do we know that if our only concept of good and bad comes from the being that tells us it is perfect so therefore good?
Doesn't that smell a bit fishy to you?

Leave a comment

           Sign in or register with TypePad.            Sign up with Movable Type.

Site Meter

ScienceBlogs

Search ScienceBlogs:

Go to:

Advertisement
Enter to win a free copy of The Monty Hall Problem
Visit the Collective Imagination blog
Advertisement
Collective Imagination

© 2006-2009 Seed Media Group LLC. ScienceBlogs is a registered trademark of Seed Media Group. All rights reserved.

Sites by Seed Media Group: Seed Media Group | ScienceBlogs | SEEDMAGAZINE.COM