…and this is a 
Here we go again. Ross Olson is sending more patronizing email, so I guess I'll have to be mean and tear up his prior argument.
November 18, 2009
Dr. Myers,
Thank you for posting my comments and promising to comment on the questions I raised. Here is the introduction I gave to your debate with Dr. Jerry Bergman on the topic, "Should Intelligent Design Be Taught in the Schools?" on http://scienceblogs.com/pharyngula/2009/11/i_get_email_47.php
Although many of us on the ID side did not think our arguments were clearly presented, we were pleased with the civil tone and actual intellectual interaction that took place, just as I asked for below:
*****************************************
Introduction to the Debate
Thank you, on behalf of Campus Atheists, Skeptics and Humanists, Christian Student Fellowship and Twin Cities Creation Science Association, for coming to this debate which can serve as an example for dealing with explosive issues in a courteous, intellectual manner. I am Ross Olson, serving on the Board of TCCSA. I was educated at the University of Minnesota for both undergraduate and medical school and never heard any evidence against evolution. It was 10 years later that I discovered a powerful case against it and I changed my mind, although it took a long time to do so.
Perhaps some will change their mind today, one way or the other, but even for the vast majority who do not, a new respect for the other side may be developed. You may be sitting next to those who you consider enemies tonight. Those of us coming from a Christian perspective know that we are told to love our enemies. And from my interactions with Nick Wallin, leader of the Student CASH, I sense that he follows a very similar principle. A few years ago I was invited to speak at a gathering chaired by Matt Stark, former head of the Minnesota chapter of the ACLU. Introducing me he said, "Unlike theists, we do not believe in revelation. So we have to arrive at truth the hard way; we have to listen to everybody." And they did listen and of course they questioned and argued, but they did listen.
I hope you will take one of the pre and post debate surveys, fill out the first section now and the second section at the end. This will help us evaluate the event. We also hope to have a DVD of the entire debate available through the sponsoring organizations within a few weeks. I would now like to introduce Dr. Mark E Borrello, Assistant Professor, Ecology, Evolution/Behavior, UMN Twin Cities who will introduce the debaters and explain the format.
*****************************************
Dr. Myers, when you do answer my questions, which you refer to as "creationist fallacies," could I ask you to send a copy to my e-mail address? I do not have the time to sift through the chaff of the Blog to find the occasional grains of wheat.
It is ironic that the characterization of creationists by Carl Sagan as "armies of the night," mindless groupies and sycophants, could be applied to the Blogosphere. I asked you to raise the level of the genre but I get the impression that you have no desire or intention to do so. One retired professor began by e-mailing me some barely comprehensible trash talk in the language of the blog but shifted into normal English and actually interacted for several exchanges. When he concluded that interlude, however, he said this, "You are too delusional to continue with...I must return to PZ's blog to get my sanity back."
OK, I have studied the dialect and can try to speak broken "Blog-talk." Dr. Myers, you criticized Dr. Bergman's academic credentials and publication record as a cover-up for insecurity. May I ask you what you have published in peer-reviewed journals? Or in edited journals? I find many references to your blog entries.
And by the way, a blog is not instant peer-review. You would admit -- indeed insist -- (as did Superman) that you have few peers and that most blog entries are not even reviewed by the minds of those who post them. The blog is combination of mutual admiration society with occasional piranha-like attacks on any outsider who wanders in.
Ross Olson
Sneer harder, little man.
No, I'm not going to mail him a reply. If he can't find this, tough. He made a number of ludicrous claims yesterday in a kind of one paragraph Gish Gallop that I've broken up here, and I'll address each one, briefly, with absolutely no expectation that he'll be able to comprehend the concepts, since he's shown no such capability before.
To be addressed is your claim that evolution adds information. That needs to be supported.
Of course evolution adds information: it's a process driven by random variation of a string of information, with subsequent filtering to find viable and more fit variants. My children are not identical to my wife and myself; they contain novel combinations of genes and many new mutations.
I'll add that development is also a process that adds information. The adult multicellular organism that is PZ Myers is a concentrated node of complex information of much greater volume than the fertilized single-celled zygote that my parents made in 1956. As individuals and as a species, we extract energy and information from our environment to increase our personal information content.
Your closing remarks about evolutionary research into the beak changes of Darwin's Finches need to be answered with the point that they are still finches and the changes cycle with changing environmental conditions.
No, because that point is stupid.
What do you expect, that finches in the Galapagos will evolve into monkeys? Over the timescale examined, they will change slowly, and any changes we see will be incorporated into our concept of the finch clade. This is what evolution predicts.
I'll add that we are seeing speciation in Darwin's finches. Some of the latest work shows the emergence of a new finch species in the populations studied by the Grants. This is what we expect: slow shifts over time, punctuated by the separation of populations into emergent species, and they'll all be members of the reptile clade, the bird clade, and the finch clade. They branch, they don't leap categories as creationists demand.
The nonsense about how the changes "cycle with changing environmental conditions" is creo-speak for "they didn't change directionally!" Again, that's not what evolution predicts. Populations will drift genetically, and will also to some degree track changes in the environment. That's what was predicted, and that's what was seen in the Galapagos.
The only point at which the crowd got rowdy was with the mention of evolution's influence on Hitler. Actually, that issue is not solved by shouting because there is a strong case that the desire to improve the race leads to eugenic and ethnic cleansing policies.
The shouting and disgust with Bergman was prompted by his dishonesty.
We are very familiar with these facile and ahistorical attempts to pin the blame for the Holocaust on evolution and atheism. It's not true; Hitler was a Catholic (I will concede that he was a very bad one, one who was attracted to paganism and who also used religious fervor to support his policies), his horrors were supported by many German churches, and by far the vast majority of the German population — you know, the people who ran the death camps and fought the war — were Catholic and Lutheran.
Owlmirror found this very interesting quote in Mein Kampf.
Walking about in the garden of Nature, most men have the self-conceit to think that they know everything; yet almost all are blind to one of the outstanding principles that Nature employs in her work. This principle may be called the inner isolation which characterizes each and every living species on this earth. Even a superficial glance is sufficient to show that all the innumerable forms in which the life-urge of Nature manifests itself are subject to a fundamental law–one may call it an iron law of Nature–which compels the various species to keep within the definite limits of their own life-forms when propagating and multiplying their kind.
That's creationist thinking; Hitler could have been a baraminologist. Don't try to blame evolutionary biologists for the actions of an obvious creationist, like Hitler. Darwin and Haeckel were not such important influences on Hitler as the creationists would like you to think; far more important was Houston Stewart Chamberlain, who basically laid out the entire Nazi philosophy for Adolf — and Chamberlain openly despised evolution. (By the way, my colleague Michael Lackey is writing a book on Hitler's philosophy, which he argues was actually a theology derived from Chamberlain's work. Look for it sometime next year, I'll definitely be posting a review.)
By the way, "desire to improve the race" is not a part of evolutionary biology. Some individuals may feel that way, and they may see the tools of biology as useful for carrying out that process, but it's not implicit in the theory.
Indeed, your claim that morality comes from our culture needs to answer the question, "What if my culture is the Mafia?" Other evolutionary apologists have candidly pointed out that the only morality that can come out of evolution is that I leave my genes, as many of them as possible, to the next generation.
If your culture is the Mafia, you grow up with Mafia morality. Isn't that obvious? God doesn't step in and zap you with Buddhism, you know.
It's the same with Christians. They are brought up with Christian morality, so their beliefs and biases are a product of their culture, which is no mark of shame, although you wouldn't know it to hear how they deny it. Similarly, my morality is a product of my culture, which I will freely admit was shaped by Christianity and other influences. We have beliefs that have worked to maintain our society, so they've been shaped by a kind of natural selection, too — the morality of the Bible has evolved over time. Again, they hate to admit it, because that would be an admission that right and wrong aren't absolute…but Christian morality is itself a testimony to that fact.
Also, a truly interactive academic blog would allow posting of the studies on the academic success of students exposed to both evolution and intelligent design. You have consistently claimed that those students who do not get pure evolution will fail, but without offering any experimental or observational data.
Well, they will fail my classes, obviously. I ask questions about radiometric dating methods, about allele distributions in populations in Hardy-Weinberg equilibrium, and about the effects of the environment on the frequency of traits in a population. If you can't answer those, you'll fail biology courses. It's a truism, like pointing out that students who can't add will fail basic mathematics.
But once again, Olson gets the spirit of the idea entirely wrong. Contrary to his claims, I've mentioned repeatedly that creationist students can be quite bright, and the problem is the wasted potential of indoctrinating them into the lies of creationism. I've also had a number of creationist students who not only pass my courses, but do quite well: they can learn the concepts even if they don't believe them. The point I made in the debate was not that creationist students were doomed, but they were handicapped — they didn't get the background that would have been helpful for freshman biology and had to work harder than students who did get the basics.
And to claim that evidence against evolution does not represent evidence for intelligent design needs closer analysis.
Nope. It's another stupid claim. Arguing that there are weaknesses in evolution (which are typically bad arguments, anyway, but that's another matter) does not mean that Genesis is right; obviously, there are many other alternatives. Creationists like Olson want to make a badly performed sleight of hand in which they disagree with some minor technical point in the science, and therefore we're supposed to swallow the whole bloated, elaborate theology of Christian fundamentalism instead. Nuh-uh, that's transparently false.
There is a logical dichotomy involved. Life either has a natural origin or not. If not, then the origin must come from outside natural mechanisms. You can claim that we just don't know, but while waiting, need to entertain the possibility that there is a cause outside of nature. To say there can be no such thing is not a scientific statement or even a logical one but an a priori elimination of one whole field of inquiry.
And there he goes. Don't trust him; he wants an admission that a supernatural agent is merely possible, and then he's going to pretend that you've admitted that the entire intricate structure of Christianity is a scientific enterprise. I'm not going to fall for it, and no one else should be that gullible, either.
I do not say that there can be no such thing as a supernatural agent; I say that the creationists have not provided any credible evidence for such a thing, which is a very different argument altogether. As I said in the debate, if you want an idea to be scientific, show us the evidence. It's possible that the elves have been guiding evolution all these years, but it's not a possiblity I have to seriously consider in the absence of evidence for the existence of elves.
Your redefinition of vestigial organs as reduced function may get some traction but is not the way they were presented 100 years ago,
No, it is precisely the way Darwin presented it. Darwin did not claim that vestigial organs had no function (Bergman's bizarre and erroneous definition) but that the appendix was reduced compared to the homologous organs in non-human relatives. The word Darwin used was "rudimentary," not "non-functional." The only people redefining terms here are the creationists, and Bergman's peculiar series of bizarre distortions was a perfect example.
but there is no doubt that "Junk DNA' was clearly touted as evolutionary leftovers and delayed the search for function, which was predicted by Intelligent design.
There is no doubt that Olson is spouting complete bullshit here. At the debate, I recommended T. Ryan Gregory's website, Genomicron, as a good source for factual information on the history and meaning of junk DNA. You might start with his "best of" post; scroll down to all the links on junk DNA. As he explains, the default view, biased by a strongly adaptationist stance, was that all DNA was functional (creationists thought likewise for different reasons—why would god load up our genomes with junk?). These views did not hold up to scrutiny. The idea that much of our DNA was junk arose from understanding of genetic mechanisms and was further supported by comparative genomics.
If ID predicts that there is little junk in the genome, then ID is wrong. Roughly 95% of the human genome is repetitive sequence, pseudogenes, and random debris. A few percent is coding sequence (not junk), and a somewhat larger percentage is regulatory (also not junk, and never regarded as such — much of the defense of non-junkiness nowadays comes from a bogus appropriation of regulatory DNA as evidence of function, but such regulatory sequences were never part of the 'junkome'…to coin an ugly new word that Jonathan Eisen can scowl at, righteously, I think).
Most of your genome is junk. Get over it. A small part of the non-coding DNA is intensely interesting to biologists, but not because ID had anything to do with predicting it.
And that's enough of that. Creationist misrepresentations of science are so ridiculous that you want to slap them down hard, but they also take way too much time to criticize…especially since superficial kooks like Olson love to flit over these claims with so little depth, tossing out a dozen lies instead of addressing a single point with some seriousness, since that would expose their con far too obviously.
He was right on one thing: we do make piranha-like attacks on people like him. The implication of that analogy, of course, is that that makes him dead meat ready for shredding. Bon appetit, my ravenous school!
Comments
Posted by: mechanoid
|
November 18, 2009 2:18 PM
How could any of my DNA be junk when I'm a precious snowflake of God?
Oh... wait...
Posted by: Glen Davidson
|
November 18, 2009 2:21 PM
There's one way to increase respect in these discussions--for people like Olson to quit lying egregiously, repetitively, and without respect for his opponents.
Lying charlatans deserve no respect!
Glen D
http://tinyurl.com/mxaa3p
Posted by: John M | November 18, 2009 2:33 PM
Excellent posting. I enjoyed reading it and learned a lot.
Posted by: Insightful Ape | November 18, 2009 2:34 PM
It only puzzles me how many lies you can stuff into one email.
Posted by: Nerd of Redhead, OM
|
November 18, 2009 2:37 PM
Ah, Dr. Olson appears to be afraid to come and face the knowledge and rationality of the ilk. Doesn't say much for the strength of his convictions, much less his evidence for his convictions. Methinks he is afraid of a true scientific debate, but prefers inane philosophical discussions where he can mentally wank without overt criticism, or being called on his misinformation.
Posted by: mechanoid
|
November 18, 2009 2:38 PM
As for Hitler...
The moral objection is due to the constant conflation of Darwinism and Social Darwinism.
Not the same thing people! Quit perpetuating the naturalistic fallacy of is ergo ought.
Morals arise through acculturation and agreed upon standards of conduct, not from observing natural processes.
Posted by: Rev. BigDumbChimp | November 18, 2009 2:38 PM
Leaving alone his ridiculous absurdity concerning creationism and evolution, there's no need to attack Ross like a piranha.
Anyone who thinks like this does not make it difficult to attack him.
Posted by: Sherman | November 18, 2009 2:39 PM
I would love to see the exchange he mentions- I'm curious what he considers "Normal" English. I wonder if the professor (assuming he exists) still follows the blog?
Posted by: Peter G | November 18, 2009 2:42 PM
It was just a few threads back, the one on eating live squid, that I was admonished about the perils of moral relativism. Yet morals can never be anything but relative and a product of culture.
Posted by: Glen Davidson
|
November 18, 2009 2:43 PM
Minor point: It's confusing to have two "I get email" titles in play at the same time.
We don't know if the "recent comment" is on one thread or the other one.
Just for your consideration, PZ.
Glen D
http://tinyurl.com/mxaa3p
Posted by: Alan B | November 18, 2009 2:46 PM
Well analysed and disected! There were so many random ideas coming together that I could hardly see where the joins were in the original e:mail.
I wonder what purpose the original served if the author was not prepared to look for a reply as a thread on this site. Presumably so he could say, "I asked the questions but I got no reply to any of my points from the evilutionist".
A final point. I note that he says the ID arguments were not presented very well in the debate:
That is hardly PZ's fault. The ID people chose the speaker. He fouled up. Get over it!
Posted by: Hydra009 | November 18, 2009 2:47 PM
This is my favorite part of his whole screed because it's just so blatantly false.
The implication here is that evolution has absolutely no effect on human/animal morality with the notable exception of rampant breeding. Yet many animals (not to mention humans) certainly exhibit a variety of altruistic and cooperative traits, traits that clearly have an evolutionary basis.
Sigh. Another creationist lying for Jesus.
Posted by: Ryan F Stello | November 18, 2009 2:47 PM
Jimmy Olson sed,
Posted by: Rev. BigDumbChimp | November 18, 2009 2:47 PM
More Dr. Olson
everyone say it together
PRO-JEC-TION
Posted by: Owlmirror | November 18, 2009 2:51 PM
Just to give credit where due:
Three years ago, you posted a bunch of quotes of Hitler proclaiming his religious beliefs (which I saved off to use against those claiming that Hitler was an atheist).
On that thread, Steve_C linked to dorkafork's Darwin-Hitler quiz (now a dead link, sorry), which I also saved off to use in further arguments against those claiming that Hitler was somehow an evolutionist/Darwinist.
That's where I got it from, but I did confirm via Google that the cited material is indeed in Mein Kampf (in various archive sites) before posting it.
And just for completion's sake, here are the other citations from Mein Kampf that were in that quiz -- (they are all vaguely in favor of Creationist/fixity of species notions, but the one I posted was, I think, the one most obviously Creationist in phrasing):
Posted by: AJ Milne OM
|
November 18, 2009 2:53 PM
... ah yes, more insinuations about 'sycophancy' and 'echo chambers' from dear ole' Cap'n Projection...
I expect he may be noticing by now there is rather a large number of people--some several thousand, I'd guess, at least--who happen to generally agree here he's pretty much full of shit, here...
Now, sure, to anyone half familiar with the facts of the case, this is no mystery. To me, this is a bit like finding a forum of people generally agreed that the sky is blue, the earth is round, and so on... Not exactly puzzling, those.
Still, Olson seems to be finding this odd, nonetheless...
Hmm. Dunno how to help ya, here, pal. A new metaphor maybe?
So how 'bout this one: Olson, dearie, the way I see it, the jury isn't unanimous you're a pathetic dweeb so much because the foreman happens to have talked 'em all into it, or they've some deep desire to agree with him, or nothin'...
No, I rather think it's more that you keep videotaping new confessions and sending 'em to us.
(/Along with nicely bagged and labelled forensic evidence. And mind you, no, this is in no way an appeal for you to stop or nothin'... I mean, there's so much that's uncertain in this world... The economy, the wars, who knows where it will all end? But in this whirling maelstrom of the uncertainty, it is nice to be able to lay your hand to one certain fact... And the fact that Ross Olson is spectacularly full of shit, I guess that'll have to do.)
Posted by: Celtic_Evolution
|
November 18, 2009 2:53 PM
Love this part... nothing like admitting you're a sniveling coward who doesn't have the strength enough of his own convictions to bring an argument to a forum of people with the actual credentials to debate it on its merits.
Stop whining, Olson and bring your arguments, and the evidence supporting them here. Let's have it...
You haven't even brought any evidence supported argument to PZ... all you've brought is an old, overused laundry list of suppositions and perceived "holes" in evolution that even if legitimate (and they aren't), would still in no way support ID as a viable scientific pursuit.
Your continued insistence on embracing an idea steeped in superstition and magic, with no evidence whatsoever, as science is an embarrassment to your intelligence and your profession. You should be ashamed.
Posted by: RickR
|
November 18, 2009 2:53 PM
"Nope. It's another stupid claim. Arguing that there are weaknesses in evolution (which are typically bad arguments, anyway, but that's another matter) does not mean that Genesis is right; obviously, there are many other alternatives. Creationists like Olson want to make a badly performed sleight of hand in which they disagree with some minor technical point in the science, and therefore we're supposed to swallow the whole bloated, elaborate theology of Christian fundamentalism instead. Nuh-uh, that's transparently false."
I try to parse the godbots POV, since it makes no fucking sense to me. But I think they see the shining golden light of Genesis and the bible, lighting up the path of history for ~2000 odd years, making everything all jesusy and yummy, and along comes mean old science and evolution! Puke and icky! It comes along and...and..starts covering up the perfect jesosity of the bible's account with, like, facts and junk. This just won't do!!
It's as if they see this shining golden sphere, covered with a thick crust of dried dog poopy, slung by meany atheist scientists for 150 years, dulling the light and making it seem weak and feeble in comparison.
So all they have to do, is attack the crust, chip enough of it off, and the golden light will spring forth, for all to marvel at and adore!!
At least, it seems so when I play "think like a loony".
Posted by: mechanoid
|
November 18, 2009 2:53 PM
My favorite example of altruism as an evolutionary advantage is the noble Slime Mold!
"I sacrifice myself. Onward comrades!"
Posted by: AdamK
|
November 18, 2009 2:54 PM
The whole Hitler/eugenics lie makes no sense on the face of it. Hitler wanted to perform ARTIFICIAL selection on humans, like agriculturists have been doing on non-human forms since the dawn of civilization.
Darwin"ism" is about NATURAL selection. Different thing!
Obviously, farmers are to blame for the Holocaust.
Posted by: freelunch | November 18, 2009 2:54 PM
I thought that was a feature, not a bug. If the ID claims are clearly presented, all but the most brain-dead creationists would recognize that the ID claims are claptrap.
Posted by: Clan of Schnauzers | November 18, 2009 2:57 PM
W/ regards to Hitler.
I don't quite understand the argument. Say for sake of discussion I concede that Hitler was an atheist. And say I also concede that atheists have no moral barometer (or whatever). At what point do either of these lead to the conclusion that therefore God must exist?
Maybe I just don't understand but I don't see how the conclusion follows from the premises. Actually a more acceptable conclusions is that these premises show that God does not exist.
I know about the free will defense.
Posted by: Sherman | November 18, 2009 2:57 PM
Just finished the entire post- I've heard of this tactic by creationists before, trying to bury the debater in lies that can't possibly all be tackled within the time alotted- but I've never actually seen it. It also shows, graphically, why it's so succesful- even in a debate with 30 second turns, he could get off a lot of the "misconceptions" (I wonder though how you can package so many together and still be allowed to call them that), while any kind of rebuttal would take at least 30 seconds per point- putting you on the defensive for the rest of the debate. I wonder if we could take a similar approach when debating them?
Posted by: Ewan R | November 18, 2009 2:59 PM
May I ask you what you have published in peer-reviewed journals? Or in edited journals?
Just incase Ross Olson happens by.... may I suggest combining google scholar with the vanishingly small chance that there are many PZ Myers working in the field of developmental biology at the institutions this PZ Myers has worked at? It takes all of 5 seconds to churn up a bunch of articles. From reputable science journals no less.
A similar search for Jerry Bergman turns up well, exactly what you'd expect (creationism journals and apologetics), as well as some batshit crazy stuff about how pathogenic viruses are the result of man buggering about where he shouldnt be, and how viruses arent really pathogenic anyway (he does mention the immune system now and again, but fails utterly to acknowledge an evolving immune system might have something to do with the fact that most viruses arent pathogenic) - he also comes dangerously close to admitting that evolution occurs throughout, which may be why he goes to such lengths to make sure that everyone is aware he doesnt consider viruses to be living.
Posted by: Rev. BigDumbChimp | November 18, 2009 3:00 PM
The Gish Gallop
Posted by: lose_the_woo
|
November 18, 2009 3:01 PM
Mr. Olsen - I think the proper name for this kind of argument is called false dichotomy. You should really read about it. If you click that blue text (that reads: "false dichotomy") your web browser will take you to a different web page (this action is called "hyperlinking") where you can learn more about it.
Posted by: AdamK
|
November 18, 2009 3:02 PM
To do so would require packing in an equivalent number of lies, straw men, and irrelevencies, and abandoning reason altogether.
Who would voluntarily do that?
Posted by: Owl"piranha"mirror | November 18, 2009 3:02 PM
NOM NOM NOM
Better that than the candiru of "ID"iocy...
Posted by: Celtic_Evolution
|
November 18, 2009 3:04 PM
This is the part that takes the cake for me...
It's smug, condescending, mind-numbingly lazy and epically stupid all at once.
It really takes a creationist to make such a poorly veiled attempt at derision, and not realizing what an idiot he's making of himself in the process.
Posted by: SteveM | November 18, 2009 3:05 PM
I was going to try to satirize this by trying to derive morality from physics, but then realized that has already been done in all seriousness with the theory of relativity. "Moral Relativism", I believe, kind of "took off" after TOR became misinterpreted as "everything is relative".
Anyway, the point is that these (TOR and TOE) are not designed nor intended to be used as a basis for morality. It would be like trying to derive morality from a automobile service manual. They are meant to describe how the world works, not how we should behave in the world.
Posted by: NewEnglandBob
|
November 18, 2009 3:05 PM
Bravo, PZ. Olson got the evisceration he deserves for being such a malicious "Liar for Jesus™".
I see from his web site that he is a pediatrician that was 'laid off" and then "contract not renewed". I guess his 'attributes' are obvious to others.
Posted by: Joe Bleau | November 18, 2009 3:08 PM
Rev BDC @7:
Ewww.
Dr. Olson my friend, don't you turn away, uneasy. You poor old sod, you see it's only me.
Posted by: cervantes
|
November 18, 2009 3:11 PM
Regarding the culture of the Mafia:
You might have pointed out that they are all devout Catholics, who go to church regularly, take communion, have their children confirmed, marry in the church, and are given last rites, funerals, and Catholic burial.
Just sayin'.
Posted by: lose_the_woo
|
November 18, 2009 3:12 PM
Sherman #23
Read about the Gish Gallop Rev. @ #25 linked to. I've seen it in action. Even as a bystander it's infuriating.
I don't like that - it's deceitful and dishonest discourse. IMO, the way to handle it is to restrict each exchange to exactly 1 point and continue the exchange until exhaustion or say 4 rebuts each. This forces them to lay bare all of their misconceptions, misunderstandings, and misinformation.
Posted by: Caine, ghetto féministe
|
November 18, 2009 3:14 PM
Oh, it's a tragedy! Cue Coach Olson, ready to whine about tone and the evil tendency of pharyngulites to not bend at the knees. Tsk.
Posted by: bunnycatch3r | November 18, 2009 3:14 PM
PZ just opened the big can.
Posted by: SteveM | November 18, 2009 3:15 PM
You're right, but it could also be that they are not always saying "therefore God exists", but instead "you can only be good if you believe in God". God's actual existence doesn't matter so much as your belief in him that will keep you on the "straight and narrow". Just as not believing in him will let you run rampant, killing and raping willy-nilly.
Posted by: Qwerty
|
November 18, 2009 3:15 PM
Olson writes to PZ, "Although many of us on the ID side did not think our arguments were clearly presented."
Because your debater, Jerry Bergman, spent most of his time talking about his books, his life of perpetual ostracism from atheist and the scientific community, and his understanding of ID and/or "irreducible complexity".
At NO time did I hear Bergman present a single argument as to the central theme of the debate which was "Should Intelligent Design Be Taught in the Schools?" And, we were told, this was HIS topic!?!
From Kittywampus's excellent summary of the event:
"Dr. Bergman, on the "Yes" side of the debate, spent the first half of his twenty minutes talking about himself and all the atheists he knows. In fact, he was an atheist! Many of his friends were atheists! But he found the atheist movement to be deficient, scholarly. He defined evolution as "from the goo to you by way of the zoo." There's nothing like a catchy, rhyming phrase laden with panting sarcasm to make me warm to your argument. He said that "you cannot judge a religion by those who don't follow it," and that sentence still does not make sense to me. He talked about debunking Darwinism step by step, stating that doing scientific research was what led him to theism and creationism.
I was wondering what this had to do with teaching ID in schools."
And so was I.
Posted by: Tulse
|
November 18, 2009 3:18 PM
My guess is that Olson thinks that Catholics are not Real True Christians™, and are all going to burn in hell regardless.
Posted by: David Estlund | November 18, 2009 3:19 PM
Rev. BigDumbChimp #7:
Dr. Olson is a pediatrician?! I sure hope he doesn't treat little girls!
Posted by: Sherman | November 18, 2009 3:22 PM
To do so would require packing in an equivalent number of lies, straw men, and irrelevencies, and abandoning reason altogether.
Not necessarily- it requires building up an enormous amount of arguments they cannot possibly respond to in the time allotted. They could be legitimate arguments- just cram them all into a tiny amount of time.
Who would voluntarily do that?
Funny that two "amoral" atheists are equally outraged, morally, at the prospect of doing something that some Xians not only do on a regular basis but take genuine pride in.
Posted by: Greg Laden
|
November 18, 2009 3:22 PM
HE LIES!!! I am not entirely disconnected form the creationist/ID community, and I have heard nothing but utter disappointment from people who were at the debate regarding Bergman's stunningly asinine presentation.
One creationist said "I'm always so disappointed with these debates, one side is always so much smarter and better prepared and able to do this than the other."
When asked which side was better prepared and smarter, the chagrined answer: "That Myers guy"
Posted by: SteveM | November 18, 2009 3:23 PM
[continuing] God is the answer to the idea "it ain't illegal if you don't get caught". The only counter they can come up with is "god will catch you eventually". They are unable to conceive of doing the right thing for its own sake and not because you will go to heaven for it or because you will go to hell for doing the wrong thing.
Posted by: Joe Bleau | November 18, 2009 3:23 PM
Oooh, good question! Hey, can I play too?
What if your culture was the Moche of Northern Peru? Do you think that your ideas about how to best commune with your creator(s) might have turned out a wee bit differently?
Posted by: Celtic_Evolution
|
November 18, 2009 3:23 PM
Yeah... that letter the Rev. BDC posted at #7 is downright creepy... especially, as David Estlund pointed out, coming from a pediatrician that must treat young girls. What a misguided argument... "therefor no male teacher shall teach a class with girls, since heterosexual males are attracted to females"...
Ick... I need a shower just reading that...
Posted by: lose_the_woo
|
November 18, 2009 3:24 PM
Speaking about piranha and mafia morality, I wonder why piranha wait for prey. I mean, certainly they don't believe in teh jebus. So why, I wonder, don't they just eat each other?
Gosh. This morality and mafia point is such a tough one to figure out.
Maybe I should just go start killing and raping now, since, as an atheist, I'm moral-less.
Posted by: Rev. BigDumbChimp | November 18, 2009 3:24 PM
Oh damn. Nice point.
Posted by: Sven DiMilo | November 18, 2009 3:28 PM
They find each other a little stringy and gamey.
Posted by: lose_the_woo
|
November 18, 2009 3:29 PM
Greg Laden #42
Nice intel. Thanx. It made me feel warm and fuzzy. Well, maybe just a little less shrill and strident - for a moment.
Posted by: Kel, OM | November 18, 2009 3:31 PM
Is it really that obvious? What about our innate sense of right and wrong? Agreed that there's some malleability about it, but to put it down as all culture?Posted by: Sven DiMilo | November 18, 2009 3:38 PM
What about it? Is there such a thing? Does it innately apply to all sentient beings, all Homo sapiens, or just my immediate tribe?
Does a wiseguy hitman think what he (or she) does is innately "wrong" but he does it anyway? Or, in his or her cultural milieu, is it "just business" or "the way we have always done it" and therefore not "wrong"?
Should I append any more rhetorical questions?
Posted by: Krystalline Apostate | November 18, 2009 3:39 PM
Joe @ 32:
...you poor old sot, you see it's only me. Sun streak & cold...
Posted by: Rev. BigDumbChimp | November 18, 2009 3:40 PM
The problem comes in this, It takes virtually no time to spout off a Kent Hovind styled lie about evolution, but the debate format is not well suited to give a well done explanation of the specifics of say genetic drift or the geologic column or heritablity when at the same time dealing with additional Hovind / Gish style lies. There just isn't the time to answer the lies not only efficiently by thoroughly.
It's not just the number of lies you have to contend with, its that the time it takes for them to tell the lie is minuscule to what would take to shoot it down (frequently)
Posted by: Malkara | November 18, 2009 3:40 PM
I'm always amused by the "Darwin influenced Hitler" spiel, because the easiest return is to simply quote Martin Luther's own words in "On the Jews and Their Lies":
http://en.wikipedia.org/wiki/On_the_Jews_and_Their_Lies
Fascinating.
Posted by: Anubis Bloodsin the third
|
November 18, 2009 3:42 PM
So Ross got his delusion totally panned, obviously cos someone has got a pout on.
Bleating and whining is the only recourse the retards have, it was so mean to show the jeebus scam for what it is.
'babby jeebus bee cwying' methinks!
Bit of a whiner anyway is Ross, according to the snippets from Rev BDC.
Best to really give the dork a reason to snivel.
"Although many of us on the ID side did not think our arguments were clearly presented"
Ross munchkin, you do not have any arguments remember precious, ID is fictitious in your confused and addled mind, that is why you and your ilk ask and present the same discredited dross over and over again, must be short term memory loss.
And let us not overlook lack of substance, or more likely IDeas!
ID/Creationist clones do not have the scope, just the blinkers of 'godwotdidit', and that means you is screwed both functionally and metaphorically.
You are all trying to squirm through the same gap you think is there in front of you, but you are all, and to a ID/Creationist, hallucinating.
There is no gap kidda, that is why you are all bunching up at the same bottle neck.
Hence we get the same mantra of petulance over and over from the 'jeebus is my sunbeam' addicts.
Like watching a car crash over and over again, fascinating at first but ultimately boring.
And the stupidity or probably the dishonesty not to want to understand the answers to the questions creationists always ask and that are always answered by rational knowledge, is between you and your foetid conscience.
Sticking digits in ears and loudly singing jeebus praises is no excuse dear, do yourself a favour get a life before it is to late!
Although damaged beyond repair methinks, but that is what happens if you wallow in your own intellectually desolate stench for to long.
Posted by: Krystalline Apostate | November 18, 2009 3:43 PM
I pointed this out in the last thread (but didn't expound on), that the Mafia is actually a sub-culture. As such, it subsists on surrounding culture, & being parasitic, would likely not survive in isolation.
So as analogies go, that's a limp one.
Posted by: Kel, OM | November 18, 2009 3:45 PM
Just saying, don't think it's all cultural.Posted by: lose_the_woo
|
November 18, 2009 3:46 PM
Hmmm Sven, let me take a stab at that.
I think that those in the mafia do strongly feel that unwarranted, cold blooded, unprovoked, pre-meditated murder is wrong. But when they do a "job", they convince themselves that the "mark" deserved it.
Perhaps that was what Kel was getting at. However, I thinks it's facile to characterize it as "an innate sense of right and wrong". IMO there are a lot of factors that get involved.
Posted by: Joe Bleau | November 18, 2009 3:47 PM
Kel @50
See @44.
It's fine to sit here in the comfort of our 20th-century "enlightened" Western morality and declare ritual human sacrifice an abomination (and make no mistake - it's an abomination!), but that is an irrelevant (and likely incoherent) opinion vis-à-vis the ancient Incan (neither the poor shlub victim, nor the willing participants who thought that they were doing the right thing in order to please their Gods).
It's comforting to imagine that our "innate sense of right and wrong" has some sort of objective backing, maybe in physics (or metaphysics), but you really can't escape your culture - you can only project your experience from your own perspective, and imagine alternatives.
Can you imagine what some future culture/society will think of us in 1500 years or so? Are you certain that your "innate sense of right and wrong" is the last word?
Posted by: freelunch | November 18, 2009 3:48 PM
Go find a couple of toddlers playing with each other who end up in a tiff and tell me about their innate sense of right (me) and wrong (you). Acculturation is very important to humans. Our innate sense is pretty badly out of whack even if there is something there.
Posted by: octopod | November 18, 2009 3:48 PM
That Hitler quote is from Mein Kampf, Chapter XI: "Race and People", right at the beginning. It's a pretty astonishing chapter -- he seems to have read and misunderstood Darwin, in that he has forgotten about the idea of descent with modification, and of variation.
Just in case anyone didn't want to step in the Hitler next time they wanted to cite that. I sacrifice the cleanliness of my browser history for you, people. (In fact, I had to look up some Nazi medical crap yesterday too. Is it in the air right now or something?)
Posted by: DemetriusOfPharos | November 18, 2009 3:48 PM
Regarding the letter BDC posted @ #7 by Olson about scouts - would it surprise 'Dr.' Olson to learn that the majority of my scout leaders were women? All heterosexual to, btw - or at least all were married to men.
For that matter, the vast majority of my teachers have also been (presumably) heterosexual women. Why then, 'Dr.' Olson, should I not be suspicious of their motives? They were, after all, in a position of authority over me , much like a scout leader would be; their main job being to teach me about a specific subject, much like a scout leader; finally, much like gay men are attracted to other gay men, these women were attracted to men.
All of this, of course, ignores the obvious logic fallacy that being attracted to an adult of either gender means you are attracted to their under-age counterparts, but then logic doesn't exactly matter to a creationist.
Posted by: Scott Ramoth
|
November 18, 2009 3:50 PM
hmmm. My corporate firewall blocked rossolson.org as pornography
Posted by: Kel, OM | November 18, 2009 3:52 PM
lol, he serious?Posted by: theshortearedowl | November 18, 2009 3:56 PM
"Junkome" - awesome!
Posted by: Mandrake | November 18, 2009 3:59 PM
Dear Dr. Ross:
Heterosexual males are, in fact, eligible to become Girl Scout Troop leaders. I even know of one (not myself) in our GS Service Unit. I'm the camping coordinator for my daughters' Brownie and Juniors troops. I went to the required training and even went camping with 11 women as part of the certification! Yes, there are various requirements to have adult females present in various situations, but GSUSA encourages men are encouraged to be part of their daughters' scouting experiences.
Happy camping!
Mandrake
Posted by: Rev. BigDumbChimp | November 18, 2009 3:59 PM
That's because he has a section on how EEEEEEBIL!! it is.
Posted by: Nebula99 | November 18, 2009 4:00 PM
@Rev. BigDumbChimp and David Estlund: If Olson thinks people shouldn't be around children of the gender they're attracted to, then:
1) presumably his ideal family is made up of a pair of gay men with adopted daughter(s), or a pair of lesbians with adopted son(s), and
2) He thinks everyone is a pedophile. As one proverb (IDK source) says, "A theif thinks everyone steals." Not that I'm implying anything...
Posted by: Anubis Bloodsin the third
|
November 18, 2009 4:03 PM
I wonder if the IDiots will invite Bergman to tow their ideological ark again in front of an audience?
Not that they have a lot of choice methinks, sacrificial lambs are hard to come by!
Posted by: jose | November 18, 2009 4:05 PM
"Hitler wanted to improve race"
People have been practicing animal breeding for millenia. Darwin himself learned a lot from pigeon breeders. As for human breeding, spartans did it (and I don't think they were inspired by Darwin). I mean everyone had known how to improve a particular race of animal since forever! Darwin explained what this practice was based on and extrapolated it to natural history, but he didn't invent the concept of breed or race. So I can't quite make out any significant relation between Darwin and race improving.
Posted by: daveau
|
November 18, 2009 4:07 PM
@52 (& 32)
It is "sod". And it is "sun streaking cold". And, furthermore, I don't believe that "sun streaking cold" directly follows "you poor old sod, you see it's only me."
Just sayin'.
Posted by: Gus Snarp | November 18, 2009 4:10 PM
You know what I really like about the whole "the only "the only morality that can come out of evolution" gambit (other than the fact that PZ said morality comes from culture, not from evolution) is that it implies that we expect the theory of evolution to have anything at all to say about morality. The theory of evolution is concerned with how things work, not with how people should behave.
Posted by: Peter G | November 18, 2009 4:14 PM
@44 That's why I always make a point, when attending rock concerts, of staying out of the Moche pit.
Posted by: sinned34 | November 18, 2009 4:15 PM
I'd love to see if I could find Ross Olsen's Christian testimony. I'll wager that the conversion to Christianity happened well before he "discovered" the Magical Evidence that disproved evolution.
Posted by: Mandrake | November 18, 2009 4:21 PM
myself@66: Read and edit before you submit, you dolt! Sheesh.
Posted by: Sherman | November 18, 2009 4:22 PM
@60
I don't think that's necessarily a fair argument- part of the process of growing up involves, for lack of a more concise term, acquiring empathy.
Children are born horrendously selfish beings- but they grow out of it. For ethical reasons, I'm sure there are no studies backing up what I'm saying, but the "Golden Rule" applies to most people at some level.
Posted by: Gus Snarp | November 18, 2009 4:27 PM
So since this guy believes he is entitled to a response to his questions, even though they weren't part of the debate, I wonder if he plans to release publicly and openly the results of his surveys? I for one would love to have the raw data on that.
Posted by: 'Tis Himself, Quel Dommage
|
November 18, 2009 4:29 PM
Another creationist fucktard whining about tone.
Posted by: SteveM | November 18, 2009 4:33 PM
No, it is fair, because he is refuting the idea of an inate sense of right and wrong. What you describe is learned behavior, not inate.
Posted by: Joe Bleau | November 18, 2009 4:34 PM
Don't underestimate the old "Teh Gheys can't reproduce, so the only way that they can grow their ranks is by recruiting your children" trope.
Posted by: Joe Bleau | November 18, 2009 4:36 PM
Erm, @80 was intended to respond to Nebula99 @68...
Posted by: Somnolent Aphid
|
November 18, 2009 4:39 PM
compels the various species to keep within the definite limits of their own life-forms when propagating and multiplying their kind, which completely explains why the dog humps my leg.
Posted by: Somnolent Aphid
|
November 18, 2009 4:42 PM
wow, if you call hitler a hitler, there's like a poe squared effect that takes place, right?
Posted by: SplendidMonkey
|
November 18, 2009 4:48 PM
"From goo to you by way of the zoo."
I submit:
"From Adam to you by way of (about) 150 jews."
That sounds totally reasonable!
Posted by: kopd | November 18, 2009 4:49 PM
@80
It is funny how many things they have completely backwards. Like believing that everybody is born with knowledge about God, rather than coming to believe in it later - but homosexuals aren't born homosexuals, that's a decision they made later. How they can be absolutely wrong about absolutely everything all the time and still think they have a monopoly on Truth is fascinating.
Posted by: Alyson Miers
|
November 18, 2009 4:50 PM
Doc Ross is so funny with his "I'm too important to read your blog" shtick while he's asking you to run a friendlier blog for creationists and get us piranhas to stop swarming.
Right. What he doesn't realize is that the piranhas don't only eat strangers. Sometimes we use each other as chew toys, too. But I suppose Ross wouldn't know that; he can't very well sift through all that chaff when he's got letters to write to the editor about how grown men can't be trusted around children.
Posted by: Doo Shabag | November 18, 2009 4:51 PM
"absence of evidence for the existence of elves"
Blasphemy! Haven't you ever read The Lord of the Rings? What more evidence do you need, it is written in a BOOK?!
Posted by: FastLane | November 18, 2009 4:51 PM
Fish....barrel....shot.
I'd say our work here is done. (Even though I was late to the party.)
Posted by: Jafafa Hots | November 18, 2009 4:55 PM
When cdesign proponentsists continually restate questions and criticisms that have already been answered discarded scores of times, I wonder if it's simple dishonesty, or if they may actually not be recognizing the answers?
Like a toad's brain triggered only by the movement of flies, could it be that they're programmed to only see "of course! I see it now, I'm saved! Praise Jesus!" as a response or answer, and anything else simply doesn't register at all?
Posted by: Joe Bleau | November 18, 2009 4:56 PM
SteveM @79 wrote:
"What you describe is learned behavior, not inate [sic]."
I'm not sure that's obvious - empathy could certainly be an innate characteristic that merely shows up later in the development process (in fact, a quick and dirty grep o' The Google suggest that there has been some research that supports the notion that empathy has a genetic basis).
In any event, though, I think that "empathy" and "sense of right and wrong" are hardly synonymous. Empathy is really just the ability to project your own sense of consciousness onto another - to put oneself into someone else's mindspace, so to speak. I suspect that it's a necessary, but hardly sufficient, component of moral judgments.
Posted by: Thinker | November 18, 2009 4:57 PM
Considering churches are hierarchical organizations based on fear, offering "protection" from harm of you and your loved ones, but demanding subservience and money in return, does it matter if your culture was a church or the mob?
Posted by: Qwerty
|
November 18, 2009 4:59 PM
Rev BDC - Wow! Your post on Olson's description of porn now makes me see the light on why he hates Darwinism.
If his son or daughter are taught evolution at the local academy; then, who knows where this evil idea may lead them. They may become another....
Hitler!
Ahhhhhh!!!!!!
Posted by: Feynmaniac | November 18, 2009 5:02 PM
Well if anyone ever deserved the comics sans + grumpy in their quotes I guess it would be Hitler.
Posted by: Joe Bleau | November 18, 2009 5:04 PM
Thinker @91:
And let's not forget about the gambling rackets...
Posted by: kopd | November 18, 2009 5:06 PM
PRATT
I'm ashamed that I used to be a YEC. In my defense, I was young and brainwashed.
Posted by: David Estlund | November 18, 2009 5:07 PM
@SteveM #79
I'm not sure it's appropriate to categorize it out-of-hand as learned behavior. Children are not fully developed human beings, physically or mentally. Not even teenagers have a fully developed frontal cortex, which is responsible for self-control (and thus morality). One doesn't "learn" to have an adult brain. Where our innate sense of ethical behavior ends and imposed cultural morality begins is an interesting and very complex issue, but as people like Ross Olson so enjoy reminding us, the latter often easily trumps the former.
Posted by: Steve | November 18, 2009 5:13 PM
If anyone wants to pound creationists who are pissing on the "new finch species" story, check out:
http://str.typepad.com/weblog/2009/11/birth-of-a-new-species.html
Posted by: David Marjanović, OM | November 18, 2009 5:13 PM
I do think there's innate empathy.
Of course that's not precisely the same thing, but it's close enough most of the time.
Steve M: in-nate, from Latin natus/-a/-um "born". Simply "inborn", "in" as in "inbuilt".
Posted by: Bog Disco Palin | November 18, 2009 5:14 PM
Nazism was so obviously a religion that it still baffles me that it is not widely acknowledged as such.
I guess that would make believers look a iittle more closely at the astonishing crimes committed by their own lunatic genocidal godheads.
And nobody wants that...
Posted by: NoAstronomer | November 18, 2009 5:14 PM
"...a truly interactive [academic] blog would..."
FAIL. There's no such thing. No blog is truly interactive.
Posted by: Bog Disco Palin | November 18, 2009 5:24 PM
@ 92
"Rev BDC - Wow! Your post on Olson's description of porn now makes me see the light on why he hates Darwinism.
If his son or daughter are taught evolution at the local academy; then, who knows where this evil idea may lead them. They may become another....
Hitler!"
Or, apparently even worse, John Holmes.
Posted by: SteveM | November 18, 2009 5:26 PM
David M@98:
That is how I was using the word (even if I did misspell it).
Posted by: David Marjanović, OM | November 18, 2009 5:32 PM
Hey, great! Now I have a one-word response to just about all cdesign proponentsist talking points! :-)
Posted by: David Marjanović, OM | November 18, 2009 5:34 PM
I tried to explain how it's spelled, and why it's spelled the way it is.
Posted by: Tim Butler | November 18, 2009 5:37 PM
Nice work with the blade, Dr. Myers. Especially with his Hitler bullshit. I bet you carve your Thanksgiving turkey with a Freddie Krueger glove.
Posted by: lose_the_woo
|
November 18, 2009 5:41 PM
Thanx for PRATT kopd - learned something new.
Posted by: Chris Phillips | November 18, 2009 5:44 PM
Dear Dr Myers.
How do you find the time, energy and persistence to cope with the creationist BS that comes your way?
I could not even think of doing it as a week would probably have me in an asylum for the "tired and emotional"!
Thank you for your blog. It is a daily delight for me.
Chris Phillips
Milton Keynes
UK
Posted by: SteveM | November 18, 2009 5:44 PM
re 104:
Okay, thanks. I admit to carelessness, I am usually more careful about proofreading and correct spelling. I do appreciate the etymology, it will help me remember the correct spelling in the future.
Posted by: darvolution proponentsist | November 18, 2009 5:45 PM
Reality Bites
Posted by: Coel | November 18, 2009 5:45 PM
PZ gave a good quote from Mein Kampf, but it is worth pointing out that the whole of that book, and the whole of the justification for the holocaust contained within it, is explicitly creationist and is incompatible with Darwinism. It is simply untrue that Hitler ever used Darwinism to justify the holocaust. Here are some quotes.
Essentially, Hitler regarded different races as God-created, with the Aryan race created supreme, but considered that the Aryan ideal was being corrupted. Hitler spends much time criticizing the churches for opposing each other rather than Jews:
Note that this is the *opposite* of Darwinian ideas, of mankind's *improvement* and ascent from apes. Instead it is a notion of a *previous* ideal, a created "fundamental" archetype, that is now subject to "racial decomposition" and "debasement".
Again, the notion of a *prior* ideal that "can no longer be replaced". It's the very opposite of Darwinism.
Note- again the concept of a *created* Aryan race as God's ideal. An ideal that is being corrupted.
Again the concept of debasement of God's Garden-of-Eden handiwork, the degeneration from a *prior* ideal. This is entirely the opposite of Darwinian ongoing improvement.
No comment needed!
Again the criticism of churches for not opposing Jews. "Atheist Marxist" is also code for Jews.
Note the concept of *primordial* race! I.e. Original creation by God of *separate* races, that are now being mixed by the sin of interracial marriage.
Again, *conservation* of an ideal, the very opposite of Darwinism.
This might superficially seem Darwinian. But it isn't, note the "eternal Will" (ie God), which is not in Darwinism. The idea here is that *God* created the races as seperate and UNequal, and placed one above the other. This was a standard idea in Christendom pre-Darwin. It was used to justify slavery, and apartheid South Africa (the Dutch Reformed Church there believed exactly that).
Excusing what might be seen as unethical (oppressing Jews) by appeal to higher ethics!
Note that, rather than *improvement* *to* an Aryan super-race, Hitler is worried about degeneration *from* a *past* Aryan ideal.
Ditto.
Ditto. Again note the Aryans as past *founders*, and the conservation ("custodians") of a past ideal.
The "expulsion from paradise" again being the idea of a lost ideal: an Aryan race God-created in it's ideal form as God's ideal handiwork, originally created for the Garden of Eden. That's entirely the opposite of a Darwinian ascent from apes.
Lastly, Hitler advocates celibacy of "lesser" non-Aryan people. He thinks they could be induced to accept this.
Note the revealling "truly original sin" -- that is, the destruction of the past ideal of the Aryan race in the Garden of Eden. And the concept that it is *Aryans* who were made in God's image.
Posted by: Bog Disco Palin | November 18, 2009 5:50 PM
PRATT--never heard that one before. Nice one.
However, I think RationalWiki screws up big time in its series of definitive PRATTs.
Religion is a direct cause of lawless behavior.
Countless murders have been committed in the name of God, Allah, Satan etc. with the believing murderer directly attributing their motivation to their deity.
I believe this is an example of different type of PRATT--Point Reinforced A Thousand Times.
Posted by: nigelTheBold, Minister of Spankings
|
November 18, 2009 5:52 PM
I would also like to point out that Hitler's POV of eugenics is based more firmly in livestock breeding than in evolution. This kind of breeding, while occurring for thousands of years, was formalized not by Darwin, but by Gregor Mendel, a priest.
Posted by: truth machine, OM | November 18, 2009 5:54 PM
"If your culture is the Mafia, you grow up with Mafia morality. Isn't that obvious? God doesn't step in and zap you with Buddhism, you know.
Is it really that obvious?
It should be.
What about our innate sense of right and wrong? Agreed that there's some malleability about it, but to put it down as all culture?
You're projecting; PZ didn't say it's all culture or anything like that. Mafia and Buddhist morality aren't disjoint -- the overlap of all human moralities would be what's innate.
Posted by: SteveM | November 18, 2009 6:02 PM
Re David Estlund @96:
I agree and it is just the nature of these relatively short comments that made it look like I was dismissing it out-of-hand. Well, maybe I am dismissing it out of hand, so let me rephrase it instead of "you're wrong...", to "I disagree". I think that the concept of "right and wrong" is acquired rather than innate. That acquisition could either be taught by others or derived by reason. Somewhat like our ability to speak is apparently innate, but no particular language is. And just as acquiring language occurs without being explicitely taught but by just existing in a speaking society, so too the sense of right and wrong can be acquired just be existing in a society. I think I just ending up arguing that it is innate after all (at least in a way similar to language).
Posted by: Rrr | November 18, 2009 6:03 PM
@110:
So, lemme get this straight: Adolf, being the supreme Aryan, would then be suggesting he be the perfect, spitting (well, ok) image of God? That means that God is a short, ill-tempered, incestuous vegan syphilitic corporal with a rap sheet and indigestion? Oh, and also an increasing propensity for astrology and genocide. I guess I may have missed a few characteristics, but I must say it does suggest an impressive likeness.
In that case, God is dead by multiple suicide.
Or maybe there is something wrong with all these images. It sure feels that way.
Posted by: SteveM | November 18, 2009 6:06 PM
I think that was a typo, should have been;
Religion is a direct cause of lawfull behavior.
At least, both should be on the list of PRATTs.
Posted by: David Estlund | November 18, 2009 6:14 PM
Re SteveM @114
"Right and wrong" are empathy-driven outgrowths of "good and bad" or "pleasurable and painful," which are most definitely innate characteristics. The interesting question is how much is a natural part of physical development, how much is learned through experience, and how much is typically implanted through cultural memes. I think the answer depends on the individual. My opinion is that those with the least actual experience and the most exposure to a (usually religious) meme set are often the least prone to mature/ethical/moral behavior.
Posted by: truth machine, OM | November 18, 2009 6:15 PM
Empathy is really just the ability to project your own sense of consciousness onto another - to put oneself into someone else's mindspace, so to speak. I suspect that it's a necessary, but hardly sufficient, component of moral judgments.
It's not a necessary component of moral judgments since people lacking in empathy make moral judgments -- e.g., "it's wrong not to do what I want". People without empathy can even make the sort of moral judgments that people with empathy make, as a result of learning that they will be treated well if they do: "People will do what I want if I say it's wrong to hurt people and puppies".
Posted by: raven | November 18, 2009 6:16 PM
Hitler was a Catholic and a creationist.
Some honest xians have addressed this in the past, at least telling the truth.
Some Jews have addressed this too. They are sick and tired of being massacred by xians.
The fundie death cults just do what they always do, lie.
BTW, the Jews don't buy the Darwindidit lie. Evoutionary biology and evolutionary biologists are found in most Israeli universities. Either they are planning the next holocaust or trying to make a better world. One of their projects is evolving salt tolerant plants for a dry and water short environment. You decide which.
Posted by: raven | November 18, 2009 6:22 PM
The fundie god, Yahweh was according to them, the inventer of genocide. Genocide is at the heart of the OT.
Where are the Moabites, Canaanites, Philistines, Amelakites and many other desert tribes?
If you read the bible, they were all genocided on god's orders with god's help.
Hitler just borrowed from the bible and claimed he was carrying out god's and Martin Luther's plans.
The mass murder is so pervasive in the bible that all churches do their best to hide and censor that information. The RCC resisted translating the bible in modern languages on the basis that the fewer who read latin and greek the better.
Posted by: Anubis Bloodsin the third
|
November 18, 2009 6:24 PM
#110 Coel
That post should be distributed to every creationist nest in the USA to every ID clone to every TV pundit, every pastor, priest and minister that ever uttered that sick and sensationalist meme of Darwinism inspired Nazi atrocity and it should be not so gently shoved firmly up in a place where the sun shineth not and that god cannot reach and only e-coli can find.
Now that would be true revelation for the tards!
Posted by: Bog Disco Palin | November 18, 2009 6:24 PM
@ 116
"Religion is a direct cause of lawfull behavior.
At least, both should be on the list of PRATTs."
They are.
I'd be curious to hear your explanation why "Religion is a direct cause of lawless behavior" should be on this list.
Religious motivation can conclusively be shown to be the direct cause of the murder of abortion providers alone.
Not to mention the catalogue of horrific crimes described in the bible itself, including but not limited to genocide, murder, rape, arson, slavery, kidnapping, theft, incest, and prostitution.
How could this possibly be a PRATT?
Posted by: plumberbob | November 18, 2009 6:25 PM
@ Rev. BigDumbChimp #7, #47,
As a pediatrician Dr Olson is treating either little girls, or little boys, or both. It looks as if, since Dr Olson brought up this subject, that he might be under suspicion on all fronts.
Posted by: Brownian, Most Vicious & Petty of Pharyngulites
|
November 18, 2009 6:28 PM
Don't be. I used to be a Catholic. An altarboy, even.
In my defense, I was young and wanted to get laid.
Posted by: SteveM | November 18, 2009 6:29 PM
David E@117:
Well, we certainly agree there. I contend that it is the very nature of religion to prevent the mature development of ethical/moral behavior, in favor of maintaining a childlike dependence on authority to define (impose) morality.
Posted by: ianadams.wordpress.com
|
November 18, 2009 6:36 PM
One of the most clear and well-known examples I've found to use for this argument is Down's Syndrome, which is caused by a trisomy of chromosome 21. Normally humans have 2 copies of chromosome 21, but Down's Syndrome is caused by an extra (third) chromosome 21. It's extra information that's been added to the genome of someone who has it.
Posted by: Anubis Bloodsin the third
|
November 18, 2009 6:53 PM
What are the odds of a religious retard being a fully paid up member of the Nonces'R'Us legion of the damned?
Though the stupid is pretty strong in this particular one it does seem to rule out
the suspicion of some sort of sexual dysfunction.
I mean surely not...I did not suspect him of closet Catholicism?
Nah! methinks not... it is far from clear that he would know what his dangly bit was for anyway seeing as he is a little unclear about evolution and the point of it and all that.
Has he a view on peeing I wonder?
Posted by: F
|
November 18, 2009 6:59 PM
If you liked PRATT, best to go with PRAT, then, seeing as we are on a spelling kick.
Posted by: kopd | November 18, 2009 7:04 PM
I just learned about PRATT this week, so it was pretty fresh in my mind when I read this post. It is nice to have a succinct way to describe such a thing.
In regards to: "Religion is a direct cause of lawless behavior."
Not all religions are the same. While Abrahamic religions do glorify violence and have many commands that are contrary to modern morality, others (such as Jainism) do not. Religion, in and of itself, is not sufficient for lawless behavior. But as pointed out, religion is not necessary or sufficient for lawful behavior, either. That one is definitely a pratt.
Posted by: F
|
November 18, 2009 7:04 PM
Never mind, I now see the later posts, and have identified the hyperlink. I thought the capitalization was for emphasis, I didn't recognize the acronymicity.
Posted by: kopd | November 18, 2009 7:11 PM
Brownian said:
"In my defense, I was young and wanted to get laid."
I am so glad I wasn't drinking anything when I read that. I like this keyboard. :-D
Posted by: 386sx | November 18, 2009 7:12 PM
Dr. Myers, when you do answer my questions, which you refer to as "creationist fallacies," could I ask you to send a copy to my e-mail address? I do not have the time to sift through the chaff of the Blog to find the occasional grains of wheat.
Doesn't make sense. All you have to do is read the article.
Those of us coming from a Christian perspective know that we are told to love our enemies.
Oh. I guess the phony remark up there about wheat and chaff where you pretend you don't know that all you have to do is read the article must have been a "love snark".
Posted by: Sastra
|
November 18, 2009 7:16 PM
Unfortunately, I mislaid my Atheist Moral Directive and accidentally wound up taking my morals from the Theory of Gravity, instead of the Theory of Evolution. Now I have to keep throwing people out of windows, because things are supposed to fall.
They don't much like it, and it's hard work -- but it's the Law.
Posted by: nigelTheBold, Minister of Spankings
|
November 18, 2009 7:17 PM
@Sastra,
I think I love you.
Posted by: RamziD | November 18, 2009 7:18 PM
What kind of d-bag uses 90% of a debate introduction to talk about himself and his qualifications rather than those of the actual debaters?
Posted by: kopd | November 18, 2009 7:19 PM
Sastra:
Thank you for that. I never thought of it. The next time somebody tells me that evolution leads to Social Darwinism, I'm telling them that Relativity leads to defenestration.
Posted by: 386sx | November 18, 2009 7:19 PM
Love this part... nothing like admitting you're a sniveling coward who doesn't have the strength enough of his own convictions to bring an argument to a forum of people with the actual credentials to debate it on its merits.
Nah. He's just pretending like he doesn't have time to check and see if one of the most popular blogs in the history of the universe wrote an article about him.
Posted by: Vene
|
November 18, 2009 7:21 PM
"May I ask you what you have published in peer-reviewed journals? Or in edited journals? I find many references to your blog entries."
I see somebody is too stupid to do a simple GoogleScholar search.
Plenty of examples here.
Posted by: 386sx | November 18, 2009 7:23 PM
I do not have the time to sift through the chaff of the Blog to find the occasional grains of wheat.
Thank you for another "dog ate my homework" moment...
Posted by: lose_the_woo
|
November 18, 2009 7:24 PM
Clearly one who needs more practice at becoming a master-debater. One would think that by his age and background it would be second nature.
Posted by: gorunnova
|
November 18, 2009 7:27 PM
"Junk DNA"? I prefer to call it "historical curious DNA". :D
Of course, even then it still underlines the fact that such DNA is proof of gradual evolution, whether the DNA is 'historically curious' or pure junk. ^^
'Send a list of creationist fallacies'? I can't believe that guy doesn't know about talkorigins, and instead is too lazy / myopic / *insert pejorative here* to get off his butt and test his own beliefs to see if they're actually, well, total bovine fecal material.
Posted by: 386sx | November 18, 2009 7:27 PM
"May I ask you what you have published in peer-reviewed journals? Or in edited journals? I find many references to your blog entries."
I see somebody is too stupid to do a simple GoogleScholar search.
"Dog ate my homework" ...
Posted by: Silič O'Nopolitanopoulos, Färschdbischuf Beesknees aus Ulm und Klein Elguth, Elector Pharynguline.
|
November 18, 2009 7:28 PM
They really should stop whining about all DNA being functional, since that's such an eminently testable hypothesis. The fact that they haven't done anything to demonstrate the claim makes it so all to easy to show that they're not interested in what is true.
Posted by: Pryce | November 18, 2009 7:28 PM
Why are so many godbots, like our friend Mr. Olsen, so damn passive-aggressive? I wish someone would do a study on it.
I fucking hate passive aggressive behavior.
Posted by: Glen Davidson | November 18, 2009 7:32 PM
I don't, I am merely saddened by it, like (passive-agressive fuck) Casey Luskin is with my attacks on his dishonest propaganda.
Glen D
http://tinyurl.com/mxaa3p
Posted by: 386sx | November 18, 2009 7:32 PM
May I ask you what you have published in peer-reviewed journals? Or in edited journals? I find many references to your blog entries.
Sorry, but there is just not enough time for wheat and chaff! Or something! Good luck...
Posted by: Kel, OM | November 18, 2009 7:33 PM
It seems that my merest suggestion that it's not all culture has people gnashing proverbial teeth at me. And yeah, it's obvious projection but that's what I see as the implication of such question. "What if our culture was the mafia?" It's like asking "what if our culture involved eating babies?" I can see what the question is trying to imply - it's trying to destroy any sense of shared humanity by making morality simply a product of human culture and thus an unsustainable position.Posted by: tim Rowledge
|
November 18, 2009 7:35 PM
To those claiming evidence of 'intelligent design' I have just one word: balls.
In particular, eyeballs and testicles.
If there is supposed to be this great skilled designer who is responsible for our design, I'd like to know why he (of course, it has to be a he, doesn't it) decided to do such a crappy job in both cases.
Eyes(human, to keep it particular, let's leave out the 36 other types) have the sensors at the back of the retina, reducing sensitivity. The nerve bundle gathers up and and causes a blind spot, not in some sensible (intelligent, even) place but right in the middle of our field of vision. The retina is not properly attached and can come adrift. Retinal cells fail and stop responding to light properly. The lenses harden and prevent proper focussing - and often have the wrong profile ab initio. They also cloud up and cause cataracts. They're not even adequately sensitive at their best. They are poorly provided with oxygen and waste removal. They have inadequate protection from atmospheric conditions. All in all, a close to failing grade for any deity, whoops 'Intelligent Designer'.
Testicles. Well, what can I say. Putting such sensitive items in such an exposed place, yet with so many pain receptors... the st00p1d, it burns. There's so much more I'm sure others here can add but demonstrating the IDiocy is just too boring to keep my attention going any longer
Posted by: Suck Poppet
|
November 18, 2009 7:38 PM
Ugh, same old boring creotard arguments over and over.
On the bright side, we could have an entertaining game of Creationist Argument Bingo
Posted by: 386sx | November 18, 2009 7:40 PM
I do not have the time to sift through the chaff of the Blog to find the occasional grains of wheat.
I'm surprised he didn't use the royal "We", since he is royalty, apparently. (Sorry, but this gentleman really cracks me up with all the "dog ate my homework" denialist mentality. Funny stuff!)
Posted by: 'Tis Himself, Quel Dommage
|
November 18, 2009 8:13 PM
Fellow Pharyngulites, you are missing the big picture. Dr. Olson does not want his ideas and comments to be attacked, piranha style, by the riffraff who infest this blog. He wants a simple discussion, biologist to physician, on some basic points of cdesign proponentsism compared to evilution. Yet the piranha in chief, His Myerness, has cast poor Dr. Olson's arguments to the howling masses polluting the blog. There have since been about 150 posts denegrating Dr. Olson and his arguments. Have we no shame?
No.
Posted by: James Brown
|
November 18, 2009 8:20 PM
My favorite quote disproving Darwin came from a Mormon true believer Bruce McConkie.
"If death has always prevailed in the world, there was no fall of Adam which brought death to all forms of life. If Adam did not fall, there is no need for an atonement. If there was no atonement, there is no salvation, no resurrection, no eternal life, nothing in all of the glorious promises that the Lord has given us. If there is no salvation, there is no God. The fall affects man, all forms of life, and the earth itself. The atonement affects man, all forms of life, and the earth itself."
So since evolution demands death 'before the garden' there is no God (works for me)
Posted by: mothra | November 18, 2009 8:22 PM
#60 said "Children are born horrendously selfish beings- but they grow out of it. For ethical reasons, I'm sure there are no studies backing up what I'm saying, but the "Golden Rule" applies to most people at some level."
Ultimately neither the Golden Rule nor the Silver Rule)is enough. At the very least one must ask 'Is this what the other person wants, rather than acting on 'what you would want if you were that other person?' The 'rules' fall prey to projection.
Posted by: Nerd of Redhead, OM
|
November 18, 2009 8:23 PM
Shame? What shame? That belongs to the IDiots/creobots who are afraid to discuss the science, and instead, try to play the aggrieved party. That shows their mental midgetry.Posted by: mothra | November 18, 2009 8:26 PM
@ Tis himself- Piranhas howl?? (mixed metaphor) /mothra swims away
Posted by: Lee Picton
|
November 18, 2009 8:39 PM
Children may indeed have an innate sense of empathy, but it needs to be triggered by the behavior of others. It was startling, and touching when the spawn, as a child of three, would cover me up when I fell asleep in my chair. That didn't come out of nowhere; it is reasonable to assume that he liked being tucked in at night and extrapolated that to "Mommy would like tucking in, too."
Yet, one day I caught him poking the cat in the eye (and I know it wasn't malice, only curiousity). I immediately poked him in the eye and he screamed. Object lesson which I explained - our kitty was an animal capable of feeling pain just like he did. He was five at the time, but made the connection immediately, and never again caused an animal pain. He has become an entirely satisfactory adult, besides.
Posted by: MaryLynne | November 18, 2009 9:00 PM
@76 - Sherman
"Children are born horrendously selfish beings- but they grow out of it."
Well, children grow out of it by way of culture. It's mostly done so automatically by consistently good enough parents that it seems automatic somehow, but it is certainly not.
The stories of children who grow up with wolves or locked in a room by abusive parents - they don't develop human characteristics like language, much less empathy or morals. Empathy especially doesn't really develop by modeling or consequences, but by a child establishing a bond with an adult. Even if her physical needs are taken care of and she survives childhood, if no adult tunes in to meet certain emotional needs or those bonds are disrupted early, often and severely enough, the child will be unable to form emotional relationships ever. She will be "selfish" because she has no understanding of other people's needs. (This is usually with really severe neglect and abuse - even really poor parents often somehow provide enough attachment for the kids to grow up functional).
We've probably all seen a toddler offer someone their blankie when they see them crying, but that is not some innate morality. That toddler had his needs met over and over and over and developed empathy from that.
I'm a special education early childhood educator, so this is something I'm familiar with.
Posted by: jj | November 18, 2009 9:38 PM
@Tim 148,
I always use teeth as an example. Who ever designed my teeth was an idiot. Wisdom teeth? Why have them grow in sideways? Why is it that I am outliving how long my teeth would naturally last me (I have highly acidic saliva according to my dentist, so I'm extra screwed)
Posted by: Hypatia's Daughter | November 18, 2009 9:56 PM
#42 Greg Laden
Except that PZ didn't look better because he was "better prepared". He looked better because he actually used real science! When these poor creotards go to these debates thinking their side will present real solid scientific evidence for creationism, they are bound to be disappointed because the evilutionists present science and their side has none.
(Of course, those who don't go for the science but to see Darwin get a whuppin' come away happier...)
Posted by: SteveL
|
November 18, 2009 11:06 PM
Then your culture would be piously Catholic (unless you're Russian).Posted by: Marcus Ranum | November 18, 2009 11:30 PM
Dr. Olson does not want his ideas and comments to be attacked, piranha style, by the riffraff who infest this blog
Then he ought to challenge someone knowledgeable in evolution and the art of debate, lube up, and publicly take it as served. I recommend he challenge PZ, but that's only because I'm a nihilist who enjoys watching weak people get hurt.
Posted by: efrique | November 18, 2009 11:46 PM
I've read Mein Kampf, and so far I've read about half of Darwin's The Origin of Species (I recently read where he talks about vestigial organs - and PZ is correct; he doesn't say they're without function).
Both authors just don't say what the creationists claim they said. Even when the odd creationist does quote Darwin they'll munge together two parts several paragraphs (or even many pages) apart, omitting the part in between that explains why they're completely wrong.
Darwin is overall pretty clear and readable. Deception appears to be the only reason creationists would have for misrepresenting him. (Hitler on the other hand is dull, dull, dull. Vapid, awful, miserable and dull. Don't bother unless you really have a pressing need.)
Posted by: Uncle Glenny
|
November 19, 2009 12:24 AM
The piranhas howl
as Pharyngula beckons
Mothra swims away
Posted by: David Estlund | November 19, 2009 12:35 AM
Thank you, Uncle Glenny. I've never seen a thread better summarized, and as haiku at that. You're my nightcap.
Posted by: Snoof | November 19, 2009 12:42 AM
I knew a guy who lived by "Do as you would be done by." We hated him.
I wonder what happened to Bob the Masochist?
Posted by: Glazius | November 19, 2009 1:07 AM
Here I thought the entire point of Darwin's finches was that they WERE all finches.
On the mainland you have the various ecological niches inhabited by various clades of birds, finches only one part among them.
And then on these islands, everything's finches.
Why, it's almost as if the observed physiological differences between organisms don't actually translate into segregated ranges of biological function!
But that's crazy talk.
Posted by: DingoJack
|
November 19, 2009 1:14 AM
Lee Picton - "He has become an entirely satisfactory adult, besides." Well apart for the distressing habit of poking people in the eyeball that is*. :)
Unclr Glenny - you forgot to add the last line "And all on Christmas day, HEY!"
Yours in silliness, Dingo.
----------------
* Picton Minor hasn't been hanging out with Snoof's 'friend', Bob the Masochist, by any chance?
Posted by: David Estlund | November 19, 2009 1:17 AM
Glazius @#166,
I'm not sure I understand whether you're being sarcastic or actually implying what you seem to be. For one thing, finches are pretty much irrelevant to this conversation, but as mentioned earlier, a discussion can be found here: http://str.typepad.com/weblog/2009/11/birth-of-a-new-species.html
As to whether "observed physiological differences between organisms actually translate into segregated ranges of biological function," I ask for A. Clarification and B. Evidence. I think "A" is more important, as your argument does not (at midnight) make sense.
Posted by: TGD7365 | November 19, 2009 1:20 AM
Wow, talk about a guy with some real insecurities...apparently the primordial ooze your ancestors developed from weren't able to remove the corn cob from their nether-regions and it remains there today. PZ, in your typical pompus and condescending tone,your response to Ross Olson missed the mark...get mean??, you only managed to demonstrate how uttery misguided you truly are. How dare you be asked to clarify some of your assertions?? Rather than having any abiliy to carry on a rational discussion and exchange of ideas, you revert to the pathetic strategy of leveling personal attacks on the questioner. I'll bet you're a blast to have as a so-called professor in class!
I'm sorry, PZ, but as much as you would like me to believe that "science" has all the rational answers concerning the origins of life, the evidence just doesn't support it. Way too many gaps, inconsistancies and leaps of faith for my blood. You see, I too come from an educactional background that has a very strong background in the sciences. And yes, like a lot of your students, I played the game and wrote the answers the professor wanted to hear to pump up their fragile egos, in order to pass the class. Yep, BS'd my way all the way to a Doctorate degree with narrow-minded professors just like you, all the while marveling at what low standards some of our institutions of "higher learning" have for hiring staff. I came to the conclusion that it must help if you're intelligent, but you obviously don't have to be smart.
I can only hope that someday, I can have the same level of "faith" that you do where I can "believe" that our universe originated from a speck the size of the tip of a pin that had so much energy that it exploded and littered the galaxy with cosmic debris that out of pure chance and luck happened to collide with one another and form the first elements that over gazillions of years organized itself into a simple single celled organism that miraculously (oops, scratch that)...that randomly evolved into a muti-cellular organism that over another gazillion years adapted and mutated and killed and endured and dominated and did that over and over and over again until that one, single, simple cell (that was purely chance in the first place) evolved into every known past, present and future species ever documented or imagined. Wow, to be that "enlightened" ... for now, though, you can stick to your "religion" and I'll stick to mine. I don't have enough "faith" to believe in yours!
Posted by: sng | November 19, 2009 1:25 AM
Kel,
Morality and eating babies?
http://robinhanson.typepad.com/files/three-worlds-collide.pdf
Posted by: ckitching
|
November 19, 2009 1:29 AM
"We were convinced that the people needs and requires this faith. We have therefore undertaken the fight against the atheistic movement, and that not merely with a few theoretical declarations: we have stamped it out."
Adolf Hitler, in a speech delivered in Berlin, October 24, 1933; from Norman H. Baynes, ed., The Speeches of Adolf Hitler, April 1922-August 1939. Vol. 1. Oxford: Oxford University Press, 1942, p. 378.
Why must we continue to beat this dead horse? Hitler's religion may not have been pure Christianity, but it certainly wasn't atheistic. Eugenics didn't require atheism, evolution or even a modern view of genetics. The understanding that an offspring tends to have many of the characteristics of its parents would have been obvious to almost anyone and was used in domestication of plants and animals long before we isolated genes and DNA. This was also the (flawed) rationale behind having royalty only marry other royals.
I wish they'd stop using Hitler. At least for Stalin and Mao there is some evidence that atheism was part of their policies in some way. I still wouldn't accept that this was the reason that they killed so many people (nearly all were killed for more pragmatic reasons - they got in the way or posed a challenge to their power).
Posted by: David Estlund | November 19, 2009 1:34 AM
TGD7365, @#169
I hope your educactional background serves you well in future. I have actually avoided graduate school because I have worked for people with Ph.D.'s who embarrassed me, the organization I worked for, and the university system itself on a regular basis with their anti-knowledge, absurd, doctrinaire views. I really hope PZed serves you something awful. The more I see people in respectable institutions of learning who are willing to stand up for true reason and sound learning, the more I regret my decision. And that is a regret I am grateful for.
Posted by: Rey Fox | November 19, 2009 1:45 AM
"Rather than having any abiliy to carry on a rational discussion and exchange of ideas, you revert to the pathetic strategy of leveling personal attacks on the questioner."
You...clearly didn't read a single word of this post. How can you be so proud of being so willingly ignorant, so anti-knowledge?
"How dare you be asked to clarify some of your assertions??"
Pearls before swine, dude.
Posted by: DingoJack
|
November 19, 2009 2:03 AM
TGD7365 - "[Evolutionary? science has w]ay too many gaps, [sic] inconsistancies and leaps of faith for my blood."
As opposed to hugely internally consistent, logical, fulsome alternatives, right?
"... that our universe originated from a speck the size of the tip of a pin that had so much energy that it exploded and littered the galaxy with cosmic debris that out of pure chance and luck happened to collide with one another and form the first elements ..."
Firstly, cosmology and biology are separate disciplines. you do know that right? Secondly, 'A tip of a pin'? No doubt several gazillion angels were dancing on it. There is nothing in cosmology that can determine how big the universe was when it formed. It could have been a Planck length [1.616252(81)×10^−35 meters, much smaller than any pin tip] , or it could have been several parsecs, there's no way (at the moment) to tell. Thirdly, it didn't 'explode' (gunpowder explodes) it inflated, and it could have only done so if the net initial energy of the universe was zero. Fourthly, The first elements were formed only minutes after the 'Big Bang', not gazillion of years (actually the universe in only 13.72 Billion years old), further elements were added over time. This happened because of physics, no miracles required.
"... over gazillions of years organized itself into a simple single celled organism that miraculously (oops, scratch that)...that randomly evolved into a [sic] muti-cellular organism that over another gazillion years adapted and mutated and killed and endured and dominated and did that over and over and over again until that one, single, simple cell (that was purely chance in the first place) evolved into every known past, present and future species ever documented or imagined."
Firstly, gazillions should be around 700 Million years, in this case. Again the assembling of Amino Acids is simply physics and chemistry, no miracle required. Secondly, gazillions again! Ever heard of a thesaurus? Actually, in this case, around 3.8 Billion years of evolution. Thirdly, 'or imagined'? What you think that if you imagine something the universe has to create it? Kind of 'if you think it, it will come'? What colossal arrogance!
And last but not least:
Evolution is not believed, it is proved, and our knowledge follows only the evidence. You? - DJ
Posted by: Jadehawk, OM
|
November 19, 2009 2:08 AM
I find your parenting methods intriguing.Posted by: F
|
November 19, 2009 2:32 AM
Where did PZ's response miss the mark? I think he hit the mark spot-on, even though it was very hard to find, as no actual argument was brought forth for ID in the first place. PZ, among many others, get tired of having to respond to the same inane drivel repeatedly. The facts are already out there. Again, ID brings no real argument or facts to back up its position, and dismisses all the answers given. So I can't blame PZ or others if they get a bit cranky.
So, where is your reasoned argument? I see that all you have is personal attacks (pot, kettle), and those are none too clever at that.
As to being "misguided", that would be you. Scientists and rational people aren't so much guided, they figure these things out for themselves.
I can't applaud Dingo Jack enough for responding to your version of cosmogeny, as I wouldn't even know where to begin telling you what is wrong with it.
Posted by: DingoJack
|
November 19, 2009 3:01 AM
TGD7365 - see PRATT* - DJ
-----
*Thanks to kopd.
Posted by: Richard Eis | November 19, 2009 6:02 AM
I don't know what TGD7365 was doing with his life, but it sure doesn't sound like science.
Posted by: Mark | November 19, 2009 6:51 AM
I had no idea you knew so much about Hiter's influences by Chamberlain. However, don't forget Arthur de Gobineau's influence, or the fact that his work of scientific racism "An Essay on the Inequality of Races" actually came out four years before On the Origin of Species.
Posted by: Rev. BigDumbChimp | November 19, 2009 7:50 AM
I notice no where in your long rambling post you refuted anything PZ posted about the science of the matter nor did you offer any alternative (with support of course).
Evolution is supported just fine.
Tell me something about it not supported. Not hand-waving grand proclamations, pick something specific about it and then tell me why it is wrong.
Posted by: Lukas | November 19, 2009 7:58 AM
I think there's a pretty simple answer to the idea that evolution is a cause for genocide. Genocides and similar atrocities are committed by people who are convinced that they know the absolute truth, and thus must act on that truth.
Few scientists, on the other hand, would claim that they know the absolute truth about anything (except, perhaps, for mathematicians :-).
Posted by: Nerd of Redhead, OM
|
November 19, 2009 8:06 AM
What discussion? Discussion implies equal theories. There is science, with facts, and a million or so scientific papers supporting evolution, directly and indirectly, or a bald faced assertion without any evidence. Evidence wins the day every time. There is no evidence for ID, there is no evidence for a designer. But that doesn't stop liars from trying to proclaim there is evidence. Funny how they never put that evidence into the scientific literature.Ooh, an attempt at authority. Never mind PZ has a PhD in biology, and several of us responding to you also have terminal degrees in their scientific fields. We trump you on the authority every time, as we do real science.There is no faith about evolution, and to say so shows you have no understanding of the evidence for it. Evolution is a fact. If it isn't, there is a Nobel prize waiting for you, but you must provide the evidence to the scientific literature, and provide a non-supernatural alternative theory that explains all the evidence already collected better than the ToE. We await your evidence in journals like Science and Nature.You don't have enough intelligence to understand the ToE, or the evidence behind it. You have to have faith in your theory since your deity doesn't exist.Posted by: Cosmic Teapot | November 19, 2009 8:07 AM
The Darwin to Hitler trope is disproven simply by reading the words of Hitler.
Anyone who proposes this argument is therefore less honest than Hitler.
_____________<;,><_____________
Hitler is more trustworthy than Ross Olson.
Posted by: Anri
|
November 19, 2009 8:17 AM
Um... this guy does know that 'finch' is a term of convenience, created by humans to more easily categorize a near-continuum of small birds. No one with this much time in school (regardless of relative qulaity) could seriously argue that there exists some Platonicly Ideal Uber-finch, to which all of finchdom must needs cleave... right?
(whimpers)... right?
Posted by: Aufwuch | November 19, 2009 8:26 AM
Oh Happy Monkey. I am the retired professor Ross mentioned. I sent him several emails and may have mocked him after he responded with...a...a...still not really sure. He must be lonely in his world to bring up little ol' me. Now I feel like Steve Martin's character in the "Jerk" when he finds his name in the new phone book..."I'm finally somebody!" Don't go away mad Ross just go away.
"Thee retired biology prof"
Posted by: Ryan | November 19, 2009 8:41 AM
You don't believe in Elves - next you'll be telling me Santa isn't real. Oh the horror of it all... That's it I'm outta here.
Posted by: Michael Le Page | November 19, 2009 9:04 AM
There is a simple way to show that evolution can add information:
"The list of examples could go on and on, but consider this. Most mutations can be reversed by subsequent mutations - a DNA base can be turned from an A to a G and then back to an A again, for instance. In fact, reverse mutation or "reversion" is common. For any mutation that results in a loss of information, logically, the reverse mutation must result in its gain. So the claim that mutations destroy information but cannot create it not only defies the evidence, it also defies logic."
Posted by: kopd | November 19, 2009 9:13 AM
His background has a background. I just can't compete with that.
Posted by: Hypatia's Daughter | November 19, 2009 9:16 AM
#169 TGD7365
You, my dear sir (is that polite enough for you?) make the same error that Ross Olson does. You treat a broad based (i.e. multi-disciplinary) ToE as though it was an "assertion" by only one man. If you really want to know about the "assertions" of the ToE, why don't you make an effort to study it instead of expecting PZ to do all the work for you or to defend it as though he was pushing a personal belief (lke aliens live in the center of the earth?)If you really want to learn the science behind evolution, then go to the library and the internet and read the journals, papers and books produced by evolutionary scientists.
That, BTW, is what all anti-Darwinists claim they have done. Well, Gee, if you have studied evolution in a science based setting, enough to conclude it is wrong, why do you not know that debates amongst individuals in church basements and books by lawyers sold in Christian bookstores are NOT how science is done? Why do all those so well-informed about the ToE to know it is wrong ALWAYS get their facts about the ToE wrong when they discuss it? Why do all discussions by you so-well educated sciency types get bogged down by the need to explain the most basic facts of science and the ToE? PZ writes a popular blog of opinion, hosting the opinions of a bunch of rabble rousers - but none of them mistake Pharyngula for a professional scientific outlet. None of them even mistake it for one of the more scientfically serious websites & blogs. That Olsen could even write: is a hilarious admission that the poor man has no clue when where or how real science is done. (And why Pharyngultes can't help but poke fun at him, rude though that may be)
Posted by: AJ Milne OM
|
November 19, 2009 9:29 AM
His 'educactional' background, even. I for one, am awed.
(/Well, that's what everyone says about me, anyway... Or, at least, I think that's what they're saying... But you know how it goes with transatlantic vowels and revealed homonyms.)
Posted by: No BS | November 19, 2009 9:51 AM
Guess who wrote this:
"The folkish-minded man, in particular, has the sacred duty, each in his own denomination, of making people stop just talking superficially of God's will, and actually fulfill God's will, and not let God's word be desecrated. For God's will gave men their form, their essence and their abilities. Anyone who destroys His work is declaring war on the Lord's creation, the divine will."
Posted by: David Marjanović, OM | November 19, 2009 9:54 AM
TGD7365, you don't have a very strong background in the sciences, and neither does your background. Exhibit A: you still don't know that the universe contains more than one galaxy. Exhibit B: you still don't know that the Big Bang was an "explosion" of spacetime itself with the matter in it, not an explosion of matter into an already existing space. Exhibit C: anything you write about evolution.
You're a textbook example of the Dunning-Kruger effect: you don't know shit, and you don't even know that you don't know shit.
I bet you can't even explain the scientific method.
Posted by: Rey Fox | November 19, 2009 10:19 AM
"Um... this guy does know that 'finch' is a term of convenience, created by humans to more easily categorize a near-continuum of small birds."
Come on. If he was capable of thinking outside of rigid categories and hierarchies (i.e., boxes), then he wouldn't be a creationist.
Posted by: TonyC | November 19, 2009 10:24 AM
regarding the original post(!) and the comments about junk DNA being 'useless'.
From a purely survivalist stance doesn't junk DNA afford some protection against random transcription errors due to environment (radiation damage, etc).
This is probably completely specious (and should maybe be asked on Good Math/Bad math) and depends entirely on how frequently (and where) mutations occur.
If the mutation happens in junk DNA - we generally would see no effect. It might have the effect of creating a 'working sequence' but probably extremely rarely(?)
If the mutation happens in 'coding' DNA, we'd see an effect - good/bad/indifferent (lots of sequences can suffert 'point changes' without affecting the transcription effect - AFAIR)
So -- assuming there is a lot more junk than good - and assuming a constant mutagenic rate, we can posit that if you only had good DNA, you'd be getting hit with functional mutations in every case. the presence of JUNK acts like a safety vest -- as a sacrificial donor to mutation events, with the effect that the good DNA sees a much smaller number of mutation events per period.
There would also be similar benefits (for a similar reason) for transcription errors -- the likelihood of an error occurring is constant -- the likelihood of the error occurring in good DNA is much lower due to the presence of the junk due to their relative abundance (much more junk than good).
I'd really appreciate input on this.
Posted by: David Estlund | November 19, 2009 10:34 AM
TonyC @194,
I'm not a geneticist, but I don't see how the presence (or number) of other genes, whether functional or nonfunctional, would affect the likelihood of a mutation on a given gene. It's sort of the reverse of saying that buying a lot of lottery tickets increases the odds of winning the lottery.
Posted by: qbsmd
|
November 19, 2009 10:44 AM
I assume you're not advocating dishonesty, but simply overwhelming them with points. Perhaps the most effective use of such a tactic would be to preemptively call them out on their likely tactics, i.e.:
Creationists have no understanding of science, philosophy or history. Unfortunately the creationists who have become accomplished debaters have learned to parrot enough sciency-sounding buzzwords to sound credible to non-scientifically literate audiences. However, for this tactic to work, they must avoid at all costs any type of elaboration or deeper analysis of any one of their points, and compensate by spewing forth as many buzzwords and half formed arguments as possible. One examples is "information". If a creationist brings up anything about information, wait to hear them define the concept, and you will wait forever. Creationists will also make the claim that evidence supports "micro-evolution" but not "macro-evolution", which intelligent people compare to believing someone can walk across a room, but not walk an entire block. They have this bizarre, stupid idea that evolution requires an organism to produce an offspring that is of a different species (or genera, etc.).
When a creationist debaters come up against the full force of science, and realizes their arguments are doomed, they often retreat to critisizing the tone of the scientist. After some of the extremely offensive things they'll say about defenders of science, they demonstrate great hypocrisy and thinness of skin by whining that the relatively tame, inoffensive (and true) critiques are "uncivil", and ignore the actual content of arguments, in the hope that everyone will forget the point.
Finally, I hate to Godwin an argument, but Hitler was a Catholic creationist, so we have to consider the horrible results that can occur as a result of allowing religious dogma to influence scientific policies at a national level. Of course, how you feel about the implications of a theory have nothing to do with the truth of that theory, but you'll never meet a creationist capable of comprehending that point.
Posted by: Ewan R | November 19, 2009 10:47 AM
It should be pretty obvious to anyone with half a brain that 'junk' DNA was actually put there by god to trick scientists into thinking they could find links between species and whatnot thus ensuring themselves of an eternity of damnation and hellfire.
Possibly not quite so obvious to anyone with a full brain though...
Posted by: David Marjanović, OM | November 19, 2009 10:58 AM
No, because:
1) You're assuming a constant mutation rate per genome. You should rather assume a constant mutation rate per million bases. More DNA, more mutations.
2) The Onion Test has been mentioned. Your idea fails it.
You carry about 18,500 genes of your own around, but 34,000 retrovirus genes in all stages of decay. Those make up a major part of the junk.
Posted by: qbsmd
|
November 19, 2009 10:59 AM
TonyC,
"assuming a constant mutagenic rate"
I assume you mean constant per genome, not constant per base pair. I would question which of those would be more accurate. For mutations caused by radiation or free radicals, more base pairs would mean more surface area to catch radiation\ collide with radicals, so more mutations would occur in a larger genome.
I think it has more to do with duplication of genes: if a gene is duplicated, you can get a mutation in one of the copies and not lose the function. Sometimes the mutations that accumulate in a copy make it do something new and useful, and sometimes it just degrades into junk.
Posted by: David Marjanović, OM | November 19, 2009 11:04 AM
Most of the time, actually. 10 % of our genome consists of identifiable pseudogenes = former genes that have mutated too much to work anymore.
Posted by: Pseudogene | November 19, 2009 11:09 AM
Thanks for the new moniker.
"Pseuduogene"
Posted by: G.Shelley | November 19, 2009 11:12 AM
I think you made a mistake in your attempt to refute the "no new information argument", in that you argued against a different type of information to what the Creationists mean. Something of a straw man really. Most will concede they don't mean information in a mathematical sense, or in the sense of different DNA or protein sequences. Or in the sense of changed, increased or even novel functions of genes. They mean it a magical "Mutation can't produce it" sense.
Posted by: Richard Eis | November 19, 2009 11:38 AM
Well it makes a change from cycling around the different meanings (none of which they understand) with a pair of goal posts strapped to their backs I suppose.
Posted by: qbsmd
|
November 19, 2009 11:38 AM
Someone a while ago pointed out that creationist use of both scientific and legal terms resembles Harry Potter-like magic words more than anything else. I don't think they mean it in any sense; they just hope the words will magically make the person who understands science agree with them.
Posted by: Thuktun | November 19, 2009 12:03 PM
"Of course evolution adds information: it's a process driven by random variation of a string of information, with subsequent filtering to find viable and more fit variants. My children are not identical to my wife and myself; they contain novel combinations of genes and many new mutations."
It may be worth noting that the variety of human religion around the globe is due to evolution as well, just not biological. In each new generation, there are random variations in specific aspects of religious beliefs, though beliefs can also propagate sideways within a population in ways that DNA may not strictly be able to do. One could create a hierarchical taxonomy of religions in much the same way we can analyze the species of biological forms on the planet.
This might be something worth drawing attention to, because surely creationists could understand it and have a hard time claiming that it all sprang into being last Thursday.
Posted by: abb3w
|
November 19, 2009 12:20 PM
TGD7365: [WHARRGARBL]
I'd give it a 6.3/10.
I'll also repeat my usual note, that I reserve "faith" to refer to primary premises, taken as valid without prior, as opposed to taken as inference from whatever priors. While science does take some points on "faith" in this sense, nothing in that ramble touched on them; all that was about the inferences, not the ultimate premises.
What you lack is not faith, but understanding — comprehension of how those ultimate premises allow others to reach the conclusion via inference. You thus presume the conclusion ("belief") must be a primary premise ("faith"), when it isn't.
qbsmd: they just hope the words will magically make the person who understands science agree with them
There's more than a little resemblance between some creationist approaches and a heap injection attack on the human brain.
Posted by: SteveM | November 19, 2009 12:23 PM
Re Thukton @205;
It may be worth noting that the variety of human religion around the globe is due to evolution as well, just not biological.
The same could be done (and is done) with language, but I am afraid it would just be refuted as examples of evolution through intelligent design. Which it is. The debate is not so much about whether things evolve, but the mechanism of evolution.
Posted by: Rev. BigDumbChimp | November 19, 2009 12:30 PM
Shorter TGD7365
Posted by: gr8hands | November 19, 2009 12:37 PM
"Doctor" Olson, if you would simply go to Google and type in
You would get 31,800 results. The first one is an insulting comment. The second and third ones are on the Nature Network, which apparently requires you to be logged in to get information, and it appears PZ hasn't submitted data to them. The fourth one is another screed. The fifth one is about PZ and Dawkins.But the sixth one -- appearing on the very first page of doing a search on 'PZ Myers publications' -- is this: http://zfin.org/cgi-bin/webdriver?MIval=aa-persview.apg&OID=ZDB-PERS-960805-655
Wow! A listing of some of PZ Myers' publications. How ever did doctor Olson manage to pass his classes with such pathetic research skills? I weep for his patients.
Posted by: David Estlund | November 19, 2009 1:01 PM
gr8hands, Google has a search engine specifically for scholarly publications: http://scholar.google.com/
Posted by: darvolution proponentsist | November 19, 2009 1:02 PM
Thukton@205
Here's something along those lines ... Religion Family Tree
It's more entertaining than useful for what you stated above but I thought you'd appreciate it. In particular if you happen to be a Rush fan.
(no, not that Rush, silly right wingers)
Posted by: truthspeaker
|
November 19, 2009 1:03 PM
SteveM, languages don't evolve because of intelligent design.
Posted by: CJO
|
November 19, 2009 1:20 PM
beliefs can also propagate sideways within a population in ways that DNA may not strictly be able to do.
And that's one reason why you wouldn't actually be able to order religions into a nested heirarchy the way you can with biological taxons. There is no single common ancestor of all religions, for one thing. For another, cultural concepts like "religion" can never be as strictly defined as "living organism" can, so you'd always be making basically arbitrary decisions about the boundaries of your heirarchy.
Also, to agree with truthspeaker, languages do evolve, and they do it "on their own," not as a result of conscious choice on the part of their speakers, though enough agency contributes to language change (new coinages, borrowings) that I guess you could make a case that, in practice, it's always a combination. But in principle, even if you had a very static language among an isolated people, pronunciation would still shift along rules studied and well understood by historical linguists.
Posted by: darvolution proponentsist | November 19, 2009 1:20 PM
ummm .. that's Thuktun @205
My apologies for the misspelling. :-/
Posted by: Lee Picton
|
November 19, 2009 1:49 PM
Jadehawk
Hah! That was minor. He got a formal lesson on the use of the stove when I held his hand over the open flame, just close enough so he understood the concept. It was important he learned how to be safe in the kitchen and it interested him. So he never needed pretend tools. He was so proud of himself when he cooked a full steak dinner for the family when he was only six. He is still the grillmeister wherever he goes and has invented his own marinades.
Posted by: Doug Little
|
November 19, 2009 2:09 PM
I have a challenge for Jerry and Ross,
If indeed they were once atheist and now have been converted to Xianity because of some deficiency in evolutionary theory could they please explain in detail on what that deficiency is and the chain of logic and evidence that then led them from evolution to creationism. Furthermore if they have found such a deficiency why haven't they as scientists written a paper about it so that they can let the rest of the scientific community assess their idea's, chain of evidence and conclusions.
That's the thing isn't it, you want ID to be part of science right? So you know... do some actual science and present it to the scientific community for peer review, like any other scientist does.
Than
Posted by: gr8hands | November 19, 2009 2:34 PM
David Estlund, thank you for politely pointing out the additional resource. I am already aware of it, but as it appears doctor Olson is terribly confused by Google and the whole "research" process, I wanted to keep my instructions as simple as possible.
When dealing with people like TGD7365, who claims their academic background has a background in science (which makes everyone deduce they are a total moron and merely lying about their education), I try to refrain from having any complicated instructions.
But you were right to point out a more accurate and more complete online resource. Thank you!!
Posted by: TonyC | November 19, 2009 2:47 PM
RE: Junk DNA
thanks -- I knew there was epic fail in there. I appreciate your kindness is pointing it out.
I was aware (vaguely) of the Onion test... but my thought was that even though the junk conferred no obvious 'coding' advantage, perhaps it allowed some slight advantage otherwise (against environmental agents that generated mutations based on relative concentration per base pair... so more base pairs, a lower effective concentration). think fail.
I do so enjoy learning. (If only there were a similar blog where MY expertise would be useful.... oh there is, but they're dull boring business consultingy things!)
Posted by: Doug Little
|
November 19, 2009 3:50 PM
My challenge also extends to TGD7365. Please sir will you choose a "hole" and be specific, citing where evolutionary theory is incorrect and the evidence that backs up your assertion.
Posted by: Glazius | November 19, 2009 4:11 PM
David @ 168:
Yes, that was sarcasm. I should be careful using it after midnight.
The entire significant aspect of Darwin's finches is that they demonstrated that the "finch" clade COULD fill more ecological niches than it currently DID.
(I'm sorry, should I be using 'clade'? Apparently Darwin's finches are actually all from the tanager family. So 'family', then?)
Apparently this was THE big deal at the time.
"Yes, they ARE all finches! And they're doing things we've never seen finches do before!
"But but but everything is crafted specially for its place in the world by God! Right? Right? So how can that happen?"
Paraphrased, of course.
Posted by: Sherman | November 19, 2009 4:12 PM
@146 MaryLynne
"Well, children grow out of it by way of culture. It's mostly done so automatically by consistently good enough parents that it seems automatic somehow, but it is certainly not."
While I can agree with this statement, I think I should point out post 114- while morals themselves, are not, at least not wholly, innate, there is an innate framework for them that all people have- empathy is a portion of this framework but the concept is lower than that, more deeply seated in the brain. And much more difficult to assign a label to.
"The stories of children who grow up with wolves or locked in a room by abusive parents - they don't develop human characteristics like language, much less empathy or morals."
But their ability to develop them was there, even if it is too late for the individual. And even if the ability to speak a meaningful language has been irrevocably lost, the ability to make noise exists. I think the same exists for the moral framework- even if we can't think "I shouldn't do that, it will hurt so and so's feelings." We should still have the moral equivalent of a grunt. These are the sorts of studies that, for obvious reasons, can't be conducted, so my hypothesis can never be confirmed, directly at least, but I think there is enough material to at least suggest that there's something to it.
Posted by: RVS | November 19, 2009 5:01 PM
Mr. Myers seems to have brought some good points in the debate, I would have loved to have witnessed this clash first hand.
Maybe this is caused by my limited understanding of the English language, English not being my first language, but the whole argument about if "Intelligent Design" should be taught in school or not seems obsolete to me.
It's the word "design" which pushes my buttons, because the Intelligent Design proponents' "intelligent agent" apparently designed some genetic traits at some point in time in some species (insert more vagueness here). However, this "intelligent agent" would have to materialize this design into the real world by some means of er... creation, right? The information contained in the design would have to have some way of coming into being (into the physical world). And that, I thought, is the definition of "to create".
Thus, the argument seems quite pointless to me, ID is just creationism. It's not science, so don't teach it as such.
Posted by: Rev. BigDumbChimp | November 19, 2009 5:08 PM
Pretty much nailed it there RVS.
Posted by: My Lord! | November 19, 2009 8:53 PM
"but there is no doubt that "Junk DNA' was clearly touted as evolutionary leftovers and delayed the search for function, which was predicted by Intelligent design."
ID predicted something? To predict something you have to have a theory based on observations. What was the hypothesis? No junk DNA because god would not create junk? If so, we can test that. How much junk DNA would an Idesigner put in? 0% 10% 25% 66.6%? I guess their response would be, you don't know its junk, it could have some function you do not understand yet; afterall, you cannot know the mind of god, er, aliens, er an unspecified intelligence...
Posted by: John Scanlon FCD | November 19, 2009 9:39 PM
Coel, thanks for documenting so fully the proof of Hitler's creationism and polygenism. Of course not all creationists are polygenists, but it was almost always the claim of the worst racists and defenders of slavery.
There are no evolutionary polygenists (except in Star Trek), and even most creationists (however deeply racist) have been monogenists; after all, Genesis is usually read as being consistent with Adam and Eve being ancestors of all humans.
This will be most useful any time the liars bring up the Darwin->Hitler claim again. "No way, he was definitely ONE OF YOURS."
Brownian:
By a priest? How did that work out for you?
(I sang in the church choir long past the end of my belief, with the same motive. Not a priest, an alto. And no, it didn't work out.)
Posted by: Rick R | November 19, 2009 9:46 PM
Too bad I wasn't raised catholic. I would've TOTALLY been on the make for Father O'Whisky after choir practice.
Of course, in my dreams, the good padre looks just like Gerard Butler. In real life, probably not so much.
Posted by: Ted Zissou | November 19, 2009 10:19 PM
I gotta wonder what the "powerful case" against evolution was. Presumably to this day, Ross still hasn't come across any evidence opposed to evolution.
Posted by: astrounit | November 20, 2009 12:11 AM
So Ross Olson is an aggravation as well as a LIAR.
Posted by: TGD7365 | November 20, 2009 1:48 AM
#188 Kopd
LOL...good one, got me there! ;) That's exactly why your lineage has survived as long as it has - it recognized threats along the way and knew when to fight and when to run!
This whole blog thing really amuses me. Many of you make some interesting comments and observations in your posts, however dare mention ID and you circle the wagons and draw the sword.
I had a son who attended PZ's recent debate at the U of M and thought I'd check into the site to see what he was all about. One thing lead to another and I landed in the blog section and began reading the posts. And yes, temptation did get the best of me and I thought I'd try posting a comment and stir up the pot a little bit.
You guys are hillarious! Really, what a colossal waste of time (and yes, I'm wasting mine right now by doing a second post). You really need to get a life and stop taking yourselves so seriously! The most amusing part of this personal experiment was the predictability of the responses to the post and all the challenges to produce "evidence" and "proof" for my viewpoint that supporting ID.
Let's face it, you are all most likely realatively intelligent people...your sentence structure is good, you use big words like "clade", and "pharyngultes" (and in the case of Mr. Marjanovic', the ultimate proof of a true intellectual, "s*#t"). Some of you can even do really impressive math like Dingo Jack...wow, a Planck length or a parsec, I had no idea! But I digress...the folks that frequent this site have likely heard every argument there is concerning ID, have weighed the evidence and made their choice. Those of us in the ID camp have also heard every argument there is concening evolution, and have made our choice. You think we're wrong, we think you're wrong. Life goes on and we can agree to disagree. Instead we can focus on really important things like not killing unborn babies, the whole man-made global warming hoax or our county's slide into Socialism.
...This should be fun!
Posted by: Satan | November 20, 2009 4:20 AM
Thank you for acknowledging that I am your master.
And you emulate Me as well. How nice.
Oh, I agree! If only everyone would stop caring about anything but amusement.
Please, continue to do My job for Me.
I approve of your lying boasts. Please, lie and boast some more.
I also approve of your very postmodern indifference to truth, much like Pontius Pilate.
Indeed.
Posted by: Richard Eis | November 20, 2009 4:46 AM
Oh look, some bait. Hanging from a tree. How nice (bats it out of the way)
Hang around a bit more. There's a long time before you keel over. You might want to learn some more stuff before then.
Posted by: John Morales | November 20, 2009 5:10 AM
TGD7365:
Aww. Sorry to hear of your loss.
Every argument there is?
Then perhaps you can adumbrate one such, and explain how it's problematic.
Posted by: Torrie | November 20, 2009 5:37 AM
"Also, a truly interactive academic blog would allow posting of the studies on the academic success of students exposed to both evolution and intelligent design."
Hahahaha, what stupid studies those would be. It's akin to the studies to see which ketchup runs the fastest.
Posted by: 386sx | November 20, 2009 5:48 AM
Torrie, I'm glad you could make sense out of that, because I sure don't know what the hell!
Posted by: Torrie | November 20, 2009 5:51 AM
Ya know, after reading this and after listening to Ray Comfort on some youtubes, I have come to the conclusion that the best way to attack and discredit creationism is to throw their disgusting bible verses at them and ask them to explain. Don't accept their explanations and throw more verses at them. Keep them on the defensive. Constantly quote their verses that contain rape, murder, animal and human sacrifice. Also, point out the contradicting verses. I mean they are always attacking evolution and we are always explaining it and and they never accept it. So, why don't we, instead of reciting Science that they can't understand anyway, just do exactly what they have been doing to us. Turn the tables. It's worth a shot.
Posted by: 386sx | November 20, 2009 6:05 AM
OK, I have studied the dialect and can try to speak broken "Blog-talk."
He doesn't have time for "wheat and chaff" type stuff, but for the study of the broken "Blog-talk" dialect, there is sufficient time for this very busy and important creationist.
Posted by: Richard Eis | November 20, 2009 6:06 AM
We should ask them why some christians believe one thing, and others believe another. All the christians can't be right so how are we poor athiests supposed to choose which is right?
...without evidence.
Posted by: Jadehawk, OM
|
November 20, 2009 6:36 AM
well, it doesn't work quite that way, but otherwise useless DNA can have other benefits. This is sort of how telomeres work: telomeres are really just a bunch of repetitive non-functional stuff attached to the end of chromosomes that does serve a purpose: a sort of "margin of error" for translation errors, so that when translation errors chop off the end of a chromosome, only useless crap gets chopped, rather than stuff that actually does something.Posted by: Nerd of Redhead, OM
|
November 20, 2009 7:04 AM
Then tell us which of the million or so scientific papers that support evolution, both directly and indirectly, are wrong. By not using philosophical sophistry, but real scientific data. You will need to cite the scientific literature while you do so.No sir, we know you are wrong, and you don't think. Beginning to see the pattern that you truly stopped using your brain?Posted by: Rev. BigDumbChimp | November 20, 2009 8:15 AM
First of all I call total bullshit on that. But giving you a little leeway on grand proclamations of your vast scientific knowledge, that statement is akin to taking a box to the busiest intersection in the city, standing on it in the middle of rush hour traffic and holding up a big sign that says
"I'm a gigantic dumb ass"
Please do as Nerd asks and point out specific scientific research supporting evolution that is wrong.
It's easy to say, "I don't like it so it's wrong", it's a different story when you have to refute the actual real science.
Go ahead, we can wait.
Posted by: David Estlund | November 20, 2009 9:26 AM
"Instead we can focus on really important things like not killing unborn babies, the whole man-made global warming hoax or our county's slide into Socialism."
Wow. They really do regress to spouting talking points when their arguments don't have a leg to stand on. Those who keep feeding these people's paranoid fantasies (churches and talk radio, I'm looking at you) ought to be prosecuted for the harm they do to the human mind.
Posted by: Christophe Thill | November 20, 2009 9:26 AM
One more comment about the mafia thing:
In the culture of the ancient Hebrews who wrote (and read) the Bible, there's no such thing as a notion of humankind. Their 10 commandments (don't kill, don't steal...) apply only within the limits of the community. Towards an outisder, you're not bound by the same rules. This allows you to go to Jericho and murder everyone with God's blessing.
Same thing with the Mafia. It has a rigorous morality for internal use (doesn't it call itself a family?). However, with outsiders, many things are allowed, the important aspect being rather not to get caught.
Posted by: Rey Fox | November 20, 2009 9:49 AM
"Let's face it, you are all most likely realatively intelligent people...your sentence structure is good, you use big words like "clade", and "pharyngultes" (and in the case of Mr. Marjanovic', the ultimate proof of a true intellectual, "s*#t")."
So, another intellectually lazy sod (complete with the "get a life" cop-out) with a phobia of naughty words and a bunch of right-wing paranoia. Like I said, pearls before swine.
Posted by: Steve_C | November 20, 2009 9:56 AM
Hey TDG,
It's not that we "think" you're wrong, we have the evidence that shows you ARE wrong. Apparently your superstition has gotten the better of you and you're willing to ignore the evidence.
It's not a matter of opinion it's a matter of what the facts show.
Posted by: David Estlund | November 20, 2009 10:55 AM
Torrie @#235:
Here is a pretty good model of how that conversation should go.
Posted by: abb3w
|
November 20, 2009 11:29 AM
Thuktun: In each new generation, there are random variations in specific aspects of religious beliefs, though beliefs can also propagate sideways within a population in ways that DNA may not strictly be able to do.
Strictly, DNA observably is able; Lateral transfer is commonplace in bacteria. It's not common in eukaryotes, but when was the last time history saw two sects of a religion having sex to produce a third?
Posted by: Middlekk | November 20, 2009 11:37 AM
@229...you say "Those of us in the ID camp have also heard every argument there is concerning evolution, and have made our choice."
Sadly, you mistake ARGUMENTS for EVIDENCE.
Posted by: Aratina Cage
|
November 20, 2009 12:17 PM
Lucky us! A fat turkey running in circles on our porch waiting for its head to be chopped off, with Thanksgiving just around the corner.*licks lips and gets out the chopping block and an axe to grind*
Posted by: Rev. BigDumbChimp | November 20, 2009 1:43 PM
It ain't cool being no jive turkey so close to Thanksgiving.
Posted by: Lynn Wilhelm
|
November 20, 2009 2:02 PM
@CJO #213
Yeah and when we attempt to "intelligently design" one,, we fail--like Esperanto! Weren't we supposed to be speaking that by now?
Posted by: Aratina Cage
|
November 20, 2009 2:21 PM
Christian's would have a much stronger argument for the USA being a Christian nation if they had listened to Ben Franklin and made the self-offering turkey (such as TGD7635) our national bird. Alas (for them), they chose a symbol of war and fierce independence (eagle) over one of sustenance, sacrifice, and peace (turkey). [Or maybe not :P]
<channeling id="Jerry Bergman"> Ah, but language is actually irreducibly complex! It had to happen all at once in a complete way, and the failure Esperanto demonstrates what happens when you try to substitute the magnificent complexity of real language with artificial words and syntax. There is no way language could have evolved in tiny pieces separately and then suddenly fit together unless it was designed that way and gifted to us by a super intelligence. When we try to create something as marvelous as language, it doesn't work. That means there must be a greater intelligence at play that favors humans. After all, you don't see monkeys speaking.</channeling>Posted by: SteveM | November 20, 2009 2:36 PM
re truthspeaker @212:
I didn't say they did. I said using language as an example of evolution would be refuted as an example of... Just as Dawkins' little evolution simulation program often is. I am not saying they are correct, just that they do (refute these examples as such).
Posted by: Rev. BigDumbChimp | November 20, 2009 2:46 PM
Well the Bald Eagle is an asshole. When I used to live out Lynna's way in the Tetons I would see Baldies wait until the much more skilled fisherbird (not a word I know, but so what) Osprey would grab a big fat trout out of the Snake River and the Eagle would swoop down / over etc.. and steal it (or try to)from the Osprey.
Bald eagles are glorified scavengers and "assholes". Yes I anthropomorphized that but it's in line with how everyone looks to them.
They may look majestic but they sure don't live up to the mystical notion of their majesty.
I mean they are beautiful but the image portrayed of them isn't really on target.
I still love seeing them in the wild.
Posted by: Rev. BigDumbChimp | November 20, 2009 2:49 PM
Yes that was a rambling off topic and somewhat unhinged rant.
Thank you
Posted by: SteveM | November 20, 2009 3:01 PM
of the Bald Eagle, Benjamin Franklin said,
Or as he was paraphrased in 1776, "The eagle is a scavenger, a thief and coward. A symbol of over ten centuries of European mischief."
Posted by: Alyson Miers | November 20, 2009 3:09 PM
I think that people on the whole don't want their languages to be intelligently designed. We don't want to communicate in something that's perfectly regular and modular. We want to speak languages with the idiosyncrasies of culture and absurdities of history burned into them. We learn the second/third/etc. languages that we learn, ultimately because real people use those languages in their real lives. We want to deal with crazy noun declensions, proliferating verb conjugations, and endlessly fiddly prepositions, because those things give languages their flavor and color. Esperanto may be easier to learn and use than Italian or French, for example, but where's the character? Where are the puns? The double entendres? We need the chance to have conversations like: "So, do you speak Albanian?" "No, we're speaking Japanese." (Yeah, I went there. I'm a bad person.)
Then again: isn't Esperanto mainly Latin-derived? It's not exactly a universal language if it comes predominantly from southern Europe. Maybe it didn't catch on because an awful lot of people felt left out.
Posted by: Cindy | November 23, 2009 5:26 PM
It took me all of 60 seconds to find a dozen of your publications, or maybe Nature is not a peer reviewed publication? The Zebra Fish has been very very good to you PZ.
Posted by: JT | November 24, 2009 9:22 PM
Very interesting post, but one thing struck out that is worth mentioning. I would caution against recommending T. Ryan Gregory as a source of "factual information." While he does provide some helpful explanations, oddly and unfortunately he also often misinterprets other people's equally helpful explanations.
Posted by: Ross Olson | November 25, 2009 7:40 PM
So my e-mail was "patronizing?" I was on my best behavior for e-mail. For a mud wrestler, Dr. Myers seems to have very thin skin.
Let's talk about the response regarding information:
Me: To be addressed is your claim that evolution adds information. That needs to be supported.
Myers: Of course evolution adds information: it's a process driven by random variation of a string of information, with subsequent filtering to find viable and more fit variants. My children are not identical to my wife and myself; they contain novel combinations of genes and many new mutations.
I'll add that development is also a process that adds information. The adult multi-cellular organism that is PZ Myers is a concentrated node of complex information of much greater volume than the fertilized single-celled zygote that my parents made in 1956. As individuals and as a species, we extract energy and information from our environment to increase our personal information content.
Me again:
You have not proved your point and misled your followers.
The difference between you and your children is due to recombination, not new information. And duplicating a gene, even though it requires perhaps one more bit to describe it, is not new information and does not support evolution.
The adult P. Z. Myers is the outworking of the information in the zygote P. Z. Myers, multiplied many times. In fact, I would venture to say that there has been a net loss of useful information, since the aging process includes many mutations which produce the diseases of aging including cancer. Those mutations you worship as part of your trinity along with time and natural selection, are not your friends and do not come up with new body plans needed to prove the tree of life. Speciation does not prove bacteria to biologist transformation.
Now there is one aspect that does have merit and is interesting. The production of memories stored in your brain as well as immunologic memory in lymphocytes do indeed represent increased information, but are of absolutely of no use to evolution because they are not genetically passed on to the next generation. (And even if you try to tell your kids anything you have learned, they instinctively discount anything a parent says at least 99%.)
And energy does not increase information. Raw energy degrades information. It is educational malpractice to say that because the earth is open to the sun, solar energy overcomes entropy. Compare a living plant in the sun (with its complex mechanism for capturing and storing energy) with a dead fish in the sun (which does NOT turn into something better.)
So again, I challenge you to come up with real scientific data, not Aristotelian arm chair philosophizing.
What have the Zebra fish done to support your contentions? It is ironic that you belittle Jerry Bergman as an insecure overachiever (sort of like the poor students accuse the good students of being brown noses). Your own publishing history is extremely narrow, yet you pontificate on nearly everything.
Posted by: bevo/devo | November 25, 2009 8:19 PM
Epic Fail. Say Olson, hows about going to the new thread inspired by your latest email and reading the nice essays explaining the answer to your challenge- the one that's been discredited time and again?
Posted by: Nerd of Redhead, OM
|
November 25, 2009 8:32 PM
Sorry sir, what needs to addressed is the scientific nature, or lack thereof, for ID. You have demonstrated no evidence that it is anything other than an religious idea. And disproving evolution in no way validates you idea.You have not proven your point, and you mislead people. ID is not scientific, or a viable theory, until you provide proof positive, such as conclusive physical evidence for your imaginary deity.Sorry, repeating lies doesn't make a truth. That is why you must show proof positive. We just point at the peer reviewed scientific literature, which are are purposely ignoring. Another lie.Another lie. They just keep on coming. Energy is required to reproduce and run the cell machinary. Ultimately, that energy comes from the sun. Which isn't running down any time soon.Compared to your lies and falsehoods? And your history? Hold up a mirror and take a good look at yourself. Compared to Prof. Myers, your flaws are enormous.If you don't like my tone, here's some advice. Shut up. I will mimic your tone.
Posted by: Kel, OM | November 25, 2009 8:48 PM
Mr Olson, would you be so kind as to answer the questions that have been repeatedly asked about the nature of ID as a scientific hypothesis? Why can't you answer such simple questions?
Posted by: Smoggy Batzrubble OM4Jesus | November 25, 2009 8:57 PM
Dear Mr Olson,
Don't let the atheists goad you into answering a question that would cast doubt on God's centrality in His creation. Their demand that you support ID with a shred of evidence is simply insulting. Verily, Jesus and all the angels will be singing your praises in Heaven this night.
Never should you feel forced to get down in the mud pit with all the real scientists! Next time they challenge you about it, just point to your brown nose and say you've already been there.
Yours from the trenches
Smoggy
Posted by: 386sx | November 25, 2009 9:18 PM
Wow, that's quite a coincidence that the only time information increases is when it is of absolutely no help to evolution!
Posted by: David Estlund | November 25, 2009 9:59 PM
"Speciation does not prove bacteria to biologist transformation." - Ross Olson
Wait, what? So you accept that speciation happens? But you don't accept that speciation can make life more complex? I'm going to have to file this under "not even wrong."
Posted by: JGjimi | November 25, 2009 10:09 PM
Mr. Olson
Have you honestly really even studied the subject matter of genetics? Gene duplication IS adding information to a chromosome. You seem to be just paroting creationist non sense.
Why don't you define some terms before continuing? I dare say that you will not for it will paint you into a corner and prevent you from shifting goal posts.
Start by defining "new information" as it relates to DNA. Do you honestly expect something other than A,C,G or T?
Posted by: David Estlund | November 25, 2009 10:21 PM
JGjimi: I don't think he expects anything but to win. The more he argues, the more he exposes the fact that he is impervious to both reason and evidence, that his views are religious and not scientific in nature, and that ID has absolutely no business being taught in the science classroom. It doesn't have any business being taught anywhere, but that's beside the point. Teach it in Sunday school if you want to turn children into Liars for Jesus, but don't expect it to help them understand biology.
Posted by: ckitching
|
November 25, 2009 10:30 PM
False dichotomy. Compare a live plant, fish or even bacteria in a sealed box which receives no input heat or radiation. It will quickly become completely lifeless. In your analogy, the fish may not become a more complex fish, but the exposure to energy input means that other life will spring from the corpse of the fish.Don't argue thermodynamics if you don't understand it. Evolution on earth can't violate the laws of thermodynamics so long as the earth receives energy from an outside source (the sun). Your example is like saying that birds violate the law of gravity because they fly.
Posted by: 386sx | November 25, 2009 10:31 PM
Why don't you define some terms before continuing?
That's easy.
information: that which evolution cannot add.
complexity: that which evolution cannot do.
That's pretty much what it amounts to! Sorry!
Posted by: Ross Olson | November 25, 2009 10:51 PM
I was talking to PZ, not you groupies.
By the way, ckitching, about 150 years ago Louis Pasteur disproved your hypothesis about new life springing from decaying meat. Each bacterium, which can certainly multiply in a piece of dead meat, is as complex as a city.
Airplanes don't violate the laws of thermodynamics or gravity, but they are not constructed without a plan and skill.
Posted by: llewelly | November 25, 2009 11:07 PM
Ross, would you please work on your contest entry in peace and quiet? Other students are trying to learn.
Posted by: Owlmirror | November 25, 2009 11:07 PM
Recombination, and about 100 new mutations each generations.
Why do you creationists never come up with any new arguments, but merely recombine old ones that have been refuted a thousand times?
Your ignorance of genetics and computer science is noted.
If development and growth is a "net loss of useful information", then "useful information" doesn't mean anything at all. Do fingers have "less information" than limb buds, and limb buds have "less information" than unformed endoderm, mesoderm, and ectoderm, which has "less information" than an undifferentiated blastula, which has "less information" than a just-fertilized egg?
Nice job shooting yourself in the foot.
Your pathetic and stupid false equivalence is so very, very insipid.
Your fallacious and obviously confused blathering is noted.
Why is your knowledge of biology so pathetically weak?
Because building up immunities and having memories do not aid in survival and reproduction?
It's a pity that you don't seem to be able to retain memories of your stupid arguments being refuted over and over and over and over again.
Ah! So in other words, religion -- passed on by word of mouth from parent to child -- is doomed.
Excellent. Glad to hear it.
Your fallacious and obviously confused blathering is noted.
Why is your knowledge of biophysics and chemistry so pathetically weak?
The truth is "educational malpractice"?
Your false equivalence is mind-bogglingly stupid.
The fish in the sun is obviously being turned into decay bacteria, which would not be able to metabolize if they were not warmed by the sun. You might not call the stinking thing "better", but a plant isn't something necessarily "better" either.
Especially if it's a poison ivy plant in a playground.
And your argument is even more ridiculous given that you just conceded that memories can form. How do think memories can form, if not ultimately from materials metabolized by way of energy from sunlight and perceptions that result from energy that ultimately comes from sunlight? Is it magic? Direct acts of God, in every single life-form? Something else?
I challenge you to come up with substantive arguments that do not stink of desperate fallacies like a fish in the sun.
What has your pathetic ignorance done to support your contentions?
He's not an overachiever. He's a fraud. Kind of like you.
No, like the the good students accuse cheaters of being cheaters.
More hypocritical sneering, especially after your ridiculous and pathetic demonstration of your ignorance of biology, chemistry, physics, the scientific method, and basic logic and reason, which you just posted above.
Posted by: Rick R | November 25, 2009 11:17 PM
Just look at Ross witnessing!! Praise jayzus that Ross is making all xians look dumb, slow, and thick as molasses in January!!
Posted by: Kel, OM | November 25, 2009 11:20 PM
Are the questions of those here baseless? Or is it simply you want PZed because he's PZed? So much for us being groupies, it seems you're the one with the PZed fascination. All I want is an ID advocate to explain the science of intelligent design. I keep asking, yet not a single ID advocate will tell me how ID works. Surely you (or any other ID advocate) can answer such a question without it needing to come from PZed.Posted by: AJ Milne OM
|
November 25, 2009 11:21 PM
The following demonstration is something yer average ten-year-old can do at home, just to underscore a few very simple facts here.
First, the demonstration: take the following string, save it to a file on your hard drive...
aagctgttgcacttattccgactggaatataccg
... now compress that file with a garden-variety file compression utility (gzip or winzip will do very nicely) and note the file size.
... now, take that same file (the input, not the compressed one) and double the contents. Like this:
aagctgttgcacttattccgactggaatataccgaagctgttgcacttattccgactggaatataccg
... and change a few of the letters, then delete a few of the letters, like this:
aagctgttgcgacttgtccgactggaatataccgaagctgttgcacttgtccgactggtatataccg
... then compress that again, using the same file compressor, and the same settings, and compare the size of the output file.
... you will note, of course, that the second compressed file is larger*.
And congratulations--that's it. That's the whole thing. Guess what you've demonstrated?
Here's the thing: most of the people reading this--hell, probably all--already know. I'd bet even the bullshitting asshat whose tedious, blathering email to PZ kicked off this thread already knows, too. But let's spell it out anyway. A tight noose is a good noose.
Winding our way toward it: the deflate compression technique at the heart of both gzip and Winzip is actually a pretty simple beast.
It uses two techniques to compress data. The first is the Lempel-Ziv algorithm, which just looks for repeated passages in the input and rewrites them more compactly as references to previous occurences. The second is a little less germane, here, but for the record, it's Huffman coding, in which, instead of encoding all symbols with the same size codes, encodes more common codes with smaller ones, less common with larger...
The point is: generic, lossless compression techniques basically reduce data partly by boiling out redundancy--in the case of those using Lempel-Ziv, it's relatively easy to see--but generally, this is what they all do, one way or another.
Which actually makes them reasonable, rough measures for the amount of information present in the input stream. If something compresses to a larger file size using the same general purpose technique (provided the technique actually can find the redundancy present, and in this case, it's fairly safe to assume it can, as that's exactly what those utilities are designed to do--take relatively small strings** of bits and find shorter ways to represent them), you may generally assume it contains more information.
... so, what you've just demonstrated is: mutations easily can increase the amount of information in a genome. One duplication, a few point mutations, and actually, they can make it increase with some speed.
... the other thing you probably already know is: any fucking moron can see this. Which leads us to our second conclusion derived from this experiment:
Any creationist who tries to claim they cannot see how this could occur, if they have the mental wherewithal, say, to clothe and feed themselves, are simply deliberately deceptive assholes. And they think the people reading them are incredibly stupid, besides.
Now: if you've ever talked to a creationist, you already know where they're going to try to go next. They're going to complain, whine, look for an out, probably which will be, in this case: but oh, those sequences don't contain the kind of information We mean. We mean meaningful sequences. Does that sequence encode a functional protein? No? Then you've proved nothing.'
The funny thing is--and much is funny about creationist arguments--and usually by this we mean 'has a funny smell'--is there actually is a strange, apparent contradiction in information theory which, if you weren't looking too closely, you might think the dissembling, weasly 'tard was referencing, and using to his advantage. And that is: yes, it is a bit annoying that by simple, otherwise uncontroversial Shannon methods referencing compressibility as a measure of information quantity, totally random sequences containing little of what a human brain would recognize as meaning do generally oddly measure as containing more information than more ordered ones of similar length constructed to contain information of some sort, insofar as they do require more bits to encode...
But this problem, as you can also probably see if you're not a fucking moron, has exactly no impact upon how this demonstration answers the creationist's objection. Because even tho' the sequences we just used were quasi-random (quasi, in that I just dumped 'em out as they came to me, and I'm probably as bad an RNG as most humans are), the mathematical result called for here (increased information), even if you let them move their portable goalposts and make it a more stringent requirement and say: we want those sequences to be somehow meaningful, and we want the second one to contain more meaning...
... well, amusingly, it doesn't matter how absurd they make their requirement, if you can actually get them to define it (good luck) to the point that there are two base sequences that meet it, you can still demonstrate simple genetic processes could easily get you there. But keeping this goalpost move to the next ten yards down the field (wouldn't want 'em to tire 'emselves out, the poor dears... it's must be tiring carrying around both the goalposts and bowels that incredibly full), letting them insist they want the first sequence to contain a functional gene, and the second to contain two related but different functional genes, well, fuck, yes, of course you can do that, too. They'd be larger sequences, larger changes, but you'd still get there from duplication and modification.
... And noting that shit gets duplicated in the genome all the time, and the genome happily carries around oodles of junk that's not doing anything, so the second gene doesn't even have to be working especially well or at all for much of this time, and remember that once it starts to do anything interesting, natural selection will take over and pick the ones that do better at whatever they happen to be doing... and well, hell, as if we need to recite the whole of the modern synthesis, here, but well, you get the drift***... Point is: it ain't no thang.
... So really, more to the point: this is an utterly nonsensical objection in the context, but then, the challenge is nonsensically stupid in the first place, so it isn't like they've really lowered themselves appreciably, I guess, by trying it on for size, from the pit of shit in which they're already wallowing. They don't care what the answer is--hell, they probably already know it--the point was: they were trying give the impression in their weasly, imprecise way that they hope will let them wiggle in more blather that there's some great mystery how you could even get more complicated things from simpler things using biological reproductive processes, and hope that the general naivete of a layman audience might let them get away with that. That's all.****
... But then, you know this now, too, effectively, presuming you have the faculties to turn on the computer you're reading this on. So really, we're done here. 'Tho I s'pose we have proved one more thing here, which we could note.
And whaddya suppose that is?
... Rhetorical question, of course. But then, I like to answer those, actually.
So, answering: we have also proved that Ross Olsen probably shouldn't sell used cars for a living.
(/And of course, you already knew that, too.)
*For the record: using a basic Unix gzip on those two strings, default options, you get 53 and 68 byte files, respectively.
** Deflate's Lempel-Ziv search window is 32 KB--that's to say if a repetition is less than 32 KB apart, it can encode it. Tho' it may not--depends on how hard you tell it to look, generally. So a redundancy further than this apart, provided there isn't another one between them providing a 'bridge', can't even be encoded, even if the implementation could find it.
**Yes, that was intentional. I'll get my coat.
****... and noting what a stupid piece of shit that 'challenge' is, think about this, too, by the way, and in the context of their insistence they want just to 'teach the weaknesses' in the theory. Do you really want lying asshats like this who'll try to imply something so trivially explained is such a great mystery anywhere *near* your kids' minds?
Posted by: Owlmirror | November 25, 2009 11:22 PM
Feel free to ignore us as you ignore all logic, reason, evidence, and fact.
ckitching's argument had nothing to do with abiogenesis, but with metabolism; the metabolism of the organisms digesting the dead flesh of the fish. Which Pasteur's experiments showed happened because spores of bacteria and fungi and mold are floating around everywhere.
Why can you not read?
And they multiply ultimately because of energy received from the sun, you moron. Which was the point of the comment you responded to.
Why can you not think?
Fat lot you know about it.
Posted by: ckitching
|
November 25, 2009 11:31 PM
Oh, my mistake. I didn't know your post was a private message only to be read and responded to by a single person. Next time you want to hold a private conversation with PZ, maybe you could do it... I don't know.... in private?Bacteria will reproduce and slowly metabolize the dead fish, producing waste that can in turn feed other life (plants). Without the energy input, the process stalls out very quickly. My apologies for assuming this was obvious.
Airplanes also don't carry around superfluous and nonfunctional or barely functional equipment inherited from less successful aircraft. I've never seen a DC-8 and 707 mate and give birth to a litter of MD-95s, have you?
Posted by: Rev. BigDumbChimp | November 25, 2009 11:34 PM
Ross
ugh.
I'm amused, at best, that you continue to push out these examples as something of worth.
Do you assume that entropy acts on individuals? I mean in reality entropy is about systems not tiny little parts.
Its the same mistake that creationist half-wits like yourself make with evolution.
Seriously this is back into grade school logic again. How can someone who's made it this far into adult hood (by age) be this obtuse?
Put down the bible, sober up from your faith buzz and try again.
When you've come out of your Jesus high answer this
What is the testable falsifiable Theory of Intelligent Design?
Posted by: 386sx | November 25, 2009 11:41 PM
I was talking to PZ, not you groupies.
Oop sorry about that. I think it was the 3rd person POV of the comment that maybe threw some people off. (Maybe try a email or something. Maybe have better luck with email.)
Posted by: David Estlund | November 25, 2009 11:46 PM
"Those mutations you worship as part of your trinity along with time and natural selection, are not your friends and do not come up with new body plans needed to prove the tree of life."
They're not a trinity we worship, they are elements of a method for logically explaining natural phenomena in a useful way. And of course they explain how "new body plans" arise. It's the only method for explaining them. ID only "explains" phenomena by injecting a god of the gaps, which is neither scientifically useful nor provable, and IC is only IC for any given example until we explore it using the scientific method. It's a shame that you don't understand how science works.
Posted by: David Estlund | November 25, 2009 11:49 PM
I forgot to add that perhaps you do understand how science works, but realize that if you actually applied it to your reasoning, it would all fall down. That, however, would make you a liar. So, until you give it up, you'll be stuck in Liar-for-Jesus ignorance/denial limbo.
Posted by: 386sx | November 25, 2009 11:54 PM
And energy does not increase information. Raw energy degrades information. It is educational malpractice to say that because the earth is open to the sun, solar energy overcomes entropy.
Look at all the simple ideas this guy has going on up there in his mind. So very simple...
Posted by: Janine, She Wolf Of Pharyngula, OM | November 25, 2009 11:57 PM
Compare a living plant in the sun (with its complex mechanism for capturing and storing energy) with a dead fish in the sun (which does NOT turn into something better.)
You might as well be saying that one cannot add 2.7 and 6.3 because they are not whole numbers.
All of the energy that the fish used and all of the stored energy in the dead fish ultimately was supplied by the sun.
Posted by: Rev. BigDumbChimp | November 25, 2009 11:59 PM
I mean, UGH.
I'm sitting here amazed that someone who can operate a computer, help organize a debate and breathe can make arguments like this.
Posted by: Nerd of Redhead, OM
|
November 26, 2009 12:01 AM
When you post here, you are talking to us. If you don't want to talk to us, use e-mail to PZ. And just stop posting here. He will expose your lack of honor and integrity anyway. If you have any honor and integrity, you will show positive evidence that ID is scientific. Until you show your idea is worthy of being scientific, you have nothing. And dinging evolution, which you will fail at, does nothing to further your idea. It must be put out to the scientific community to be accepted, and all religious content, like fictional creators, must be removed, as science cannot and will not no use imaginary deities in their explanations or for a cause of something. And someone like myself, a professional scientist, will judge whether your evidence is good enough. You don't make that decision for us.Posted by: David Estlund | November 26, 2009 12:08 AM
Chimpy (hope you don't mind me calling you that),
It seems pretty common, actually. The theory of evolution has proven so elegant (as in simple and effective) and so confirmed by vast amounts of evidence, that to argue against it, one must accomplish the herculean feat of not understanding it. One must develop a blind spot the size of science, tell oneself that one has no such blind spot, and proceed to throw rocks at the straw man you have used to replace what you would have otherwise seen.
To understand evolution and continue to argue against it would be disingenuous, not to mention absurd. But since this is one of the last frontiers to remove superstition from the story of How Things Work, good religionists must fight it, and to do so requires that they not know it.
Posted by: Rev. BigDumbChimp | November 26, 2009 12:20 AM
IOh I know it's common, it still amazes me that people that are probably functinoal in the rest of their lives can be so horribly bad at recognizing how poorly the arguments they are being fed actually are.
Dr. Ross Olsen has to have some ability to learn, but he's not exhibiting it here.
Posted by: David Estlund | November 26, 2009 12:38 AM
Reverend (I think I prefer this one),
Nah, it's just cognitive dissonance. He's thrashing against a theory he refuses to understand because in his worldview it can't be right. Of course, the irony is that he believes exactly the same thing about all of us [but without any evidence]. The mind is a powerful thing; lunchtime, doubly so.
Posted by: Kel, OM | November 26, 2009 12:38 AM
So does that mean you would answer the questions put to you if they came in the form of an official post from PZed? Is the only thing holding you back from answering the questions put to you is that none of us are PZed? i.e. would we be wasting our time if we lobbied PZed to post the questions for us?Posted by: Rev. BigDumbChimp | November 26, 2009 12:40 AM
typing and late night failure
Posted by: David Estlund | November 26, 2009 12:44 AM
Wait a minute, I almost forgot a crucial point. "Intelligent design should be taught in schools because evolution can't be true" is total FAIL. That doesn't even fall under cognitive dissonance; it's a total non sequitur, and he keeps running with it. I forgot that the whole argument was not even wrong.
Posted by: Nerd of Redhead, OM
|
November 26, 2009 12:47 AM
Ding Ding Ding, We have a winnah...Posted by: David Estlund | November 26, 2009 1:19 AM
Here's a nice article, not that Dr. Ross Olsen will accept the science, nor will we accept the God: http://www.washingtonpost.com/wp-dyn/content/article/2005/11/17/AR2005111701304.html
"How ridiculous to make evolution the enemy of God. What could be more elegant, more simple, more brilliant, more economical, more creative, indeed more divine than a planet with millions of life forms, distinct and yet interactive, all ultimately derived from accumulated variations in a single double-stranded molecule, pliable and fecund enough to give us mollusks and mice, Newton and Einstein?"
I must admit that I was a bit of an evolutionary deist for a long time. Mr. Krauthammer's views are exactly the ones I espoused in the eighth grade. Perhaps it's inevitable that this sort of gorgeous, elegant, deist stance inevitably gives way to a gorgeous, elegant, materialist/naturalist stance, and theists recognize the need to fight this. Or perhaps the Bible God just doesn't fit either of these views.
Posted by: 'Tis Himself, Quel Dommage
|
November 26, 2009 6:49 AM
Is Olson using "The Second Law of Thermodynamics disallows evilution" argument? That argument was refuted decades ago. Even other creationists admit it's bogus. Bugs Bunny has the correct response to Olson's argument.
Posted by: Smoggy Batzrubble OM4Jesus | November 26, 2009 8:02 AM
"I was talking to PZ, not you groupies."
Dear Brother Ross Olson,
I understand your frustration at the fact the Professor Myers will not talk to you, I also am a contemptible Christian.
But, curiously, I believe this frustration might also give us a sense of how all the atheists feel. Think about it. What the atheists really want is one simple thing: proof. In other words, they want to converse with God. If they could converse with God and hear from His own omnipotent lips, they wouldn't be atheists a second longer. But instead all they ever get is a cacophony of contradictory claims from millions of His groupies, no ten of whom will ever agree on exactly the same experience of faith, all of whom back up their claims from cultural tradition, unverifiable individual sensation, and a badly written ancient book.
Atheists want to talk to God, not His groupies.
And let's face it, if our God is so great, why does he need to rely on grossly imperfect vessels like us anyway?
There is, of course, a major difference between God and PZ Myers.
That is, there is ample evidence that PZ Myers exists and communicates with others. Your complaint above proves it. On the other hand, neither you nor a single other person on this planet has ever provided a shred of convincing evidence for the existence of God. Faith is not evidence, warm fuzzy feelings aren't evidence, the Bible would never survive an impartial jury as evidence, even apparent miracles and answers to prayer aren't supportable evidence.
As a True Christian (tm) I know you will feel duty bound to twist this and assert that I'm saying that some atheists worship PZ Myers. In fact, most only worship beer and bacon, but PZ Myers does at least communicate with them (and with you, which must be a novel experience) and he provides a forum for a discriminated against minority to collectively resist a theocratic world.
As I said, atheists want to talk to God, not His groupies.
And in this I think you can hardly blame them. If you are a voice for God, then they have a compelling case for doubting his existence (or at least, His judgement). And if God is an Intelligent Designer, then he checked His intelligence at the door on a few million occasions, ranging from cells that turn cancerous to pissing and procreating out the same pipe.
So, on behalf of the atheists, let me say it one more time:
"We'd like to talk to God; not you groupies!"
Posted by: 'Tis Himself, Quel Dommage
|
November 26, 2009 8:07 AM
Bravo, Smoggy. I will bugger a sheep on your behalf.
Or not, as the case may be.
Posted by: Ross Olson | November 26, 2009 11:09 AM
I am amazed at the number of evolutionists who have been brainwashed into believing mutations are our friends. Be sure you don't complain about radiation leaks, thinning of the ozone layer and mutagenic chemicals in the groundwater. The examples of favorable mutations trotted out invariably involve loss of information. Sickle cell trait (one gene) which only is somewhat protective against malaria but sickle cell disease (two genes) is a painful sometime fatal condition. Bacterial resistance, when it is not a pre-existing selected gene, is usually due to loss of a structure to which the antibiotic binds. It is only an advantage in the presence of the antibiotic and is less hardy in the wild.
But I think I get the reason it is intuitively accepted: the way to comment is to duplicate a existing comment and randomly mutate it.
Wow, I have gotten a lot of name recognition out of this. Maybe a few will visit my web site and one in a million will actually think about the content.
Ross
Posted by: David Marjanović, OM | November 26, 2009 11:15 AM
Mr Olson, why don't you just come here to learn how simple genetics can create information?
Are you new to the Internet or something?
You have publicly commented on a public post on a public blog. You are talking to everyone who can read English, two billion people in total.
If you want to have a private conversation with PZ, send him an e-mail. How hard to understand can that be?
…Besides, your feeble attempt to defend Columbia Pacific "University" is noted and giggled at.
Posted by: Nerd of Redhead, OM
|
November 26, 2009 11:17 AM
Spoken like a condescending fool. Which you are. Mutations can be good or bad. Another lie for the liar.If we show up, it will only to be to laugh at your idiocy. We see through your inane and insane arguments.You have nothing cogent to offer, and have not shown your IDiocy to be scientific, which means you have nothing. Which everybody at this blog say DUH, that's what we expect from IDiots.
Posted by: Ben in Texas | November 26, 2009 11:18 AM
"Wow, I have gotten a lot of name recognition out of this. Maybe a few will visit my web site and one in a million will actually think about the content."
Yes, they will think about it, and get a good chuckle.
Posted by: David Marjanović, OM | November 26, 2009 11:20 AM
Oh, most aren't under most conditions. That's why all those DNA repair mechanisms have evolved – those without them are no longer around, you see.
But thanks for bringing up sickle cell anemia. It's a good example of how whether a mutation is beneficial or harmful depends on the environment.
Posted by: David Marjanović, OM | November 26, 2009 11:30 AM
Most are neutral. That's because:
– Most of the genome is junk DNA, and junk DNA can mutate as it wants, as long as it doesn't happen to acquire a start codon in one place, a stop codon some suitable length (divisible by 3) behind that place (DNA has an inbuilt direction, so "behind" has a meaning), and all manner of regulatory sequences around it. (And that, as you can imagine, is exceedingly rare; the only case I know of is the antifreeze protein of icefishes.)
– In protein-coding DNA, most mutations don't change which amino acid a given sequence of 3 nucleotides will result in. There are 64 possible such sequences, but only 20 amino acids + 3 stop codons; most amino acids are coded by several such sequences.
– In most of a protein, the precise sequence isn't important, only the general shape and size is.
– In those parts where the sequence is important, the general chemical properties of the amino acid residues are more important than their precise identities. Almost all amino acids belong to groups united by similar chemical properties; this means that most mutations that result in exchanges between them are neutral or almost neutral. Furthermore, due to the nature of the genetic code, most mutations that exchange an amino acid for another exchange it for a chemically similar one.
– Depending on the environment, not every mutation that does noticeably surface in the properties of a protein has a strong effect on how many fertile offspring an organism will have ( = how high its Darwinian fitness is).
Posted by: 386sx | November 26, 2009 11:31 AM
Mr Olson, why don't you just come here to learn how simple genetics can create information?
He doesn't care. He doesn't even care enough to get the creationist arguments right. :P He's in it for other reasons.
Posted by: David Estlund | November 26, 2009 12:50 PM
David Marjanović:
LALALALALALALALALALAgoddontmakenojunkLALALALALALALA
I've just thought of an equivalent to Dr. Olson's theory. I call it the tangential theorem, and I would like it taught in geometry classes alongside the Pythagorean theorem. Instead of the sum of the squares of the lengths of two sides of a triangle equaling the square of the third, A2+B2=C2, I propose the following:
The sum of the squares of the lengths of two sides of a triangle equals the length of an invisible, intangible, unknowable third tangent at an arbitrary X, Y, and Z angle. You can't prove it doesn't. And the Pythagorean theorem is stupid and you're stupid for worshiping it. They used it to build the ovens at Dachau, after all.
Posted by: AJ Milne OM
|
November 26, 2009 12:57 PM
Shorter Olson: 'Got nothin'... dunno much but I do know when I'm totally fucked... so here's some more boilerplate creobot pablum 'bout how somehow a group of people clearly far too knowledgeable in this subject for me to snow or even sneak my talking points past without comment are somehow just thoughtlessly toeing a party line... in the vain hopes there's still someone stupid enough on the planet to buy that.'
(/Shorter me: 'Sweet.')
Posted by: Owlmirror | November 26, 2009 1:57 PM
I am amazed that you think that destroying a strawman is a substantive argument.
I am amazed that you think that an invisible being that doesn't talk or act in any meaningful manner is real and created the universe.
Why did your God create such things?
Duplications and mutations of the duplications do not "lose" information.
Why did your God create malaria?
Why did your God create malaria such that the sickle cell mutation was successful at spreading through populations that live where malaria spreads?
Does God hate people who live near mosquitoes?
As opposed to your strategy of never changing at all?
Kind of like Bozo the clown has lots of name recognition.
How many people are that curious about clowns, or consider their silliness worth thinking about?
Posted by: 'Tis Himself, Quel Dommage
|
November 26, 2009 2:20 PM
If your website is anything like the bovine feces you've displayed here, then I've thought about the content. After I finished laughing, I thought: "What an idiot Ross Olson is."
Posted by: Smoggy Batzrubble OM4Jesus | November 26, 2009 2:34 PM
Dear Brother Ross Olson,
As a fellow Christian I am deeply disappointed in you. The revelation that you are only here trying to lure a fraction of PZ Myer's blog traffic to your site so that you can pay to have your prostate bored out (another great piece of Intelligent Design btw!) is contemptible.
If you want visitors to your leprous, moribund web site then you should have the FAITH to pray for them, believing that God will supply. To resort to trying to lure web traffic from an atheist is the final resort of a faithless fool. Shame on you, you lukewarm Christian. May you spend umpteen hours a day in slow-dripping urination.
Yours in divine disgust
Smoggy
Posted by: Rev. BigDumbChimp | November 26, 2009 2:38 PM
There are idiots in every crowd.
Posted by: Rev. BigDumbChimp | November 26, 2009 2:43 PM
I'm still waiting for Ross to do two things
1. Give me his best evidence for ID
2. Pick specific research in Evolution and not only tell me why it is wrong but show the science that disproves it.
Posted by: 'Tis Himself, Quel Dommage
|
November 26, 2009 3:05 PM
Keep your chins up, Ross. Remember, they laughed at Galileo, they laughed at Robert Fulton, and they laughed at Bozo the Clown.
Posted by: Kel, OM | November 26, 2009 3:15 PM
keep arguing that straw man, because as soon as you stop, it'll highlight the fact that you still don't have a scientific hypothesis for design. Seriously, is it that hard to answer scientific questions on what you aspire to be taught in science.Hypothetically, let's say ID gets a lesson in the science class to teach it's hypothesis. What would you say about the process? What experiments would you point to? Could you make a lesson on ID that lasts for an hour which constitutes a purely scientific look at design? Not poisoning the well for evolution by natural selection, not pointing out the perceived weaknesses of modern evolution theory - but a lesson on the science of intelligent design.
Posted by: David Estlund | November 26, 2009 3:42 PM
I really love how these guys love formal debate, where they can Gish Gallop, push biologists into cosmology and vice-versa, tell outright lies without being held accountable, and leave their intended audience confused and ignorant, but feeling smug satisfaction that their backwards beliefs have been confirmed.
They like coming on here to get attention, but must pretty much ignore us, because if they engage with us, they know we'll just crowdsource truth against them and they'll be reduced to frothing angry trolls stubbornly refusing to answer simple questions. So they retreat to their Fortresses of Solitude where they can just ban all dissent and rational inquiry, and hope some of us will follow them to become befuddled ourselves.
Posted by: Rev. BigDumbChimp | November 26, 2009 10:30 PM
Ross?
Where's that best evidence for ID?
Where is that testable falsifiable theory of ID?
What specific research of evolution can you provide science that refutes it?
Posted by: Ross Olson | November 27, 2009 2:12 PM
Well, PZ has apparently tired of this issue (no new posts, which makes it necessary for further discussion to do the unspeakable, post on an old blog!) And still Myers has not given a coherent explanation of how new information is generated by evolution. Some of his followers seem to believe in spontaneous generation. Many don't recognize irony (from an opponent, anyway. eg "I was talking to PZ")
Richard Dawkins at least hemmed and hawed before coming up with his answer for the dilemma. See www.tccsa.tc/articles/dawkins_pause.html and scroll down to Dawkins explanation of information (by elimination). In summary it goes like this. A friend has had as baby and you ask, "Is it a boy or girl?" The information is a result of the elimination of one possibility, which is "selection." Therefore, mutations do not increase information but natural selection does.
Since the Blogosphere does not seem particularly strong on analysis, let me draw a picture. Information by subtraction does not add anything. It means you have to start with something and keep on taking away from it. This DOES NOT build new body plans or behaviors as evolution needs. Yet the mythology is out there that "Dr. Dawkins 'dealt with' the challenge."
As to students taught BOTH ID and evolution (for that is the hope -- not one to the exclusion of the other) the thesis that exposure to ID disables students for further success is unsupported. Dr. Myers rightly states that they would not pass tests in his classes (unless they gave the answers he wanted whether they believed them or not). That, of course, strengthens Bergman's argument that there is discrimination and censorship in academia. But put one of those evolution-only graduates in a job where a product is necessary -- like Microsoft or Medtronics -- and see if their theory of information spontaneously arising with the input of energy gets them anywhere. It is TRUE that being indoctrinated is beneficial in academia where outliers are culled from the herd. But the brain that does not contain the missing information is actually less viable in the wild, just as a bacterium without a cell wall would be outside of a Petri dish full of penicillin.
The evidence for ID is design which cannot be accounted for by natural processes. It is not just a process of elimination but we make positive determinations of design all the time. We distinguish an e-mail full of random letters from an actual meaningful message (although some are borderline.) We know that an arrowhead is made by an intelligent being and if a coherent message were received by SETI, they would conclude that somebody is out there.
As the complexity of living things is further elucidated, the design signature is more and more evident. There are frame shift genes, which is equivalent to writing a book, moving the word spacing three characters to the right and having a totally different book that makes complete sense. In some areas there are genes on the "anti-sense" strand -- the template which allows the gene to be duplicated. This is equivalent to writing a book, reading it backwards and finding it to make complete sense as a different book.
Darwin, who was humbler and more honest than his disciples, may well have considered his theory falsified were he alive today.
Ross Olson
Posted by: David Marjanović, OM | November 27, 2009 2:20 PM
I repeat comment 298.
In its entirety.
Posted by: Nerd of Redhead, OM
|
November 27, 2009 2:31 PM
And still you have provided no information showing that ID is a true scientific theory. And if you were smart enough to read the peer reviewed scientific literature, and would believe it, the answers are there. But you won't believe it due to your religious dogma.Nor do you. You provide nothing cogent in explaining your ideas.Lets phrase this truthfully, since you haven't shown your evidence yet. Students should be taught religion and science in science class. That is what you are really saying. We say only science in science class.That evidence, if scientific, will only be found in the peer reviewed scientific literature. Which you avoid like the plague. The literature doesn't bite, but it doesn't say what you want either.Sorry, you are still wrong. Everything is easily explained by evolution without invoking your imaginary deity. Which you have shown no conclusive evidence of either. In fact, your whole argument lacks evidence, and consists of little more than handwaving. But real scientists know that.Ah, another lie. Darwin would be very pleased by the scientific evidence backing his theory, including a million or so peer reviewed paper. You have essentially nothing.Another long, but intellectually devoid posting by Ross Olson. Who doesn't understand that to prove his theory, he needs positive evidence for it, and that is not found by trying to ding evolution.
Posted by: AJ Milne OM
|
November 27, 2009 2:34 PM
... yep.
(/Shorter Olson: 'Still got nothin'... So here's the previous lies, transparently rephrased, and a handful of some just as old, if mebbe new to this thread... And no acknowledgement whatsoever of the fact that the previous ones have now been thoroughly rubbished.')
Posted by: Dentroman | November 27, 2009 2:38 PM
Dear Ross,
"I am amazed at the number of evolutionists who have been brainwashed into believing mutations are our friends."
I am amazed at the number of Christians who think evolutionary thinkers think mutations are our friends. I certainly don't. Many mutations are very harmful, and I wouldn't want to have anything to do with them (see next response), but the small portion that are beneficial outweigh the others in a selective environment. Beneficial mutations spread, destructive ones don't. Again, if you understood what you blabber about, this would be obvious.
"Be sure you don't complain about radiation leaks, thinning of the ozone layer and mutagenic chemicals in the groundwater."
I honestly rather not be exposed to mutation. That doesn't change the fact that in a POPULATION, mutations can be beneficial. This is continually demonstrated in the lab, and in simulations that any half-wit with a computer can create.
"The examples of favorable mutations trotted out invariably involve loss of information. Sickle cell trait (one gene) which only is somewhat protective against malaria but sickle cell disease (two genes) is a painful sometime fatal condition."
Then how about Lenski's famous E. Coli experiment, where bacteria developed the ability to digest citrate though an IC multiple gene system, while retaining their ability to digest other substances like Glucose? Again, if you managed to (a) read the responses we give you and/or (b)do your own damn research, you would have run into this by now. Arguments like this make you look ignorant and stupid. Stop defending yourself with straw men, and face the facts.
"Bacterial resistance, when it is not a pre-existing selected gene, is usually due to loss of a structure to which the antibiotic binds. It is only an advantage in the presence of the antibiotic and is less hardy in the wild."
As with any mutation, the environment matters. The bacteria survives because it is better adapted to live near antibiotics. It's honestly that simple at the core. And agin, there are plenty of examples againt this tired clam that only adaptaions with a loss of structure exist. I'll point you once more towards the work of Lenski, but I doubt you'll bother to follow my advice.
"But I think I get the reason it is intuitively accepted: the way to comment is to duplicate a existing comment and randomly mutate it."
I quite like the idea! Lets try it! I think I get the reason you continue to post here: the way to be a creationist is to duplicate a existing, outdated, and refuted argument and randomly mess it up even further, to the point when even an ally would facepalm when you open your yap.
"Wow, I have gotten a lot of name recognition out of this. Maybe a few will visit my web site and one in a million will actually think about the content."
I visited you website. I did not read all of it, as I only had a few minutes, but I did hit several sections. I found most of it to be tired old trash, but some enormously humorous as you continually espouse your opinion that "Our culture seems to be addicted to change" then imply this problematic all on a f*cking WEBSITE. You, sir, are a despicable hypocrite. Stop trolling and do some damn research. It'll do your mind wonders.
Dentroman
P.S.
Smoggy, that post made me chuckle. You deserve the OM, without a doubt.
Posted by: David Marjanović, OM | November 27, 2009 2:48 PM
LOL! :-D Another of the sort of creationists that use a computer to complain about science. Will they never become aware of the irony?
Posted by: Owlmirror | November 27, 2009 2:57 PM
No, you just FAIL at reading comprehension.
No, that's you. You think God "spontaneously generated" everything.
That wasn't irony, so how were we supposed to "recognize" it?
We do recognize IDiocy, though.
Failure to comprehend evolution -- as you continually demonstrate -- does not make evolution false.
Oh, PZ teaches both ID and evolution. He teaches that ID is not science (and why it is not, which does not take long), and that evolution is (and why it is, which requires more time).
What a moronic analogy.
But I agree that knowing that ID is not science, and why, is better than not knowing anything about it all.
Pity that your brain does not contain that missing information.
Or in other words, human artifacts.
And also false positives, obviously.
Would you recognize random letters as being distinct from something base-64 encoded?
Note that an arrowhead is not irreducibly complex. So what distinguishes it as being designed?
Are you capable of that sort of analysis?
And that depends on whether it is determined to not be the result of a natural process.
Pulsars were briefly thought to be intelligent messages, but once it was understood that they were the result of a natural process, that interpretation was no longer viable -- just as evolution makes the argument from design no longer viable.
Actually, it's exactly the opposite.
Nah. He didn't know genetics, but if he learned about it, he'd notice the lack of intelligence involved the various combinations you describe. Not to mention the lack of intelligence in IDiot arguments.
Posted by: AJ Milne OM
|
November 27, 2009 2:58 PM
... since the lyin' 'tard did bring up overlapping genes, there's an amusing bit of serendipity occurs to me...
... there's a paper out there on one of the overlaps in mammalian mitochrondria that looks at other (non-overlapping) descendants of the evidently non-overlapping precursors (the overlap doesn't occur in other lineages, makes it relatively easy to work out how and when it probably happened in the first place) ... and guess what one of the studied species was?
Zebrafish...
(/So hey... Olson's clearly right this is some kinda huge, nasty conspiracy o' the Templars or sumpin'... and 'dem durn Zebrafish folk are out ta get him, all right...)
Posted by: a_ray_in_dilbert_space
|
November 27, 2009 3:11 PM
Ross, Work with me buddy. Let's say that I belong to a species that eats only a certain type of apple. Now over time, let's say the the tree said apple grows on gets 6 inches taller, and most but not all of my species cannot reach the apples. With me so far?
OK, what is going to happen to my species? Well only those tall enough to reach the apples will reproduce, and the species will over time get about 6 inches taller. Voila, evolution has just transmitted the information: You must be "this tall" to survive on this type of apple.
Posted by: Alyson Miers | November 27, 2009 3:30 PM
What is it this week with trolls coming in here and demanding an audience with PZ and shunning the communications of his commenters? It's like the New Pharyngula Meme. Listen, folks: there is no God on this blog. There's no one to tell the piranhas to quit swarming. You can't control us.
Argument assumes its premise. Puts the cart before the horse. Try again.
Didn't PZ do a talk about this at a conference? "Complexity, complexity, complexity, complexity. Therefore, DESIGN!" Also, a metaphor may be used to communicate valid evidence, but not as a substitute for it. The horse pulls the cart, not the other way around.
A few will probably visit. After all, even PZ can't always supply us with a steady stream of point-and-laugh fodder.
Posted by: Joffan | November 27, 2009 3:40 PM
I think we would all agree that a population of clones - all carrying identical DNA - involves less information than a population of diverse individuals of the same species. So it's easy to see that mutations occuring in the population of clones as it reproduces will increase the information in that population.
While this technically disposes of the concept that mutation cannot add information, I think there is still a more significant argument, and fortunately it follows on from our imagined population of clones becoming varied. The idea that mutations can add function is perhaps a closer description of Ross' argument and this follows inevitably once we have a population with largely heritable variation and the environmental selection process. Under these circumstances, elements of individual variation which do best under those environmental conditions will become more prevalent over generations, and instead of being an unusual feature of an individual will become a usual feature of the population. However there will still be population variation around that new norm, topped up by continuing mutations of various sorts and whittled down to acceptability by selection.
Of course if the original clones inhabited two different environments, the pressure of selection on the acquired varition would tend to drive future generations eventually into different species. More information indeed.
OK. Time perhaps to dive a little further in and describe acquisition of visible body changes. This is effectively just more of the same, but typically over longer generational spans. If, for example, a mutation means that one of the population has an extra bone in the spine, or an extra digit, which helps more than it harms, this feature may become common in future generations, a new norm for further changes. Such mutations are not unusual in reality. Horses are perhaps an example of specializing by losing some aspects to optimize on others, reducing foot digits but specializing in a hoof, not present as such in its distant ancestors.
I'm aware that there is much left unexplained in this comment, and many cases not covered. But a single counterexample to a broad claim is sufficient to disprove that claim, and I feel I have done that and more. I will leave it to Ross to respond with honor to this.
Posted by: PZ Myers
|
November 27, 2009 3:42 PM
Olson: GO HERE. I know this is hard for you to understand, but I do create new posts now and then.
Who do you think you are, John A. Davison?
Posted by: 'Tis Himself, Quel Dommage
|
November 27, 2009 4:10 PM
Ross,
If you wander over to the I get email - and create a contest thread you'll discover a good number of posts which answer your questions.
There are posts showing, with quotes from Hitler (primarily from Mein Kampf), that he was not influenced by evolution. It's also shown that even if he was, that would not be an argument against evolution. The argument from consequences (argumentum ad consequentiam) is a logical fallacy.
There are posts showing that mutation can add "information" to genes and chromosomes. Incidentally, it would help if you creationists would define some of the words you use, like "information." We realize you don't because when evidence is given to show an increase in information, then you can pretend that you meant some other type of information.
Believe it or not, Ross, there are other people posting on this blog besides PZ Myers who are professional biologists, biochemists, geneticists, and the like. There are yet others, like me, who aren't trained in the biological sciences but are educated and experienced in other fields. If you have questions about almost anything, quite likely there's someone here with the expertise to answer you.
Posted by: 'Tis Himself, Quel Dommage
|
November 27, 2009 4:14 PM
Damn, I must have started writing my post #327 just before PZ posted #326.
Posted by: Kel, OM | November 27, 2009 4:50 PM
Still notice that Ross Olson is ignoring any questions regarding a scientific hypothesis of intelligent design? When your entire shtick is "Evolution cannot account for X", then you're going to repeat it like a mantra regardless of the validity of the claims.
Why not instead of just saying "Evolution cannot account for X", do some mathematical modelling to demonstrate as such? Nope, it's just easier to point out that Dawkins didn't answer a question about increasing information, and therefore the demise of evolution? Silly boy Ross. Meanwhile there's a complete thread dedicated to answering your question. SEF even wrote some haikus to explain it to you.
And even if evolution by natural selection is falsified, what then? What would you come up to replace it? Keep in mind it has to explain the fossil record, the genetic code, the geographic distribution of life, embryological similarities in early development and the way that embryos form, homology in comparative anatomy, speciation, change in populations over time, etc. pretty much everything that evolution by natural selection covers now.
That's the problem when your position entirely rests on the negative - evolution by natural selection is not true. Because all you get if you knock down a negative is the ability to say "I don't know what happened, but it wasn't X". Unless you're whole plan is one huge substitute for human ignorance - we don't know, therefore God. If that's the case, then you've got nothing. God is indistinguishable from the unknown. You can't know how life was created, you can't know how life changed, you've got a placeholder akin to dark matter. Not very philosophically-sound.
Newton did the same thing 300 years ago, made exactly the same argument. He could account for the movements of the planets the lord hath made. So why aren't creationists quoting arguably the greatest scientist in the history of mankind? Well it seems it's because we have a pretty good understanding now of how stars and planets form. Using God as a placeholder makes a god of the gaps, and those gaps get filled.
So please, work towards a positive design hypothesis. outline a mechanism, make predictions, make sure it matches the current body of knowledge and see what it can predict in the future. Why aren't you doing this? Why are you spending your time trying to convince people that natural selection doesn't work? It doesn't make your case any stronger, all it does is show that natural selection doesn't work at best. Make a positive case for yourself and you avoid the mental trappings of thinking you win by arguing the negative. If natural selection is not the mechanism, then that doesn't say what is...
Posted by: 386sx | November 27, 2009 6:57 PM
Olson: GO HERE. I know this is hard for you to understand, but I do create new posts now and then.
Who do you think you are, John A. Davison?
Nope. Still Ross "dog ate my homework" Olson. I guess now you can see how he got the nickname.
Ross Olson said: (no new posts, which makes it necessary for further discussion to do the unspeakable, post on an old blog!)
Also sometimes known as Ross "we just don't know what the heck he's talking about" Olson. But we make a wild guess anyway. Because we know he won't tell us if we ask him what the heck he means. Lol.
Posted by: JT | November 27, 2009 9:49 PM
"Who do you think you are, John A. Davison?"
OMG. That is funny.