memes

Your Name in Protein

cagapakis — Wed, 22 Sep 2010 06:59:54 +0000

Your Name in Protein

Thanks to the internet, you can find out your pirate name and your Jersey Shore name, and now thanks to the EMBL-EBI learning tools, you can find your protein name too!

When you type your name into the box, the program reads the letters of your name as if they were the single-letter codes for amino acids. Since there are only 20 amino acids, if you have a B, J, O, U, X, or Z in your name the program reads it as "X" which just means any amino acid could go in that spot.

The amino acids are then translated back into one of the possible three-letter DNA codes for each amino acid, and that DNA sequence is searched against the genome databases for the protein that has the closest match to your name.

My name becomes TGCCACAGAATCAGCACCATCAACGCCGCCGGCGCCCCCGCCAAGATCAGC
in DNA, and the closest protein match is Phosrestin from fruit flies (apparently they allow a lot of gaps in the search), a protein involved in the fly photoreceptor.

Synthetic biologists like Craig Venter sometimes like to code their own "watermark" into artificially synthesized DNA sequences as a way to sign their work, so it's fun to be able to turn it around and search for words already there (btw, Craig Venter's closest protein name match is Fructose-bisphosphate aldolase 1 from the garden pea).

What's your protein name?

via @christianbok, the DNA poet.

cagapakis Wed, 09/22/2010 - 02:59

Tags

DNA

education

fun

memes

You shouldna done dis. You doan unnerstan: I coulda had class -- on the Jersey Shore, dey call me da T'rill. I coulda been a contender -- the pirate Machete Rupert Mango-Terwilliger. I coulda been SOME body ... instead of a heat shock protein in Salmonella paratyphi A, which is what I am.

Well, I appear to work on digesting insects on behalf of a bacteria (Photorhabdus luminescens) that lives in symbiosis with a parasitic nematode worm. I'd always suspected as much.

50S ribosomal protein in Wigglesworthia glossinidia brevipalpis, a microbe that carves out a living as an endosymbiont in the gut of a tsetse fly. Damn it, now people are going to start calling me Wigglesworth.

You could take it one step further and turn your protein name into music:
http://www.doe-mbi.ucla.edu/cgi/pettit/gene2musicweb
Who knows, you might be able to fist pump to the situation's protein name. They have some example protein jams on the site as well. However, I don't recommend the Huntingtin protein; the trinucleotide repeat music even sounds like a disease.

The Beard-ome

cagapakis — Mon, 29 Mar 2010 19:23:12 +0000

The Beard-ome

Another Hydrocalypse Industries original production, the Beard-ome presents imaginary work on the genomics of the beard. What's lying beneath your beard?

cagapakis Mon, 03/29/2010 - 15:23

Tags

Imaginary? You are far too modest! This science is huge. Grizzly Adams huge.

Brilliant

You guys are just awesome, makes working during vacation easier

I'm submitting this for journal club this week.

Men would buy bear-dome brand hair care products for grooming the beardome. Lots of men.

Surely to understand the genomics of the beard, it is first necessary to sequence the full gardengnome?

As I say on my gay bear blog, "Bear is Better".

And if beards are eventually deemed security threats or child abuse, just as what happens they take babies away from child abusing parents, take the beard away and I'll just make another.

I foresee lawsuits between backhair research and beard research".

I'm not even sure what I'm talking about.

bear dome
http://www.montanamooseandco.com/Images/Products/15657.jpg

The thing is, surface bacteria are extremely important in human physiology. The ones that I am working with, ammonia oxidizing bacteria set the basal NO/NOx level by converting the ammonia in sweat into NO plus nitrite.

Unfortunately people think it is a joke, when actually is it one of the most important regulatory aspects of physiology. Providing a niche for these bacteria is why humans have hair, why the scalp is think and well vascularized, why there are emissary veins that pass from the scalp through the skull. It is to get the NO/NOx from the scalp into the venous sinuses of the brain ASAP.

Hair under the arms is to provide NO/NOx to the major lymph nodes in close proximity, and to provide NO/NOx to the lymph coming back from the arms, and in particular the hands which are major contact points with the environment. Immune system regulation requires that NO/NOx for antigen presenting cell maturation and the rest.

The reason for andrenergic sweating, is to increase NO/NOx levels. That is why it happens mostly at night, night sweats are a sign of low NO/NOx. This is the reason for profuse sweating when you to into shock, it is to generate profuse NO/NOx. Making more NO/NOx is why hypovolemic shock causes profuse sweating.

This is amazing, if you need an consultant I have over 6 years of beard experience.

Too bad I shaved my beard too early! Missed my chance to be an experimental subject and just maybe get an acknowledgement or even my face in both Science and Nature.

HilariousQ!

I thought they would discuss the genes related to why some people are unable to grow beards. Very disappointed. Also not funny.

Lady Gaga's "Lab Romance"

cagapakis — Sun, 28 Feb 2010 12:33:37 +0000

Lady Gaga's "Lab Romance"

My labmates and I love Lady Gaga. Like, love love love. Enough to make a parody fan video of Bad Romance. It is my pleasure to present to you "Lab Romance", a production of Hydrocalypse Industries. Enjoy!

Lyrics after the jump!

Music by Lady Gaga, lyrics by Tami Lieberman and Jake Wintermute, performed by Jake Wintermute, editing by me and Patrick Boyle, dancing by the Silver Lab.

Oh-oh-oh-oh-oooh!
Oh-oh-oooh-oh-oh!
Caught in a lab romance

Roma-Roma-ma-ah!
Ga-ga-ooh-la-la!
Want your lab romance
Roma-Roma-ma-ah!
Ga-ga-ooh-la-la!
Want your lab romance

I'll cure your ugly
I'll cure your disease
I'll publish papers
As
long as they're free
I'll wear a glove
Glove-glove-glove
I'll wear a
glove

I want your carbon
The touch of your genes
Alter your genome to
make my machines
And wear a glove
Glove-glove-glove
I'll wear a glove
Glove-glove-glove
I'll wear a glove
You know that I want you
And you know that I need you
Go to the lab
Lab romance

I want your loving
And I want your revenge
You and me could write a
lab romance
I want your loving
All your love is revenge
You and me
could write a lab romance

Oh-oh-oh-oh-oooh!
Oh-oh-oooh-oh-oh!
Caught in a lab romance

Rah-rah-ah-ah-ah!
Roma-Roma-ma-ah!
Ga-ga-ooh-la-la!
It's a lab romance

Carbon storage
Genetic design
I'll own the patents
And the profits are mine
And wear a glove
Glove-glove-glove
I'll wear a glove
Glove-glove-glove
I'll wear a glove

Track your cell cycle
and learn all your tricks
to cure your cancer
'cause baby your sick
And wear a glove
Glove-glove-glove
I'll wear a glove
Glove-glove-glove
I'll wear a glove

You know that I want you
And you know that I need you
Go to the lab
Lab romance

I want your loving
And I want your revenge
You and me could write a
lab romance
I want your loving
All your love is revenge
You and me
could write a lab romance

Oh-oh-oh-oh-oooh!
Oh-oh-oooh-oh-oh!
Caught in a lab romance
Oh-oh-oh-oh-oooh!
Oh-oh-oooh-oh-oh!
Caught in a lab romance

Rah-rah-ah-ah-ah!
Roma-Roma-ma-ah!
Ga-ga-ooh-la-la!
It's a lab romance

Work work passion baby
make that model work crazy

I want your loving
And I want your revenge
I want your loving
I don't want to be friends

Je veux ton amour
et je veux ta science
j'adore la science
I don't want to be friends

You know that I want you
And you know that I need you
Go to the lab
Lab romance

cagapakis Sun, 02/28/2010 - 07:33

Tags

That's fucking hilarious!

THAT was disturbingly funny. And I thought Lady GaGa was just for us old guys....

Awesome slant on Lady GaGa. You should submit this to The Scientist when we have our 2nd Annual Lab Video Awards. Last year the winning school did a cool take on a Wu Tang Clan song.

Funniest thing I've seen in ages! Well done! Geek humour at its best :)

Looks like you guys had great fun doing this...puts the original video to shame, never seen anyone get so creative with a pipette...

OMG this is AMAZINGLY AWESOME. Sci volunteers her awesome dancing skillz for the remake. :)

"'ll cure your ugly
I'll cure your disease"

Dorks like what fellow dorks do! I liiike! Veery nice!

I love this!
though all i can think is man this a group of people who have a thesis/dissertation/publication looming over them :)

Awesome, congrats! Will tell novoseek users about it ;)

Come on baby, ig-nitrile my fire!

get a like mother fucker
make fun of yourself bitch

Is so hot and sexy and she is personality is awesome, she is dress ,she is eyes, face look everything is fine.

She does incredible things. I never saw such singers. She's the best! Lady Gaga is Best!

Yeah! I like that unusual girl!

Lovely performance!!!

Hahah, great video. I wish the guys in my lab had a fraction of the humor needed to pull this off!

So fantastic! Nicely done!

Hello Lady Gaga's Fans!
here are some more video clips, biography and information about Lady Gaga
http://emaildaily.co.uk/lady-gaga

esta cancion es unas de mis favoritos ccuidenmelo estoi loko per no lo admito bueno esta lin do diria mas q lindo lady gaga

Lady GaGa is a very talented composer and performer, but as her interview with Larry King revealed, she is addicted to the attention and fame and thus all things material and meaningless!

Nice work Christina! I hope your lab makes more of these. It's great and very helpful for teachers trying to convince high school students that scientists can be fun.

I KNOW ME LADY GAGA I SAID IN MY SCHIESSE CLIP MY HAUS OF HITLER ON YOU TUBE !

ME LADY GAGA JE VOUS SORS MON DEBUNKAGE EN LIGNE ON INTERNET

ME IâM LADY GAGA I AM DEBUNKE FOR YOU DEAR SH*T FANS PART ONE
http://www.youtube.com/watch?v=gw8RtCctVfI

ME IâM LADY GAGA I AM DEBUNKE FOR YOU DEAR SH*T FANS PART TWO
http://www.youtube.com/watch?v=GeiozGUEzyM&feature=related

ON GOOGLE LADY GAGA DEBUNKE TH*NKS MY FAN CLUB OF ME LADY GAGA

HAUS OF GAGA = HAUS OF HITLER ! YA YA RICHTIG

HAUS OF HITLER ! YA YA RICHTIG

DEDICATED TO MY FAN CLUB OF SH*T LADY GAGA OF COURSE ****

KISS LADY GAGA

The Evolution of an Internet Meme

cagapakis — Wed, 27 Jan 2010 09:12:58 +0000

The Evolution of an Internet Meme

I sort of love the "KEEP CALM AND CARRY ON" posters that have become the darling of interior decorating bloggers and graphic design jokesters alike in the past few years. I even have one of the posters hanging in my apartment. Then I saw Merlin's version.

At first I LOLed, and then I was like "huh." How did we get here? How did this meme evolve from stoic World War II propaganda to hilarious Richard Dawkins jokes?

And thus, the phylogenetic tree of "KEEP CALM AND CARRY ON" posters was born:

High res here.

cagapakis Wed, 01/27/2010 - 04:12

Tags

Missed one:

http://www.etsy.com/view_listing.php?listing_id=38041210

Keep calm and carry yarn.

Oh man! That one is awesome! I know I must have missed a lot more :(

Thanks for putting this together. I've seen these floating around here and there, but it's fun to see it all on one page!

Here's another... Stay Happy And Don't Die

http://www.mysoti.com/mysoti/designer/stuartwitts/product/671552/stuart…

Keep calm and rock on (mid-century style):

http://www.etsy.com/view_listing.php?listing_id=33959826

Nice! Keep 'em coming, I'll have to make a bigger tree!

well i recognize my type on print there! i'm part of a meme!

What stands out to me from this is that, as in evolutionary biology, sometimes the earlier well-evolved forms (in this case the original poster, which obviously had a lot of throught go into it) are often much more elegant and beautiful than later random mutations.

Nice round-up Christina. Thanks for putting it all together.

A flickr group of these and more Keep Calm variations:

http://www.flickr.com/groups/keepcalm/

How many of those, when printed on a t-shirt, would get you arrested at an airport?

Someone messed up:
http://thereisnorobotgod.blogspot.com/2009/11/god-fucking-damnit.html

Don't forget "Freak Out and Throw Stuff." it's on Etsy somewhere

Keep calm and cover your bum.

don't forget the newly minted conan o'brien one!
http://www.flickr.com/photos/claylarsen/4298622715/in/photostream/

Have added your info to my KCCO blog: http://ww2poster.wordpress.com/2010/01/28/the-evolution-of-an-internet-…

Another one missing: http://mjays.net/post/339780066/keep-calm-and-make-it-helvetica-ultrali…

i'm still going strong, since 2006. and, through feb. 14th, i'm making a $5 donation to the red cross haitian relief efforts for every purchase.

thanks for the fun!

http://www.flickr.com/photos/yotam_hadar/3832384287/

I love this post.... Very funny and very close to home.. as I'm the one who made the 'keep calm and Ride on' print with the bike!

ps- I think there's another shop on Etsy that has about 50 different versions of Keep Calm..

I just got the crown tattooed on the inside of my wrist as a constant reminded to 'Keep Calm and Carry On'.

Love this! I just got this print recently.http://www.etsy.com/view_listing.php?listing_id=40289195

my take on them http://www.behance.net/gallery/KEEP-CALM-VARIATIONS/573719

And yet another take: http://blog.ardes.com/2011/6/28/nigel-thornberry-advice

The meme of honourable death

gregladen — Fri, 25 Sep 2009 09:04:16 +0000

The meme of honourable death

The Anglo Boer War (in what is now South Africa from October 11th, 1899 to May 31st, 1902) was a turning point in European style military history. Previously, infantry would operate in large blocks that would move forward, turn and open or close ranks, and winning an infantry engagement would involve getting your columns around the side or back of the enemy's columns, or simply overrunning them head on. This worked in part because although everybody had a firearm of some kind, the firearms held few bullets, took time to reload, and were inaccurate, and since they tended to be inaccurate, the soldiers were generally not trained to shoot as well as they might. So, a rifle was really a spear (with a bayonet attached, of course) that also made a lot of noise and fired a few relatively useless bullets. Previously, the cavalry was effective because it consisted of swordmen up on big and/or fast horses who could move quickly across the landscape and would wade into the enemy's infantry slicing up the foot soldiers. The cavalry could not be stopped easily by the infantry because the infantry would shoot a relatively small number of relatively bogus bullets at the cavalry, knock a few guys off a few horses, then get ripped to shreds with the swords. The fact that the cavalry often consisted of members of the elite classes and the infantry consisted mainly of working class men made it all the more ... Victorian.

By the time of the Anglo-Boer War, the rifles that soldiers carried were more accurate, held more bullets, and overall were more deadly especially in the hands of the sharp-shooting Boer farmers who had been shooting game or involved in bellicose activities of one sort or another for years. In the old days, you could bring cannon close to the lines, have your infantry cover the cannons, and have your cavalry cover the infantry. In the new days, if you were within shooting range of the enemy's infantry, they would cover you with a hail of bullets. During the two plus year long Anglo-Boer war, the number of times cavalry actually charged into a sea of infantry and used their swords can be counted on one hand.

Why am I telling you all of his? Well, I recently finished reading a contemporary history of the Anglo Boer War. There were several things about this history that I found (most of which I was looking for) regarding English, Afrikaner, and other Euro-ethnic interactions, white vs. non-white interactions, and so on. I was also looking for examples of attitudes towards non-white native Africans at the time, and for information on the role of, or at least reaction of, 'bushmen' groups in the Cape at the time. I found about five examples of the former and no examples of the latter in this enormous tome, The Great Boer War written by Arthur Conan Doyle.

But along the way, I found something else that I knew would be there but did not know would be as striking and as interesting as it is. Doyle's writing includes numerous references to the roles of valour, bravery, and ultimately, reputation, in the execution of warfare. I hesitate to use the word "meme" but I will use it here with my tongue in, or at least near, my cheek; In bunny-like fashion Doyle copiously reproduces the meme that to live dishonourably is a life not worth living, and to die honourably is second most desirable outcome in war. (The most desirable outcome in war would be to manage to live through your honourable death.) Doyle's history is so heavily draped in the thick velveteen of honour and valour (and notice I feel obliged to use the British spelling) that it becomes apparent that the propagation of this meme is the main purpose of the book itself. Perhaps of Doyle himself. Arthur Conan Doyle, it turns out, is an over-active ovary pumping out a veritable caviare destine to grow into widespread patriotic feelings of "I want to die for the Empire!" among young subjects of the crown in the homelands and all the colonies. They were probably handing it out to school children.

This theme of honourable death in warfare builds and sustains throughout the long monograph, but there are three or four points where it is so overblown that one wonders (at least from an early 21st century perspective) what really goes on in the human brain. A few years ago, Richard Wrangham wrote a paper or two suggesting that self deception in times of warfare explained the seemingly inexplicable fact that military leaders would enter into battles that any half-witted cadet at military academy could plainly see were simply not winnable. That may well explain the phenomenon of war as we have known it for centuries at one level, but there may be more to learn of the proximate mechanisms involved, and I think Doyle's meme may be one of the mechanisms. To illustrate this, I'll give as example the very scene that made me both sick to my stomach and inspired to write this post.

We are at the Battle of Colenso. This is fairly early in the war, and the British are just beginning to learn (the hard way) about a) the military prowess of the Boers and b) the ineffectiveness of their own 19th century tactics. So far there has not been a major battle that was actually won by the British, or if there was one here or there, it was overshadowed by some strategic defeat. This was the case mostly because the political policy of the British was to let the Boers get way ahead in the material preparations for the war so that once the inevitable conflict started the British could take the moral high ground. Which they would need later, as it would turn out, as buffer when things went badly in the concentration camps and other bad things happened.

Anyway, here's the setup, very briefly: The Boer army is entrenched, and the British are moving against them. Since the Boers are literally in trenches they can't be effectively shot at, and the artillery bombardments are not really working either. The British have to expose themselves to move in, and they've been discovering the hard way that they tend to get all shot up when this happens, and again and again some unit of British sholdiers find themslevs lying on the ground hiding behind ant hills waiting for night fall to come when they can sneak away if they are still alive.

At one point, the British infantry are held back from attcking a particular unit of Boers when a British artillery officer decides to wade in really close to the Boer line and blast them with his cannons. In the old days, this may well have worked, because the rifle fire against the artillery would have been manageable, and once the cannons started letting rip, that rifle fire would be attenuated as the frightened enemy soldiers ran away. But that is not what happened.

Now remember, this is the old days. The cannons are being brought in by teams of horses, and then unlimbered (disconnected) from the horses and set up by gunners, who then fire the cannons at the enemy. I'm giving you the long version of the account because I want you to appreciate the references to the earlier formed expectations when the British were busy fighting "barbarians" in comparison to the situation at Colenso. This is important because by this time in the war, something like what you are about to read about has happened a few times, and the British should have learned something already. So, in Arthur Conan Doyle's words:

This consisted of the important body of artillery [supporting] the main attack ... under the command of Colonel Long ... Long has the record of being a most zealous and dashing officer, whose handling of the Egyptian artillery at the battle of the Atbara had much to do with the success of the action. Unfortunately, these barbarian campaigns, in which liberties may be taken with impunity, leave an evil tradition, as the French have found with their Algerians. Our own close formations, our adherence to volley firing, and in this instance the use of our artillery all seem to be legacies of our savage wars. ...

... at an early stage of the action Long's guns whirled forwards, [passed] the infantry ..., left the slow-moving naval guns with their ox-teams behind them, and unlimbered within a thousand yards of the enemy's trenches. From this position he opened fire ...

But his two unhappy batteries were destined not to turn the tide of battle, as he had hoped, but rather to furnish the classic example of the helplessness of artillery against modern rifle fire. [Nothing] ... could do justice to the blizzard of lead which broke over the two doomed batteries. The teams [of horses] fell in heaps, some dead, some mutilated, and mutilating others in their frantic struggles. One driver, crazed with horror, sprang on a leader [horse], cut the [ropes] and tore madly off the field. But a perfect discipline reigned among the vast majority of the gunners, and the words of command and the laying and working of the guns were ... methodical.... Not only was there a most deadly rifle fire, partly from the lines in front and partly from the village of Colenso upon their left flank, but the Boer automatic quick-firers found the range to a nicety, and the little shells were crackling and banging continually over the batteries. Already every gun had its litter of dead around it, but each was still fringed by its own group of furious officers and sweating desperate gunners. Poor Long was down, with a bullet through his arm and another through his liver. 'Abandon be damned! We don't abandon guns!' was his last cry as they dragged him into the shelter of a [nearby hut]. Captain Goldie dropped dead. So did Lieutenant Schreiber. Colonel Hunt fell, shot in two places. Officers and men were falling fast. The guns could not be worked, and yet they could not be removed, for every effort to bring up teams from the shelter where the limbers lay ended in the death of the horses. The survivors took refuge from the murderous fire in that small hollow to which Long had been carried, a hundred yards or so from the line of bullet-splashed cannon.

Now, I want to pause for a moment for you to catch your breath. The following bit is the icing on the cake. And the cake, too, really ...

One gun on the right was still served by four men who refused to leave it. They seemed to bear charmed lives, these four, as they strained and wrestled with their beloved 15-pounder, amid the spurting sand and the blue wreaths of the bursting shells. Then one gasped and fell against the trail, and his comrade sank beside the wheel with his chin upon his breast. The third threw up his hands and pitched forward upon his face; while the survivor, a grim powder-stained figure, stood at attention looking death in the eyes until he too was struck down. A useless sacrifice, you may say; but while the men who saw them die can tell such a story round the camp fire the example of such deaths as these does more than clang of bugle or roll of drum to stir the warrior spirit of our race. [emphasis added]

At no point during this particular engagement could anyone with a modicum of rationality have believed that this was a good idea. Even if the officers in charge, who were taken out of action right away, honestly thought that bringing the artillery, with its horses and its gunners, to within killing range of several hundred sharp shooters would be an effective strategy, it would not have taken long to figure out that they were wrong. Yet once the operation started up, the "right" thing to do was not to back off, not to question authority, not to run and hide because death was a near certainty and success impossible. No. The "right" thing to do was do die, and the reason to die was because ... well, because it was the right thing to do. Those soldiers that were hiding in the hollow or the hut were forgiven by Doyle, because there was not much they could do. But the soldiers that stayed with the artillery were honoured by him, and by the British Government and the people back home and their comrades.

The meme of honourable death served the British Empire well.

gregladen Fri, 09/25/2009 - 05:04

Tags

Didn't know much about the Boer War; thanks for this.
I grew up an Army brat and was determined to be "dashing", also. Turns out, "dashing" wasn't a big survival trait in Viet Nam.

One might say that the modern phenomenon of suicide bombing is this meme taken to its logical extreme.

I understand that this is not your main point (and I am not an expert in military history), but I think your argument about early rifles (muzzle loaders) contains some misconceptions. Yes, it is true that (most of) these rifles were not very accurate, but this is precisely why soldiers were trained to line up in rows for volley fire - they became in effect a sort of human shotgun. When the ranks were trained to so that one row would reload while a second row aimed and a third row fired, then they could be very deadly indeed. Witness, for example, numerous American Civil War battles with enormous numbers of casualties (including from some very skilled and accurate snipers).

The above is a critical reason why the military (then and now) emphasizes discipline and courage - both needed in abundance when you are being told to stand in front of thousands of people firing .50 caliber rounds at you.

Large organizations often do stupid things, even when many of the people in them are very bright.

Hey Greg,

The battle Colenso sounds like a repeat of the the Charge of the Light Brigade in the Crimea some fifty years earlier.

Tom

uqbar: I'm also not an expert on this, so we should be able to have a pretty nifty knock down drag out fight about it!

Yes, it was a human shotgun, but even so, in the days of the smooth bore, they were shooting arcing, show-moving led balls at each other, not rifle bullets.

The US Civil War was a bit like the AB war in this sense: Rifles were being used, but the tactics of the battle field were not appropriate.

I'm not sure if the kill or injury rate in the AB War was higher than the civil war or not (per battle). The AB war was much more of a trench war, like WW I but with the exploding shells having not been developed to the same degree (thus artillery was said to be less an issue in the AB war). Until the guerrilla component of the war, all significant engagements were trench engagements.

In any event, what happened here, and is very clear and is not in dispute, is that the use of the very advanced repeating long range rifles that were used in the Anglo Boer war (but not in the Civil War in the US) created killing grounds where large numbers of hidden (entenched) shooters could pretty much hit and immobilize any individual over a very large area up to or beyond 1000 yards, and then with only a half second to throw the bolt, do it again, and again, and again.

It is very true that the Civil War was also a kind of turning point. It is said that many casualties were because of soldiers using rifles (with long range) but general using tactics designed for smooth bore weapons (as you describe).

tms: That particular engagement I mention was kind of like that, yes. The charge of the Light Brigade was a little different tactically for a number of reasons. First, it was mounted infantry or cavalry (can't remember). Second, it was an error in orders at some level where the brigade was told to do something no one wanted to do .. someone (almost literally) pushed the wrong button, as opposed to this artillery engagement at Colenso, which was a general thinking it was a good idea.

A slight correction on cavalry v. infantry:

During the Napoleonic Wars, the rule of thumb was that attacking infantry with cavalry was a good way to get your cavalry killed. Cavalry was used in the stages of battle where things were moving quickly, and once things settled down into the slugging match they either moved to the flanks or waited for an opening.

The best cavalry could do against unbroken infantry was to force them into squares and thus restrict their movement.

(Oh, for Colenso to have been a repeat of the Charge of the Light Brigade: There would have had to have been a gross miscommunication sending the guns into an immediate attack on the wrong target.)

Greg - I hope you are not disappointed, but I agree with your main point that "The meme of honourable death served the British Empire well." Not everybody bought into though - see Wilfred Owen (http://www.warpoetry.co.uk/owen1.html)

. . .The old Lie; Dulce et Decorum est Pro patria mori. . .

and an interesting comment at the link:

"the first words of a Latin saying (taken from an ode by Horace). The words were widely understood and often quoted at the start of the First World War. They mean "It is sweet and right." The full saying ends the poem: Dulce et decorum est pro patria mori - it is sweet and right to die for your country."

No doubt this meme predates Horace (born 65 BCE), probably by centuries. Which only goes to make your point: This meme has staying power, despite encouraging its carriers to risk their lives; presumably a lot more people advocate it than practice it.

Also, I don't think you are going to see Wilfred Owens poem on recruiting posters any time soon.

Despite the stereotype, there are lots of examples of western infantry fighting without formation. The American war of independence is a particularly good example. In addition, the AB war should really be compared to other colonial conflicts, rather than to the stereotypical napoleanic battle. As such, it seems like the unusual aspects of the AB war are not the absence of formations and successful cavalry charges, but rather the success of trenches when combined with improvements in small arms. As uqbar points out, this is also characteristic of the American civil war.

William, I agree with some of what you say, but even the small passage quoted above signifies the fact that treating the AB war as just another colonial war was a failed approach for the British, and thus would be unwise I would think for a military historian.

@Bodach #1: 'dashing' has never been a good survival trait, but it does get you 'mentioned in dispatches'.

Just to wade in on the ACW - AB debate. The rifled muskets used during the ACW were an order of magnitude more accurate than the smooth bores they replaced. As ugbar points out, picking out individual targets and even sniping was possible.

However the rate of fire was still relatively low and a decent charge could cross the distance from maximum range to bayonet range in just one or two volleys. So the 'old' tactics still worked, to an extent. Casualties were significantly higher however. But, in recognition of the fact that anything standing on the field of battle could now be hit reliably, smart commanders were already seeking covered positions for their troops by mid-war. At the end of the war the siege of Petersburg had degraded into full-fledged trench warfare.

As Greg points out The advent of breech loading rifles with self contained ammunition changed firepower equation again such that the old fashioned shoulder-to-shoulder charge was now complete suicide.

I think a confusing factor in comparing the two wars is that the AB war was fought in terrain that allowed for engagements at maximum range. In the wooded countryside of the eastern US being able to see an enemy 1000m away was a rarity.

NoAstronomer: Good point about the terrain. Also, don't forget the kojpies.

I think that repeating firearms put some of the infantry (and artillary and cavalry) tactics used previously into the category of "organized suicide" but the motivational tools used to inspire the troops to use those tactics was still valid. And they are still used today.

Most infantry battles before WWI were decided by the moral of the troops and weapons were mainly used in an attempt to break the moral of the other side. After all, few wounds were inflicted by the infantryman's hand-to-hand weapons after gunpowder took over as the primary infantry weapon. I think you may find that many of those wounds that were delivered with the bayonet were delivered to basically defenseless people (surrendered or attempting to surrender). The emotional impact of someone coming at you with a 17" spike would cause you to make a much more immediate and urgent decision as to whether to fight or run than having that same person standing 50 yards away firing his weapon.

I think that those officers that learned their tactics against the Fuzzy-Wuzzy had a hard time changing over but even the US Civil War was dominated by the rifle and the trench before the end.

It would probably amuse Horace to have been so misunderstood then, but a widespread modern view of the ode in question is that Horace was being gently sarcastic about the whole thing: of course any young man would much rather have fun and get laid than die honourably. So, really, people were being sent off to die encouraged because they thought anything two thousand years old must be serious. Of course the meme must have been current in Horace's time too, or he wouldn't have been taking the mick out of it.

Arthur Conan Doyle, it turns out, is an over-active ovary pumping out a veritable caviare destine to grow into widespread patriotic feelings of "I want to die for the Empire!" among young subjects of the crown in the homelands and all the colonies. They were probably handing it out to school children.

They don't require encouragement so much as direction.

I have come to the conclusion after a decade-plus of emergency field medicine that young male humans are hard-wired to self-destruct. After all, they're redundant: kill nine out of ten of them and the tribal birthrate doesn't drop worth mentioning. This provides a fine stock of young idiots who will go into caves after bears, raid other tribes, etc.

Those who somehow fail to get killed go on to reproduce. Developmental specialists tell us that somewhere in the early to mid 20s the circuits that enable them to think "Wait a minute -- if I do that, Bad Things could happen!" start to function.

We've made it harder for young idiots to kill themselves lately, but that just means they try harder -- and thus my experiences with field emergency medicine. The little buggers are remarkably creative in finding ways to defeat our attempts to prevent suicide.

As for their elders ...

The prize goes to the geniuses in charge who blithely ignored the lessons of the American civil war, the Spanish-American war, the Anglo-Boer war, etc. and decided to fight the First World War as though they were still in the Napoleonic age.

And then completely ignored the fact that This Obviously Isn't Working after three more years of total failure (and astronomical body counts), continuing to do the same stupid things that hadn't worked before.

A lot of very interesting information. A couple of things occurred to me. 1) Cavalry in the ACW changed because of the addition of the revolver. Cavalry irregulars in particular gave up on sabers and carried more pistols. So I've heard. This would seem a more effective tactic, was it not used elsewhere? 2) Valiant, honorable death: I think this has more to do with overcoming fear in an overwhelming situation than anything else. The wise thing to do when someone is trying to kill you is to either a)kill them or b)run away. If you don't think you can kill them, you will run away...not a good thing in a military situation. 3) This does get carried too far...aviators in the WWI were discouraged from using parachutes as they were told it was their duty to stay with the plane...no matter what.

Owen is an interesting case - he is widely considered the best of the 1st World War Poets, started the war a cheerful advocate (who no doubt very much bought into the honour and glory), wrote his poems whilst convalescing after being diagnosed with 'shell shock' (PTSD), and then returned to the front only to die gallantly (to borrow a word from the citation for his posthumous MC) seeking through war the very glory that his poetry was in fact destined to bestow on him.

The choice of dying a suicidal but "honourable" death or being killed by your own men in the battle (or being executed for cowardice later on) is well-established in military history, even in the 20th century. Whether for honour or just because you are brainwashed to follow all orders no matter how stupid the CO is seems irrelevant to me...either way you're dead!

Now when it comes to cavalry, by the ACW their primary function was more of intelligence than combat. The lack of General Stuart's cavalry during the lead up and 1st days of the Battle of Gettysburg is usually considered one of the contributing factors toward's Lee's loss.

I wasn't familiar with the Boer War or this battle, but any attempt to maneuver artillary to within 1000 yards of an enemy position and come into action, reeks of desperation not necessarily bad strategy. The description of the battle on wikipedia seems to bear that out. Hart's brigade had been lead to the wrong position and was already under fire, taking heavy casualties just trying to cross the river.

If you are analyzing the change in infantry tactics due to changes in firearms, don't forget to include the Franco-Prussian War. The Prussians had single shot cartridge loaded breech loading rifles which gave them a high rate of fire, although the breech didn't seal well. (To preserve their eyesight, many Prussians fired from the hip.) It also allowed them to reload while prone. The AB War sounds a lot like the Spanish-American War tactically. Rifles could fire to 2000+ yards, with sights marked to match. (At that range, targets were company-sized.)
Sounds like the British were slightly behind the times in 1900 in artillery. The first modern field artillery piece was the French 75, which came out in 1897. It was a fixed ammo breech loader with a recoil system, and a range of 7500 yards. I don't think the British 13-pounder used in the AB War had a recoil mechanism.

A lot of the function of the 'honourable death' meme is to maintain military order and effectiveness at a unit scale. Older tech left the individual solider (or even small unit) pretty ineffective, and the unit was what actually got the job done (or not). Also note how strong the distinction between 'men' and 'officers' was.

Technology has empowered small units. Small units down to individuals are now expected and encouraged to make intelligent decisions (the entire Marine doctrine of controlled chaos is based on this idea).
I think the quote attributed to Patton sums up the counter-meme nicely.
"No bastard ever won a war by dying for his country.
He won it by making the other poor dumb bastard die for his country."

Of course, when it comes to the Boer War, 'desperation' and 'bad strategy' would seem to describe perfectly much of the conduct of the British officer class, especially those at the top. If you want to see just how bad it could get, have a look at the Battle of Spion Kop http://en.wikipedia.org/wiki/Battle_of_Spion_Kop. Not our finest hour.

As for Doyle, he firmly believed that a pamphlet titled 'The War in South Africa: Its Cause and Conduct', and the book you read, led to his knighthood in 1902. He might have believed what he wrote, but he certainly did well out of it, honourable or not.

I'm quoting this simply because someone has to as a counterpoint to the 'honourable death' meme:

"I want you to remember that no bastard ever won a war by dying for his country. He won it by making the other poor, dumb bastard die for his country."

* Spoken by George C. Scott in the film Patton.

MikeB, wow That's one of the biggest cluster f's I've ever read about.

I see that Travc @21 beat me to the quote. Didn't see it until after I posted. My bad.

When I was in the Marines, we used to all sit around dreaming about going to war. But the closest we got was Granada and the closest I came to combat was manning a 55 gallon pump distributing three thousand gallons of water we made potable with a few chemicals and a lot of diatomaceous earth.

We were responsible for the supply of fresh water in the field that supported the assorted showers, laundry trailers and storage bladders scattered around wherever some General in charge decided to camp.

Although I am sure many of us would have given anything to get into a fight, the closest any of us came to being a hero, was when all the plumbing was working, the lights were on and the clothes of the regiment to which we were attached were clean.

Not much glory in any of that, but plenty of honor.

Just a thought,
Tom

My G.G.grandfather went to the Boer war. He came back with a bit of his skull blown away and a little bit mental. Didn't stop him working, but made him hard to live with, according to my granddad.

Just an aside: the tallest war memorial in Toronto is the one to the Boer War on University Avenue.

My great grandfather was also in the Boer War (with the Elswick battery) though not wounded there (he did get wounded at Gallipoli in WW1 but survived). Judging from his letters he did suffer a bit from death before dishonor idealism (though his idea of honor could also be a bit quirky).

Death was perhaps honourable but often long drawn out. At Sanna's Post, the first guerilla action of the ABW, appproximately a thousand men on either side faced each other. The War Memorial records the death of less than a hundred British on the day of the battle but half as many again dying within a few days of being wounded. No med-evac in those days.

Great comments. A few more points:

The majority of people who died in the ABW were not soldiers in combat. They were people who died of disease. Tens of thousands of Afrikaners were in concentration camps for the last part of the war. Most of the very young children died of, IIRC, measles. Most of the soldiers that died died of disease. And so on.

From the perspective of England/UK (the part of "britian" that is where everybody thinks England is, including Scotland, Wales, whatever whatever) sent more people and money off to the Boer War than to any prior military engagement. This was the biggest war Britian had fought to date.

Of the 30 million people in UK at the time, close to a half million went to Boer War (1-2 percent). (For reference, of the 76 million people in the US, somewhate over 3 million were in the field in the American Civil War... close to 6%.0\)

"Also note how strong the distinction between 'men' and 'officers' was."

Which was part of the British distinction between gentlemen and the rest of us slobs. Gentlemen usually became officers and nongentlemen were enlisted. At least that was the case during the Napoleonic wars and I think that much of system was still in place at the time of the Boer War. I know that Winston Churchill had to use his family's income (and eventually the income from his writings) to pay for the lifestyle that an officer was expected to have.

Churchill, by the way, is mentioned frequently in Doyle's book. He was apparently both a correspondent and in the army at the same time and was captured by the Boers and spent some time in a prison camp (from which he escaped).

I think the Spanish have the dubious honour of being the first to employ concentration camps but the Brits, employing a scorched earth policy as a final resort against the Boers, put all the women and children in poorly sanitised camps, where 26,000 women and children died. Curiously, the champion of their rights was an English woman, Emily Hobhouse, who today is still honoured by the Boers. Emily was eventually refused entry into the Cape by the military authorities and was sent home in the ship in which she had arrived. A fine example of Pax Britannica.

@D.C.Sessions: After all, they're redundant: kill nine out of ten of them and the tribal birthrate doesn't drop worth mentioning. ... Those who somehow fail to get killed go on to reproduce.

This assumes that all those departing soldiers were virgins who hadn't participated in any predeparture boinkage. Is that how the contingencies really operate? The whole system leverages aspects of sexual selection. Look at the 'I love a man in uniform' posters from WWI. The cultural reinforcers were all about getting comely, fertile young women to shun with unconcealed disdain slackers who wouldn't sign up for duty, and fall madly in love with brave young warriors who would. The military obligingly sets Johnny up with several weeks of training in an isolated location so his darling can only keep her ardor alive with love letters.Then he gets one last leave before shipping out, perfectly designed for a last-minute wedding and a quick honeymoon (or maybe an accidental honeymoon without a wedding!), so by the time his ship leaves there's a bun in the oven and the next generation of fighters is ready whether Johnny comes marching home or not. Remember, it's really all about whether the genome replicates; after that, as you say, Johnny's redundant.

I've got to admit, I'm all for comely young lasses falling for guys with high I.Q.s, as well as a willingness to use it. It would've probably made my life a lot easier. But, then again, maybe I'm just bragging or "got lucky" taking a test or twenty. My point, however, is that if you look at it from a biological view point, it would seem that evolution would select for men with the best qualities for protecting pregnant women and young children. Let's face facts, running away might be the best survival strategy and fighting is really stupid. But, pregnant women and young children aren't very fast. Many women are attached to those kids and would prefer a brave male who is not abusive towards them or their kids. Therefore it would seem natural selection would choose for men willing to die or be maimed to protect their progeny and the progeny of the tribe. Of course, even better would be males who were willing to die or charge into hell to protect, but came back alive, due to their fighting prowess. Of course, ultimately, intelligence, not brute strength wins the battle. As indicated by this post which discusses changing tech and medical care given to the wounded. The smarter you and your tribe are, the more of the enemy you can kill and the greater your chances of survival, even with extensive injuries.

The Boer War had one interesting result - the futility of the old tactics became apparent and the result was a change in thinking about how war was to be conducted.

One officer, Ernest Swinton, wrote the Defence of Duffer's Drift

http://en.wikipedia.org/wiki/The_Defence_of_Duffer%27s_Drift

a treatise meant to change the way young officer's approached tactical problems.

ChicagoMolly@35:

Yes, that's how the Powers In Charge put the instinct to use. I was referring, though, to what I observe which may well be hard-wired into the species.

Marktime: That's pretty accurate, but only part of the story.

The good news (for the Brits): It is very easy for it to sound all bad ... the word concentration camp all by itself can do that, although we must remember these were not explicitly extermination camps ... but it is also true that the Boer fighters were at least as responsible for continuing the war as any other factor, and the way they were starting to do this was to disappear back to the farms and just be farmers while someone was looking then to reappear as belligerents. Looking at it from the British perspective at the time, the blockhouse lines, scorched earth policy, and concentration camps can not really be seen as a purely evil strategy.

The bad news: The numbers you give are typical and correct for the WHITE concentration camps. There were also Black concentration camps, which had far more people in them, were much more enigmatic as to why the even existed, in which far more people probably died, for which there were no advocates at the time, and which are to this day less known about or of than the Boer concentration camps.

The saddest thing about it all is this: If you look at why the war started, why it was fought, and how things existed say 20 years after the war ended ... well, the Anglo Boer War may have been the single most senseless war fought in the history of modern Western warfare.

Sadder still, Greg, was the bitterness carried over from that scorched earth policy. It contaminated Afrikaaner politics allowing an extreme right wing nationalist party to articulate the rage for those past atrocities, leading eventually to a hard right attitude to race, and the rest is history.

Actually, little was learnt in terms of tactics from the ABW, allowing generals (from the aristocracy, of course), to send waves of infantry against well entrenched machine gun positions in WW1 which led to a level of slaughter that is beyond our comprehension today.

BTW, I'm a Brit.who has known the very best of who the Afrikaaners are.

Marktime: I'm not sure how it matters, but I count among my very best friends in the world ever, among my close colleagues, and just plain people I like or know and respect, South Africans who are Afrikaner as well as all sorts of other South Africans. (I've worked in South Africa for years.) The situation today in South Africa is self consciously divorced (by most people that I know) from the past at a certain level of discourse in order to get some distance and perspective.

I won't totally disagree with what you said, but but I need to point a couple of things out about your statement to contextualize it more or it could be easily misunderstood.

First, make no mistake that the standing policies and attitudes of Boers in Transvaal and to a (somewhat) lesser extent Orange Free State (those are the two countries fighting with the Brits at the start of the war) and the Cape Colony (a British Colony with lots of Boers in it where some of the fighting happened as well) were not even close to devoid of racist and generally atrocious presumptions. It would be very incorrect to read this as a situation in which the seeds of Apartheid lay dormant and minor and were it not for the British atrocities during the Anglo Boer War they would have never sprouted and flourished. Pretty much all of the policies that were later formalized in the named apartheid government of later times were all in place, and no, they were not just typical "white colonialist" manifestations. They were a special and rather insidious, not entirely unprecedented but for the late 19th century very much outdated and relatively nefarious version of racism.

At the same time, it is not true (in case anyone might have thought this from what I just said) that the British invaded Transvaal and OFS for the purpose of overthrowing a racist government. Well, they did actually do that quite explicitly, but the "race problem" that they percieved was the Boer race kicking around the non-Boer white races (mainly bits, but lots of Americans and others too). (This was explicitly, at the time, supposedly a "white man's war").

I don't see any evidence that the racist oppressive Afrikaner government that grew up during the middle of the 20th century happened because of the AB war. (I'm not necessarily saying that you were suggesting that either.) The details may have been different, but when I read what the Boers were saying and doing from the earlies days up throgh, say, 1980, is see a more or less straight line with the AB war not turning that line one way or another. (And I oversimplify only a little!)

"well, the Anglo Boer War may have been the single most senseless war fought in the history of modern Western warfare. "

Even more senseless than WWI?

That is saying a lot.

a lurker: Well, I suppose it all depends on what we mean by "sensless" (and even as I wrote that I wondered what I was up to...)

Let's change "senseless" to "Inexplicable and without effect."

WW I at least had a large effect on the nature of nations. The ABW may have had an effect on the nature of colonialism, but mostly a redundant one.

But what I was really thinking was that to which I refer in my comment above. If you look at European history and imagine it without WWI, do you still get, say WW II? No. (Probably). If you look at southern African History without the ABW, do you still get Namibia and the war there, Rhodesia's war, Apartheid, and so on? Yes. (Probably).

Thank you for an interesting topic. I'm off to the Kruger next month for four nights in the bush. Eat your heart out: :-)

And to continue the meme, in another war, in the Sudan:

"Weep not my boys, for those who fell,
They did not flinch nor fear.
They stood their ground like Englishmen,
and died at Abu Klea".

I guess that to get the business loans from creditors you must have a firm reason. However, once I've got a consolidation loan, because I was willing to buy a car.

Memetics of Meaning, Memory and Me: The minefield of the annoying or endearing mannerism

gregladen — Mon, 20 Jul 2009 12:03:25 +0000

Memetics of Meaning, Memory and Me: The minefield of the annoying or endearing mannerism

Did you ever notice how some verbal expressions have an extra meaning for you, just you, because of history? In reflecting on this, it is impossible to not consider such lofty topics as memes, cultural transmission, and ... well, meaning. A particular expression might invoke a memory of an event, or of a person who often uses that expression. That can be a pleasant experience, or an unpleasant one. If you know what I mean.

A moment or two ago a person who could only be described as annoying, whom I do not personally know, corrected me on Facebook. I had responded to Carl Zimmer's lament that he was unable to look back at Facebook entries, RSS feeds, and so on that had accumulated during his one week vacation. My comment was simply to say that absolutely nothing had happened over the previous week, so he should not worry. Obviously, I was kidding. But Mr. Annoying had to jump in with some news items that had in fact happened, with the implication that these news stories were very important to him and I was really bad for suggesting that it had been a slow week.

He started his Facebook troll-comment¹ with the phrase "Not so..."

It turns out that² I can't hear or read a comment that starts with "Not so..." without getting real annoyed because it is a verbal expression that has extra meaning to me.

This extra meaning comes from a guy I knew when I was very young. Ten years old plus or minus one, I would say. He was a man of about twenty two who did his hair and beard up to look exactly like the standard Western depiction of Jesus Christ. One time, while staring at my aunt, who was a Franciscan nun, he simply said to her "Do I remind you of someone?" She thought for a moment and answered "Yes, actually, you remind me of a DJ I know in Hawaii," and kind of grinned.

Anyway, he was trying to court my sister, and he was a councilor at the boys camp next to the state camp ground my family would live on for the months of May and June most summers. No matter what I ever said, he'd respond "Not so..." and then tell me how I was wrong.

I was rarely wrong, so this was especially annoying. I was just a kid, and he was Jesus Christ, so he probably figured I was wrong all the time by default, but little did he know that I was one of those obnoxious precocious smart kids who in fact had already read his first encyclopedia and was about half way through his second, which he was carefully and sincerely doing just so that some day he could say "Oh. Encyclopedias. Yeah, I read a couple of those..."

So, if you say "Not so ... bla bla bla" to me I'll rarely hear the bla bla bla, I'll think of this obnoxious guy (well, I think my sister liked him, but she was a teenager at the time so that does not mean much) and I won't be listening to the rest of your sentence. Rather, I'll be pleasantly recalling in my mind the fate that eventually came to Jesus Christ. Which was, if you must know, this: The boys at the boys camp, many of whom had been sent there by their parole or probation officers, were also annoyed by Jesus Christ. So one day he walked in after lights out to make sure the kids were all in their bunks, and some kids dropped on him from the rafters of the crudely built dormitory, tied him up, and shaved off every bid of hair on his head. I think they even plucked his nose hairs out for good measure.

So, that what i'll be thinking about. You, de-haired.

I have a more pleasant example: "That makes me laugh."

Last night, I was having coffee with Lizzie, and we were talking about her life and her plans for the next few years, which could involve moving. So we were talking about how representative New York City was of the rest of the east coast, and this got me on to a topic I often bring up which is how to know a phrase or mannerism is particular to an individual, vs. regionally or subregionally used. When I first moved to Minnesota, I already knew about certain Midwestern mannerisms, because I had lived in the Midwest for a while a couple of years earlier. So when people started randomly talking to me in the video rental store, I knew this was a Midwestern thing. I quickly learned that Minnesotans, uniquely and to the exclusion of Wisconsinites, reversed the meaning of "yet" and "still" compared to people on the east coast.

But there were other things I was not so sure of, and several of these came from my BFF Stephanie, who is the first person who took the time and energy to really show me around The Cities. She would say, for instance, "that makes me laugh" quite frequently (but at appropriate times). I didn't know at first if "that makes me laugh" was her or Minnesota or the Midwest. After a while I concluded that it was Stephanie. But then I met my wife and her sister, and they said it too, and then I noticed that occasionally Amanda's brother says it, and I heard a couple of their old high school friends say it. So I now realize that this is a Western Suburb (Golden valley, Plymouth, Hopkins) thing of a particular generation. It probably spread among these folks in high school.

I don't hear many people say "that makes me laugh" but I use the phrase myself in my writing. When I do, that means that I'm thinking of Stephanie. So now when you read my stuff, you'll know that.

I mentioned all this to Lizzie, pointing out that she does not have any western Twin Cities mannerisms because she is from the eastern Twin Cities. As I said that, she was twirling the end of the single braid of brilliantly red hair that came down from her feathered head dress, which nicely complemented her shamanistic necklace and her home made little black dress. Then I thought ... wow. Lizzie has no mannerisms. So that is the second unique characteristic that makes me think so highly of her. "Actually, I think all your mannerisms are from Berkeley, California. Have you ever lived there?" I asked her. "Not yet," was her reply.³

There are a whole bunch of blogospheric expressions that have emerged fairly recently that invoke particular meaning for me. The phrase "to call one out" in one form or another is particularly annoying to me no matter who uses it because it invokes the idea of the self righteous judgmental twit who thinks it is his or her job to patrol the blosophere for people who say or do certain things (whether they really do or not), then drag those individuals into the public square for some kind of blogflogging. The negativity arises, of course, from the fact that the first twenty or so times I heard the expression, it was me that was getting "called out!"

"As it were" reminds me of an old friend who used that expression, with irony, all the time. The construction "it is doing" for the English habitual "it does" reminds me of two or three European friends and their semi-broken English. Walter Cronkite's "And that's the way it was" is almost identical to the Efe Pygmy expression that ends most short story segments. That makes me laugh.

Am I the only person who experiences mannerism flashbacks?

_____________________________

¹It is of note that I am very rarely annoyed by anything anyone says on facebook. But I am often annoyed by comments on my blog. I suppose on facebook ... well, those are my friends.
²This expression always makes me think of Terry Deacon.
³That was totally paraphrased.

gregladen Mon, 07/20/2009 - 08:03

Tags

Am I the only person who experiences mannerism flashbacks?

Not so. I come from an Acadian French family and often befuddle Jodi with mannerisms picked up from ages hence, as it were. She frequently calls me out on them, yet I still do them from time to time. This makes me laugh.

ACK!!! ... even though I should have been prepared for it, that "NOT SO" totally got me. Totally flashed on Jesus. Well done. Good to get fooled form time to time.

Not to call you out or anything (as that I have no desire to publically blogflog you (or privately for that matter)) but what is your third footnote in reference to? Perhaps I have been at work too long, but I don't seem to see anything being referenced in the article.

Eric: sorry, fixed now. Footnote three is about the dialog between lizzie and me regarding berkeley

Given that Montaigne might have written this essay (in a different style of course; and with a few anachronisms fixed up), how does memetics fit in here?

I grew up in the Eastern Suburbs, and I'm pretty sure we said "that makes me laugh" too. At least, I have a distinct memory of a conversation in which it was pointed out that the phrase was often used in lieu of actually laughing. Unfortunately, I can't remember who else was part of the conversation, so I'm not sure if it was during high school (White Bear Lake), college (Minneapolis) or grad school (Northern CA).

Oran: What do I know???

But seriously...

Memetics does have to come to terms with mechanism, which it tends not to (or I should say the writing about it tends not to). So if an expression has a certain neutral meaning, but its actual use can invoke an emotion or secondary meaning in a given individual because of history, well, that is a powerful mechanism that can strongly influence memetic transmission.

So, consider two of the key examples I gave here. You are not going to hear me using the term "Not so" because it repulses me, so I'm a dead end for that. But I'm whimsical and positively emotional about "that makes me laugh" so I use it a lot. In fact, as I've been fielding comments on this post, I am writing a long Linux related essay that opens:

It is often said that "Linux would be better if you didn't have to use the command line" or "Linux would be usable on the desktop if you didn't have to use the command line" or "If only ... Linux .... command line ... my grandmother .... just click on it..." and so on.

This makes me laugh.

So, I'm constantly bathing all eleven of my readers in a gentle, positive, funny, replicator made up of that phrase.

At a more subtle level, and here we are not just in memetics but more broadly in semiotics, we are talking about the development of intrinsic meaning that can happen as words and phrases go along in time.

JenW: There are White Bear people who read this blog so they can tell us if they remember "it makes me laugh" in that context. It will also be interesting to hear from the Lake Elmo people. Lizzie is more rural Stillwater, although now very firmly planted in South.

It could be that since you were talking about it, it was meta, and thus introduced. There is said to be a small amount of leakage between Minneapolis and its suburbs and Saint Paul and its suburbs, though I personally think this is inconceivable!

Greg: you keep using that w-AW DAMMIT, that's a meme too isn't it?

Jason, you think that I want you to think that I think that is a meme, but in reality, I think you are thinking that Im' thinking that I want you to think that it is NOT a meme, so ....

Crosstalk between Minneapolis and St Paul??? Oh no. It simply isn't done.

I don't remember "That makes me laugh," but that doesn't necessarily mean it wasn't present in Stillwater (Lake Elmo counts here, since the high school was in Stillwater). In school, I hung out with kids who spelled "gray" with an "e" and never saw an "or" they didn't think should be interrupted by a "u." We spoke a weird mix of archaic and modern English with a bunch of private jokes thrown in.

Also, I did not graduate anywhere near the same time Amanda did, as far as trends go. That age difference will make a difference. She probably has no traces of Valley speak in her vocabulary. I do.

JenW, you up for saying when you graduated WBL?

Finally, Greg, I'm very amused at how...differently we use some common phrases, as it were.

To each his own.

Oh, and let's not even talk about phrases the nuns used to use....

Hi Stephanie! I graduated WBL in '93, with Ana. I also (like Ana) went to elementary school with Ben (hi Ben!).

This is a great post, Greg. I get very annoyed when people around these parts start a sentence with "Say?" as a way of introducing a question or asking/telling me to do something I usually don't want to do. It's almost never good. "Say? Can you re-write those 400 pages?" or "Say? we were thinking of raising the rent." It's even more annoying when I catch myself doing it.

A friend who grew up in upstate NY always says "You make me smile" or "that makes me smile" at the end of almost every sentence and I do not mind one bit, and have kind of adopted it myself. But, I find the phrase "good on ya" sets my teeth on edge.

My Scottish brother-in-law often substitutes "but" for "though" at the end of sentences, even if the "though" would be somewhere in the middle. It took me years to figure out what he was trying to say.

On another note, my girlfriend has a BA in linguistics, and I have a passing interest in it, so we often marvel at how thoroughly we can mangle the English language and still convey very precise ideas to each other. For example, saying "thbldlbldlbld" while wiggling my finger passed as a synonym for doorstop the other day.

Greg @10: I'm not going to say what you expect me to say, not the least reason which being it'll inflate your ego.

itzac @16: I will substitute "thing" for nouns, verbs, or even entire sentences sometimes. I'm understood maybe at best half the time.

The very closest I came to getting beat up by bullies as a kid, was the result of my using the phrase, "as it were." I probably would have been, but my next eldest brother was around and he didn't take kindly to anyone but him beating on me. I have used that phrase for my whole life, as it were...

And in a fit of true strange, I get rather teeth-grindy, whenever someone says "not so." It totally smacks of condescension of the highest order, right there with fucking bastards who refer to me as "Mr. Brayton." I don't allow small children to refer to me as that and sure as hell won't put up with it from grownups who should fuckingwell know better. "As you know," is also in that category, just below "as we know." Because what nearly everyone who uses either means is, "as I know and you would, if you weren't an ignorant fucking moron." Personally, I am far less offended by being called a fucking moron.

Monica -

I actually get rather gritty at "good on ya" too, but that's mainly because whenever I use it, it is usually to congratulate someone for fucking something up... And in spite of - or more probably because I hate it, Hate it, HATE IT!!!!11!!! when people use the phrase; "Say what?," I end up using it most of the time when I need someone to repeat themselves. And given the variety of methods by which I have damaged my hearing over the years, that is rather often...

Any time, anyone starts a sentence with the word âOneâ as in âOne can never really know if a rock has feelingsâ, I have flashbacks to my asshole, all knowing, freshman roommate. That's OK though, because anyone that actually does that is an asshole and probably deserves to be punched in the face. I'm looking at you Confucius.

Here's a related phenomena. Have you ever intentional used a word or phrase that is wrong or ridiculous in jest to the point that it no longer sounds wrong or ridiculous? Years ago my wife and I were seated next to a couple that used over the top luvy-wuvy, cutesy-wootsy language when they talked to each other. As soon as they left and were out of earshot, I turned to my wife and said, âI love you poopsy pants.â We haven't looked back.

Well one phrase that always get's me 'round these parts - Hella. Originally from Southern California, now living in central / northern CA, I swear it's every other word out of everyone under the age of 30's mouth. I can stand when people use the term a "hell of a lot of", which then became helluv, and is now pronounced hella. D

Heh.

Mmmm. It would seem to me that these phrases are replicands or replicates not replicators.

Any particular reason to assume these phrases replicate themselves rather than being replicated by human agents with particular motives, backgrounds, competencies, incompetencies?

If not I wonder if memes just aren't an unnecessary complication in the discussion, or, rather, an unwarranted simplification.

This: Any particular reason to assume these phrases replicate themselves rather than being replicated by human agents with particular motives, backgrounds, competencies, incompetencies?

is a question that can only lead to a methodological quagmire.

This: If not I wonder if memes just aren't an unnecessary complication in the discussion, or, rather, an unwarranted simplification.

applies an unfair test, born of a methodological quagmire, to the meme question.

Not that I'm defending memes or anything.

However, I will say that I don't assume that memes, to be something (useful, conceptually or otherwise) need to act like genes or to have a strong parallel in how they work to genes.

"Meme" might better describe language itself, or religion, or various other technologies whose laggard adopters and discontents are left at a competitive disadvantage. (Yes, I'm listing religion as a technology.) Military tactics qualify, as do agricultures. How and where they originate has less effect than how, and how widely, they are copied.

Not so, Nathan, but that makes me laugh.

Funny how facebook is more friendly, with the whole 'friend' thing, even if you have never met one of the friends.

I quickly learned that Minnesotans, uniquely and to the exclusion of Wisconsinites, reversed the meaning of "yet" and "still" compared to people on the east coast.

As we reverse as well the meaning of "salad" and "Jello"

I wonder if the expression "in process" is a Massachusetts thing? I've heard it from two different people since moving to the area. It's used like others use "in progress". "in progress" sounds ok to me as does "in the process of", but "in process" sounds odd.

I just want to note for the record that when Lizzie read all this and something I wrote just for her she told me "Greg, you crack me up"

Greg has an interesting phrase that he uses as well. I remember when we first started dating and he said he would drop me at the coffee shop. I'm glad he wasn't being literal or I would have had a broken bone or two!

Yeah, right, well, so, you Minnesotans! You say "shall I come with" or "shall we bring him with" or "I'll be going with" and so on and so on.

Makes me laugh.

Oh, you two are so cute. You crack me up.

"It needs washed". Ha. "It's too hot any more". Double ha.

Summer Reading List

sciencewoman — Wed, 10 Jun 2009 13:56:33 +0000

Summer Reading List

BrianR at Clastic Detritus introduced me to the perfect meme to wrap a tedious summer afternoon of work...What books are on my summer reading list? First let me say that *love* summer and breaks because I've always associated those times with a chance to do some of the reading that I've never managed to keep up with during the semester. And I don't just mean the teetering pile of journal articles on my file cabinet, but also the teetering pile of books near my bed. I hate paying good money for a book and then letting it sit around for years unread. Plus, with my blogger schtick I feel like I should review some of the blog-relevant books I read. So I'll divide my list into two parts: (1) books I've read and need to blog; (2) books I'm hankering to read. I *know* I won't get through all of either list in the next few months, those journal articles waiting to be read and written will suck me away from the pleasure reading. (Yeah, I'll also be busy blowing bubbles, splashing in the pool, building Duplo towers, and collecting new results in the field and lab.) So without further ado, the optimistic view of my summer book reading and blogging

Books I've Read and Been Meaning to Blog

Mama, PhD
The Open Laboratory 2008
The Best American Science Writing 2008
The Best Science Writing of 2007
Field Notes from a Catastrophe: Man, Nature, and Climate Change by Elizabeth Kolbert (most of the way through this one)

Books I'm Hoping to Read (and then maybe blog)

Last Child in the Woods: Saving Our Children From Nature Deficit Disorder by Richard Louv
Unscientific America: How Scientific Illiteracy Threatens Our Future by Chris Mooney and Sheril Kirschenbaum (of The Intersection)
Motherhood, the Elephant in the Laboratory
Sense and Sensibility by Jane Austen
The Omnivore's Dilemma by Michael Pollan
Dirt: The Erosion of Civilizations by David Montgomery

What's on your reading list?

sciencewoman Wed, 06/10/2009 - 09:56

Tags

Books

Book reviews

memes

wow, I really don't know how you have time to read, I'm always amazed by everything you do. If I'm reading something other than a journal article, it's a kids book (with Z) or a cook book... or a blog :)

I actually just got done compiling a tentative summer list. Pretty sure I won't get nearly as close to done as I want to, but it's exciting nonetheless. Afraid my summer list doesn't even make a dent in my constantly growing Amazon wishlist. :(

Hey! I'm reading Last Child in the Woods, too! (I've been working on it for four months or so. I should blog the story about why I didn't manage to finish it over spring break... it involved the Small Human and the Grand Canyon.)

You're me - in reverse.

I've read all of the books on your "to read" list, and none on your "read" list.

I have therefore decided to co-opt your "read" list as my "to do" list. Thanks for compiling this for me, ScienceWoman!

oh crap, you reminded me that Omnivore's Dilemma was on my list last year and I never read it ... oh, and Dirt looks good too! Can I quit my job and read?

Omnivore's Delimma and Sense and Sensibility are both really quick reads, especially considering their length.

I should make a list this summer, mostly it's just a growing pile of books sitting on my bedside table...

I started Omnivore's Dilemma but had trouble with it. I think I have trouble with nonfiction books where the authors are in love with their own style of prose. So even though I appreciate Pollan's message, it's hard for me to read his stuff.

I highly recommend Sense and Sensibility :).

And I look forward to adding the other books on your list to my own!

BikeMonkey's Best/Worst Cover Song Meme

terrasig — Sat, 30 May 2009 14:14:19 +0000

BikeMonkey's Best/Worst Cover Song Meme

I was tagged with a meme by BikeMonkey (whose initials "BM" make me laugh) at Sun Dappled Forest a few days ago but didn't have a chance to get to it.

Post your best/worst covers and tag some more muppethuggers. Oh and do a linkback to whomever tagged you if it wasn't me.

In the meantime, several of those tagged have posted many of those songs that the world agrees are among the best covers of all time: The Jimi Hendrix Experience's "All Along The Watchtower" is phenomenal and so beyond comparison that even its creator, Bob Dylan, is on the record as loving it so much that he adopted Hendrix's arrangement.

It overwhelmed me, really. He had such talent, he could find things inside a song and vigorously develop them. He found things that other people wouldn't think of finding in there. He probably improved upon it by the spaces he was using. I took license with the song from his version, actually, and continue to do it to this day.

Then my dear friend Isis The Scientist tagged me yesterday. So, I figured I'd better get to it.

So, I took BikeMonkey's tag of your best/worst covers from the standpoint of what covers mean the most to me. For the one I like best from over (uh, several) decades of music listening, I selected Wilco's cover/composition of Woody Guthrie's "Remember the Mountain Bed."

Many of you have probably not heard this song and it doesn't exactly classify as a cover. The lyrics were written by Woody Guthrie in 1944 with a very sparse framework of what he wished the music to be. Not until 1999 was a full arrangement put to it by Jeff Tweedy and former Wilco colleague, Jay Bennett.

I pick this one for a number of reasons.

I have been completely fascinated by the Billy Bragg/Wilco project envisioned during the 1990s by Guthrie's daughter, Nora (a nicely enlightening interview here). Hundreds of Guthrie lyrics had lain unrecorded in the Woody Guthrie Archives in New York City and Billy Bragg and the members of Wilco did an extraordinary job on writing music and performing more than two dozen of these. Recorded on the albums Mermaid Avenue and Mermaid Avenue, Vol. II, the songs also feature performances by Natalie Merchant and Corey Harris.

Listening to words put to music 55 years later jazzes me beyond belief. In fact, I encourage you to read the lyrics of "Remember the Mountain Bed" before you even hear it put to music. (Lyrics here but you can also play at the top of the page the version recorded on Mermaid Avenue Vol. II). It's pretty easy to appreciate why Tweedy and Bennett would've wanted to put this one to music.

Second is that Woody Guthrie, voice of the oppressed for social justice, is not very well known for his romantic songs, yet his lyrics of love are perhaps among his best. PharmSis bought me the book Woody Guthrie Artworks a couple of Christmases ago and I was blown away by Guthrie paintings and passion for life. So I really enjoy learning unique sides of historical figures that are masked by their primary reason for fame.

Third, is just simply that this song has taken on several different meanings for me over the 10 years since it was first performed. Having lived in the mountains, although not those in California that I believe were the inspiration for Guthrie, the song represents for me an array of emotions in speaking of a love of nature, life, and a woman, as Guthrie speaks to us over the years as an individual and as a representative of common wishes of us all. The timelessness of the lyrics are self-evident.

Finally, Tweedy and Bennett gave these beautiful lyrics the most tender treatment. A beautifully fingerpicked central acoustic guitar run is repeated throughout the song to provide a moving yet simple backdrop to these amazing lyrics. The album version includes a lovely piano and and Hammond B3 organ by Bennett to accompany Tweedy's guitar.

Here is a version the Tweedy performed solo in 2005:

Oh, and I really hate to adulterate this post with my pick for the worst cover: William Shatner's cover of The Beatles' "Lucy in the Sky With Diamonds."

And as I realize how long it took me to get this, I'll be gentle and not tag anyone else. However, consider all of yoursevles tagged should you wish to join in and let us know of your votes for best and worst cover songs.

terrasig Sat, 05/30/2009 - 10:14

Tags

http://www.youtube.com/watch?v=ZQaBGSxvNrI
Best cover ever!
Powerful Pete Seeger song turned into a thunderous rock song that gets me dancin' (and I can't dance worth a damn).

Worst cover ever: http://www.youtube.com/watch?v=ZQaBGSxvNrI
I actually like some of the Carpenters' stuff, but this cover absolutely blows...

Of course, the link for Worst Cover is here: http://www.youtube.com/watch?v=AHfddvbKb4w

I have no idea how that happened...

T. Bruce: I have to admit that I find all covers by The Byrds to be outstanding. Speaking of Pete Seeger, "Turn! Turn! Turn!," comes to mind, although Seeger essentially lifted it from the Book of Ecclesiastes 3:1.

Their version of Mr Tambourine Man is another great Dylan cover - Dylan wrote something like 8 or 9 verses and McGuinn selected the best. The Byrds are the entire reason I bought a 12-string.

My vote for best cover would be Simon and Garfunkel's "Scarborough Fair". The original is a ca. 14th century English folk song, in which the singer sends a message to his ex that if she does a series of impossible things he'll take her back.

The worst? Harder to say, but I'll vote for Gang Green's version of "Voices Carry", originally by 'til Tuesday. I'll spare you the link.

Now that you mention Mr Tambourine Man, The Cpt Kirk version must be down there. Worse than the Lucy In The Sky...

Eric's tip for Scarborough Fair puts me in mind of She Moves Through The Fair. Another folk song done up by All About Eve.

My fave covers are;
The Mission - Tomorrow Never Knows, but they also did a great Like A Hurricane.
Souixsie And The Banshees - Dear Prudence, but they also did The Passenger.
Mudhoney - Pump It Up.

Discover disco covers:
Lost In Music - The Fall.
I Feel Love - Balaam And The Angel.
We Are Family - Babes In Toyland.

Book Meme - From Sciencewomen

thusspakezuska — Thu, 26 Feb 2009 18:20:23 +0000

Book Meme - From Sciencewomen

To avoid a paper review I should be working on...

Via Sciencewoman at Sciencewomen, the BBC Book Meme. Using the second list she has posted, supposedly the actual BBC book list. The ones I've read are in bold. I didn't bother starring the ones I plan to read, since my "plan to read" bookshelf is probably several miles long. Good intentions, we all know what road they pave. List is below the fold.

1. The Lord of the Rings, JRR Tolkien
2. Pride and Prejudice, Jane Austen
3. His Dark Materials, Philip Pullman
4. The Hitchhiker's Guide to the Galaxy, Douglas Adams
5. Harry Potter and the Goblet of Fire, JK Rowling
6. To Kill a Mockingbird, Harper Lee
7. Winnie the Pooh, AA Milne
8. Nineteen Eighty-Four, George Orwell
9. The Lion, the Witch and the Wardrobe, CS Lewis
10. Jane Eyre, Charlotte BrontÃ«
11. Catch-22, Joseph Heller
12. Wuthering Heights, Emily BrontÃ«
13. Birdsong, Sebastian Faulks
14. Rebecca, Daphne du Maurier
15. The Catcher in the Rye, JD Salinger
16. The Wind in the Willows, Kenneth Grahame
17. Great Expectations, Charles Dickens
18. Little Women, Louisa May Alcott
19. Captain Corelli's Mandolin, Louis de Bernieres
20. War and Peace, Leo Tolstoy
21. Gone with the Wind, Margaret Mitchell
22. Harry Potter And The Philosopher's Stone, JK Rowling
23. Harry Potter And The Chamber Of Secrets, JK Rowling
24. Harry Potter And The Prisoner Of Azkaban, JK Rowling
25. The Hobbit, JRR Tolkien
26. Tess Of The D'Urbervilles, Thomas Hardy
27. Middlemarch, George Eliot
28. A Prayer For Owen Meany, John Irving
29. The Grapes Of Wrath, John Steinbeck
30. Alice's Adventures In Wonderland, Lewis Carroll
31. The Story Of Tracy Beaker, Jacqueline Wilson
32. One Hundred Years Of Solitude, Gabriel GarcÃa MÃ¡rquez
33. The Pillars Of The Earth, Ken Follett
34. David Copperfield, Charles Dickens
35. Charlie And The Chocolate Factory, Roald Dahl
36. Treasure Island, Robert Louis Stevenson
37. A Town Like Alice, Nevil Shute
38. Persuasion, Jane Austen
39. Dune, Frank Herbert
40. Emma, Jane Austen
41. Anne Of Green Gables, LM Montgomery
42. Watership Down, Richard Adams
43. The Great Gatsby, F Scott Fitzgerald
44. The Count Of Monte Cristo, Alexandre Dumas
45. Brideshead Revisited, Evelyn Waugh
46. Animal Farm, George Orwell
47. A Christmas Carol, Charles Dickens
48. Far From The Madding Crowd, Thomas Hardy
49. Goodnight Mister Tom, Michelle Magorian
50. The Shell Seekers, Rosamunde Pilcher
51. The Secret Garden, Frances Hodgson Burnett+
52. Of Mice And Men, John Steinbeck
53. The Stand, Stephen King
54. Anna Karenina, Leo Tolstoy
55. A Suitable Boy, Vikram Seth
56. The BFG, Roald Dahl
57. Swallows And Amazons, Arthur Ransome
58. Black Beauty, Anna Sewell
59. Artemis Fowl, Eoin Colfer
60. Crime And Punishment, Fyodor Dostoyevsky
61. Noughts And Crosses, Malorie Blackman
62. Memoirs Of A Geisha, Arthur Golden
63. A Tale Of Two Cities, Charles Dickens
64. The Thorn Birds, Colleen McCollough
65. Mort, Terry Pratchett
66. The Magic Faraway Tree, Enid Blyton
67. The Magus, John Fowles
68. Good Omens, Terry Pratchett and Neil Gaiman
69. Guards! Guards!, Terry Pratchett
70. Lord Of The Flies, William Golding
71. Perfume, Patrick SÃ¼skind
72. The Ragged Trousered Philanthropists, Robert Tressell
73. Night Watch, Terry Pratchett
74. Matilda, Roald Dahl
75. Bridget Jones's Diary, Helen Fielding
76. The Secret History, Donna Tartt
77. The Woman In White, Wilkie Collins
78. Ulysses, James Joyce
79. Bleak House, Charles Dickens
80. Double Act, Jacqueline Wilson
81. The Twits, Roald Dahl
82. I Capture The Castle, Dodie Smith
83. Holes, Louis Sachar
84. Gormenghast, Mervyn Peake
85. The God Of Small Things, Arundhati Roy
86. Vicky Angel, Jacqueline Wilson
87. Brave New World, Aldous Huxley
88. Cold Comfort Farm, Stella Gibbons
89. Magician, Raymond E Feist
90. On The Road, Jack Kerouac (listening on cd counts, right?)
91. The Godfather, Mario Puzo
92. The Clan Of The Cave Bear, Jean M Auel
93. The Colour Of Magic, Terry Pratchett
94. The Alchemist, Paulo Coelho
95. Katherine, Anya Seton
96. Kane And Abel, Jeffrey Archer
97. Love In The Time Of Cholera, Gabriel GarcÃa MÃ¡rquez
98. Girls In Love, Jacqueline Wilson
99. The Princess Diaries, Meg Cabot
100. Midnight's Children, Salman Rushdie

42, unless I miscounted. Not bad, I guess. Though maybe I wish I had back that time out of my life I spent reading "The Clan of the Cave Bear" and "The Stand".

thusspakezuska Thu, 02/26/2009 - 13:20

Tags

memes

That's a rather impressive list of things you've read. And 42 is the magic number, so I guess you better move off o the list and on to the rest of your to-read shelf.

I counted forty-one titles on this list that I've read, and the number is probably higher, since I've read some of the Harry Potter series; I'm just not sure of the titles. I'm with you on Clan of the Cave Bear and The Stand.

I've read 37, and there are another four or five that I started but didn't finish including Clan of the Cave Aargh Make It Stop.
If you're in the mood for book memes, consider yourself tagged with this one!

I've read far less of those than you, but it did give me an idea, to send out a shortened meme list and let it mutate. I hope you don't mind, I tagged you (since you gave me the idea)

http://ichthyes.wordpress.com/2009/02/27/best-loved-book-meme/

Aww, Zuska, you didn't like the "cave woman romances"? That said, it's gonna be a really, really dull day at the library when I choose to read any of the English Great (Dickens, Austen). To each her own! You might try the Thursday Next series, where our girl Thursday saves the world from inside books.

I second the Thursday Next recommendation! And the "Nursery Crime" books by the same guy.

artemis fowl is really cool. humorous and witty. i've read the series. worth it.

Wednesday night miscellany

laelaps — Wed, 18 Feb 2009 16:16:10 +0000

Wednesday night miscellany

There are a number of things I have been meaning to blog about during the past week but for whatever reason they kept slipping my mind. Here's a brief collection of some neat stuff that I should have written about earlier;

Michael Barton, author of the Dispersal of Darwin, was interviewed for the the BBC's Pods and Blogs! I am certainly envious. You can listen in here.

A number of paleo-artists active in the blogohedron have started a new carnival, ART Evolved. The first edition will be posted at Prehistoric Insanity on March 1, and I certainly encourage you to check it out (if not submit something to it)!

Paleontologists at the Page Museum have just announced a new collection of fossils recovered from the La Brea tarpits, including an 80% complete mammoth nicknamed "Zed." It sounds like they took in quite a haul and you can read some of the details here.

Blake recently published an excerpt from his book Until Earthset. It starts with "When the movie was finished, Devi was still very high, and she began performing an interpretive dance about viruses."

Scicurious has a great post about why she is a scientist. It's a great read, and my only lament is that I can't carry on the meme since I'm not a scientist.

Science & the City recently conducted interviews with the first class of the AMNH's Richard Gilder Graduate School students. It's an interesting look at what the program is like. If I had the chance to go to graduate school it would definitely be a place I would apply!

laelaps Wed, 02/18/2009 - 11:16

Tags

Blogging

memes

paleontology

I liked the story of the Page Museum's La Brea fossil collection the best. I've always been fascinated by the tar pits, even having a snap-together model of them as a child (which incorrectly featured a European wooly Rhinoceros!)

you are not a scientist? what defines a scientist, a degree or an inquisitive mind which conducts research?

In other Wednesday night miscellany, Ben did something EVIL on LOST. Shocked?

YOU ARE A SCIENTIST. You have scientific curiosity, you read and analyze previous studies on your topic of choice. Just because you are unable to uncover your own bones right now (or whatever) doesn't mean you're not a scientist. You totally are. Write it!

What scicurious said.

(Oh, and thanks for the link. Every bit of traffic helps!)

On Columbian Mammoths

Think you're so special.