Yes, you heard it here, folks.

Is it any wonder that HIV researchers are so outraged by these people?

Comments

  1. #1 Jeb, FCD
    September 19, 2007

    That is truly amazing.

    Why are these people like this? What is wrong with their brains?

  2. #2 SLC
    September 19, 2007

    Once again, I wonder how long it will take the HIV/AIDS denialists to hijack this thread.

  3. #3 Jim
    September 19, 2007

    Wow, that just seems… over the top. Is it fear of the disease itself that causes that kind of denialist, angry reaction?

  4. #4 Dan
    September 19, 2007

    Really, Tara,

    Michael’s latest comments were worth starting a thread over?

    Are you desperate? What’s up?

  5. #5 apyy
    September 19, 2007

    This just in, being a moron causes AIDS!

  6. #6 blf
    September 19, 2007

    Is it any wonder that HIV researchers are so outraged by these people?

    Nope, no wonder at all. Especially when the comment in question starts:

    Hello Tara and all of you HIV promoting Terrorists,

    That had me spluttering in rage before the first full stop (period to the USAians). “HIV promoting”? “Terrorist”? I sure as hell don’t wish HIV, or AIDS, or any disease on anyone. I godsdamn ain’t a terrorist or other criminal. But I am now enraged.

  7. #7 Carter
    September 19, 2007

    No, you idiots! Loneliness doesnt cause AIDS.. It’s a factor to an early death. Death by prescriptiona and indocrination into the death and dying club simply for nothing other than a measurement of non-specific antibodies.

  8. #8 Guitar Eddie
    September 19, 2007

    [Is it any wonder that HIV researchers are so outraged by these people?]

    No it isn’t, Tara. I’m not even a researcher and I’m outraged by this clown. I’m outraged because, at the present time, people like this Michael are able to get the ear of public officials.

    In that sense, HIV/AIDS denialists are becoming inimical to public health. Witness the public disaster that has become South Africa because Mbecki believes what these morons have to say.

    ER

  9. #9 Dan
    September 19, 2007

    Hello Tara and all of you HIV promoting Terrorists

    Let’s do the math…

    Are gay men and Africans terrorized by HIV/AIDS? Yes.

    Do Tara and her goon squad promote and support the HIV/AIDS belief system? Yes.

    Looks like Michael’s on the mark with this one.

  10. #10 jspreen
    September 19, 2007

    Is it any wonder that HIV researchers are so outraged by these people?

    Of course it is no wonder at all. HIV researchers know very well that loneliness cannot possibly be a source of disease, on the contrary: lonely people are never ill. Diseases are caused exclusively by physical things like a virus, tobacco, asbestos etc. and can exclusively be healed by other physical things like for instance life saving killer drugs.
    HIV researches know this because they search and then research and research and research over and over again which is why they know everthing about life and death and that’s why they behave like they behave when they read what Michael Geiger wrote what he wrote.

    I am not a HIV researcher and I personally think that what Michael wrote makes a lot of sense, but that makes no sense because I’m not a HIV researcher and thus do not know everything for sure.

  11. #11 Manu
    September 19, 2007

    test

  12. #12 M
    September 19, 2007

    hello

  13. #13 ElkMountainMan
    September 19, 2007

    Strangely, folks, I’m going to have to defend Michael Geiger on this one.

    Well, maybe not “defend,” but at least point out that the studies he cites are not complete nonsense like most of what he says.

    It is entirely plausible that stress, including stress caused by “loneliness,” involves physiological factors that include transcriptional changes, as Cole and colleagues suggest. Depending on what these changes are, they could theoretically lead to increased susceptibility to viral infection and disease progression.

    Of course, Michael Geiger goes too far (as usual). In the absence of HIV, “loneliness” can’t cause AIDS. Loneliness also will not have a “molecular signature” of HIV (i.e. lonely people won’t test false positive for the infection).

    It is an interesting study he brings up, though, and I’ll try to remind myself that “rethinkers” aren’t always completely wrong…just upwards of 99% of the time.

  14. #14 Tara C. Smith
    September 19, 2007

    …they could theoretically lead to increased susceptibility to viral infection and disease progression.

    But no one is doubting that. I’ve pointed that out to Michael several times myself, as have others here. However, “increased susceptibility” by itself =/= AIDS, despite Michael’s outlandish claim, and loneliness alone (or “fear”, or any of the other things Michael typically claim) does not cause AIDS.

  15. #15 SLC
    September 19, 2007

    It only took 2 hours and 26 minutes for whackjob Carter to show up.

  16. #16 Carter
    September 19, 2007

    SLC,
    WTF? Your opinion of me is none of my business!

    I watch these posts almost 24/7 so I can be reminded how completely and utterly insane the HIV/AIDS camp is and here complete with Tara, et al protecting their failed and bogus theories. It would be down right laughable if it weren’t for the mainstream establishment causing deaths from liver failure and drug testing, let alone the voodoo hex one receives by opting to take a bogus test.

  17. #17 apy
    September 19, 2007

    they could theoretically lead to increased susceptibility to viral infection and disease progression.

    I thought germ theory was a lie pushed by big pharma to sell more drugs?

    Read up on Bechamp, will blow your mind!

  18. #18 SLC
    September 19, 2007

    Re Carter

    “I watch these posts almost 24/7 so I can be reminded how completely and utterly insane the HIV/AIDS camp is and here complete with Tara, et al protecting their failed and bogus theories.”

    I guess that Mr. Carter is either retired or independently wealthy and has too much time on his hands. Mr. Carter, you should get a life.

  19. #19 apy
    September 19, 2007

    I watch these posts almost 24/7 so I can be reminded how completely and utterly insane the HIV/AIDS camp is

    Well at least we now know why your research has come so far and you’ve published so many papers on the true nature of HIV/AIDS.

  20. #20 Heather
    September 19, 2007

    Wait, wait, wait. So there are really people out there who truly believe that AIDS is caused by loneliness and that researchers are all just “collaborating their lies to fool the public”? Because, well, from what I’ve heard the only way two people can keep a secret is if one of them is dead. And that’s just TWO people…

    The denialism just blows my mind. I hope awe doesn’t cause AIDS next, or we’re all screwed.

  21. #21 cooler
    September 19, 2007

    This is a straw man argument Dr. Smith. I think what micheal was referring to is catastrosphic long term stress that accompanies an hiv positive test, nevertheless this “lonliness” argument does not represent the rethinker movement.

    The main reason many credible scientists doubt hiv is
    1) the lack of a relaible animal model, tons of chimps/mice were injected and they dont die of aids even after 20 years.
    2) The lack of a carefully controlled study that would be designed to see if if hiv positive people with no other possible risk factors get AIDS, risk factors that include the cell killing chemotherapy drug AZT, coinfections w/ mycoplasma incognitus, catastrophic stress, intense drug abuse etc.

    all the studies so far assume hiv is the cause of Aids, so they didnt do much to test gallo’s claim, if you want to prove me wrong please provide me with a study done by honest scientists that dont view dissidents as nazis that clearly states in the study aims ” a study to follow hiv positive people with no other risk factors to see if Gallo’s hypothesis is correct.”

    3) the low amount of blood tcell infection, which is around 1/1000 t cells

    4) The very low rates of transmission, the Padian study followed serodiscordant couples for years and who had all kinds of unprotected sex and there were 0 seroconversions!

    Many more reasons. Lurkers should do a google search and see a film called hiv fact or fraud that explains the positions well, its free.

    scientists that have doubted the hiv hypothesis at one time or another

    Peter duesberg phd retroviral expert, California scientist of the year.

    kary mullis phd Nobel prize winner, inventor of the PCR

    Shyh ching lo md phd cheif of the infectious unit of the armed forces of pathology

    Richard Strohman ucb mcb professor

    Harry rubin ucb mcb professor

    Walter gilbert nobel prize winner Harvard mcb professor

    Lynn Margulis phd national academy of sciences member

    many more………..

    I would suggest people read a book called Project Day Lily, this microbe called mycoplasma incognitus killed every animal injected (Dr. Lo injected mice primates and they all died) a riveting book by garth and nancy nicolson phds found out how it was part of the biowarfare program, found in some AIDs cases and in CFS etc, google it and read a chapter for free.

  22. #22 apy
    September 19, 2007

    nevertheless this “lonliness” argument does not represent the rethinker movement.

    What argument does? None of the ‘rethinker movements’ arguments have any coherence between them. Perth say HIV does not exist, but if it did it would cause AIDS. Duesberg says that HIV does exist but is benign. So which one does represent rethinker movement?

  23. #23 cooler
    September 19, 2007

    Also most viruses cause the most havok before antibodies, thats why we get vaccines, if there ever was an hiv vaccine wed all test positive……..sound strange!?

    yes i know there are exceptions but exceptions are not the rules, this is just one of the many strange anomolies that needs to be further investigated about the hiv hypothesis.

    see hiv fact or fraud.
    http://www.archive.org/details/aids_scam
    Read project day lily.
    http://www.projectdaylily.com/

  24. #24 Tara C. Smith
    September 19, 2007

    nevertheless this “lonliness” argument does not represent the rethinker movement.

    Hmm, a fellow denier states that there is no denial movement and chatises me for using the term. Funny when y’all who are involved in the [non-existent] movement can’t even get your stories straight yet again…

  25. #25 cooler
    September 19, 2007

    The Rethinker movement is simple, we dont know whether or not hiv is the cause of AIDS or not, it could be other things, more studies are needed by honest scientists.

    Just because it was announced at a press conference, a barely detectable no animal model microbe by gallo before the publishing of any evidence and the disbarring of dissent from that day on does not make the hypothesis true.

  26. #26 Epidemiology-LISA
    September 19, 2007

    Funny when y’all who are involved in the [non-existent] movement can’t even get your stories straight yet again.

    It’s Cuz there ain’t no movement and no unified front, get it now Mrs. smartypants? (-;

  27. #27 Adele
    September 19, 2007

    It’s Cuz there ain’t no movement
    says ELISA

    right after Ron Paul boy said
    The Rethinker movement is simple

    Try again guys?

  28. #28 Epidemiology-LISA
    September 19, 2007

    No you try again Leda. I know language is slippery, but you can try. We’ll leave out the thing about denialist movement, just come up with your definition of “movement”. C’mon, give it your best shot cowgirl.

  29. #29 cooler
    September 19, 2007

    Adele, aka kathy bates from the movie misery,
    Ron Paul voted against the patriot act and the Iraq war, unlike your fairy godmother hillary.

    the movement does not need to be defined to an exact stance…..do all people who support Obama or for gun control have to have the same views exactly? and if they don’t that nullifies evertything they say?……..some of you people need to take to critical thinking classes

  30. #30 cooler
    September 19, 2007

    or are for gun control

  31. #31 Adele
    September 19, 2007

    cooler you do know you have to be 18 to vote for Ron Paul don’t you.

    ELISA I just remembered you havn’et been around last few weeks so maybe you’ll be the ONE person whose got a answer about those Duesberg flaws from the other thread.

    So much talk from you people about how we’re all scared of Duesberg and we can’t find anything wrong with his crap.

    Then so many examples from us of where Duesberg lied or messed around with the truth.

    Then so much silence from your not existing movement!!

    Maybe you got some answers well read LISA from your nice greek mythology. Why did Duesberg lie? Is it ok he lied? Since like most of your not existing movement just copies off Duesberg isn’t that not a problem its lies??

    If you give us a good answer maybe i’ll even call you a rethinker.

  32. #32 Epidemiology-LISA
    September 19, 2007

    Adso girl, what’s the matter, was defining “movement” too hard for you?

    I don’t know what you are talking about re Duesberg and lying, but if it’s the anonymous or by proxy smear campaigns on AIDStruthorgy, I must confess I lost interest after Mr. Delaney’s learned inquiry into whether it cleared Duesberg of the suspicion of homophobia that he “was hanging around with leather-clad gay men”.

  33. #33 Epidemiology-LISA
    September 19, 2007

    . . . Although I would have to admit there are pretty convincing refutations of Duesberg’s scientific arguments posted on ADIStruthy. This one from Stephen Martin, Ph.D. Immunology, University of California, Berkeley is a real haymaker, which I have never seen countered satisfactorily:

    When the lights dimmed and the projector was turned on, Peter always moved close to the projector light beam so he could make hand puppets that projected on the screen. The students laughed, but the lecturers and most faculty members hated him.

  34. #34 Adele
    September 19, 2007

    No i’m talking about the introduction thread. Examples where Duesberg made up stuff to prove his theory. Doncha think that’s odd? Maybe makes your not existing movement look bad?

    Oh but it’s way more fun to make fun of people who criticise Duesberg then deal with the facts isn’t it ELISA?

  35. #35 Epidemiology-LISA
    September 19, 2007

    Oh now I understand what you are referring to. It’s these words by Tara in her latest variation over her one note

    One way to brush off novel evidence is to attempt to discredit the scientists carrying out the studies

    http://aidstruth.org/fanaticism.php

    I liked this one too:

    Scientists must engage more with the public or the HIV/Aids deniers will gain credibility (…) It is up to us to explain the science to the public

    When will it go up next to this one?

    We will not engage in any public or private debate with AIDS denialists or respond to requests from journalists who overtly support AIDS denialist causes

  36. #36 Adele
    September 19, 2007

    So no you won’t talk about the real stuff here ELISA. Duesberg lied and people died. Laugh all you want, doesn’t change it.

  37. #37 Epidemiology-LISA
    September 19, 2007

    Adso, you may think this is a laughing matter to me, but do you remember what the very serious secret was that the Benedictines were ready to kill for to keep from the public?
    http://www.ruinedendings.com/film3979plot

    By the Way, have you read the latest article by one famous epidemiologist revealing more denialist immorality? Here’s the headline and a relevant part of it:

    Dr. Smearah Tit exposes the Deadly Denial Virus.

    (…)

    Dr. Tit first realized something was afoot when she heard from fellow science fictionist Beanne A. Jergman that Christine Maggiore was not HIV positive.

    “I was outraged! Up until then we knew that denialism could be a co-factor in the development of AIDS. Prominent studies by Prof. J.P. Macaque and his Virus Veritas team had revealed multiple correlations between denialism and risk of premature death, or at least loss of job and funding. But with Maggiore our assumptions were clearly challenged by a case of HIV free slander. I was still outraged at this woman’s cheek, testing positive then negative just to make science look bad, but I was also intrigued: Was this a unique case of shameless dissembling or were there more people like Christine Maggiore out there? The more I thought about it the more evident it became that our firmly established HIV/AIDS hypothesis was in need of another ad hoc addition. Then, while I was reading an unusually inspiring scientific article about Maggiore’s despicable denialism, it struck me: Denialism itself must be caused by a transmissible virus, a Deadly Denial Virus”

    http://medicine.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pmed.0040256

  38. #38 SLC
    September 19, 2007

    For all the denialists on this thread, I would like to know when Prof Deusberg is going to take the injection of HIV positive blood which he promised to do? After all, if HIV is just a benign retrovirus as he claims, the injection shouldn’t have any negative affects. Unfortunately, all we get are excuses and alibis. It would appear that Prof. Deusberg has some chicken feathers where his competitive spirit should be.

  39. #39 Epidemiology-LISA
    September 19, 2007

    Adso you mule, the answer to the culture question was a comedy by Aristophanes. Now why were the Bendictines so afraid of Aristophanes?

    As for the interview, I’ll have you know that, unlike so many others, Dr. Tit not only talks about talking about the science; she really explains it. See this snippet for instance:

    “Like HIV, Deadly Denial Virus (DDV) can kill independently although they are most effective together”, Dr Tit explains. “But in that case it’s mostly remote controlled suicide in ethnically challenged bystanders via unexplained transduction of hypothetical signals traversing mysterious biochemical byways yet to be discovered by science. As is readily apparent, we have made enormous progress in understanding the fanaticism behind this disease although it may all seem a bit diffuse to the layperson. This is why I feel it’s my duty to stoop and explain the science on my blog, faeciology.com, and other fine outlets. But as with most cutting edge science, it can really only be expressed via mathematical modelling. The by far most popular one with retrovirologists is the “tap and drain” model of DDV funding, essentially similar to the one used with HIV”.

    http://www.scientificblogging.com/hank/the_least_known_war_in_science_does_hiv_cause_aids

    http://aidstruth.org/fanaticism.php

  40. #40 Justin Moretti
    September 19, 2007

    And here I was thinking the HIV/AIDS denialists had already sunk to their lowest level.

    I have just realized – there is no lowest level.

    I would have barred them by now. They contribute nothing useful. Carter in particular, “watching these posts nearly 24/7″, should probably be dealt with under stalking provisions.

  41. #41 cooler
    September 19, 2007

    Bar them! you must want to abolish the first amendment like your hero mark wainberg…….

  42. #42 Epidemiology-LISA
    September 19, 2007

    Adso tsk, tsk. Aristophanes was indeed close, but in fact the supposed author of that dreaded book was Aristotle.
    http://en.wikipedia.org/wiki/The_Name_of_the_Rose

    Anyway, as consolation I’ll quote some more words of wisdom at you:

    Since the final proof of the existenceof the fanatic Deadly Denialism Virus, Dr. Tit has been devoting the most flattering photos of herself to fighting this menace to mankind.

    “It’s a disease marked by the most vicious fanaticism”, she warns. “As is often seen in mental illness, there seems to be a strong unconscious resistance against being cured -in severe cases leading to a complete refusal to discuss scientific points with anyone who is not also infected. The mode of transmission is, like everything else about DDV, not known, but early childhood trauma seems to predispose for later infection. When myself and the dazzlingly smart neuropathologist, Steamy Novel, teamed up to expose the psychological root causes of the well known denial cases of Christine Maggiore and Mathematician Rebecca Culshaw, we found that both had been encouraged by their parents to think for themselves. This is obviously a very dangerous trend which can only be fought via total censorship of the media and the school system.’

    http://medicine.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pmed.0040256

  43. #43 ElkMountainMan
    September 19, 2007

    cooler confuses Tara Smith’s Aetiology blog with the United States government…but similar mistakes are common amongst supporters of conspiracy theorist Rupaul.

    As a refresher for those, like cooler, who have forgotten their junior high school civics class, the First Amendment to the Constitution prohibits the federal legislature (“Congress”) from, among other things, passing laws abridging the freedom of speech.

    Perhaps cooler would like to tell us how Tara Smith’s decisions about who and what to permit on her own private blog have anything to do with the Congress. (To make it easier, look up “Pruneyard”…but you’re still going to need to explain the connection of the several states to the Congress and address the relationship of the internet and “public property.”)

    In any case, Tara has permitted dissenting views on this blog far in excess of anything I have ever witnessed on “rethinker” sites, including Liversidge’s site, the rethinker message boards (which censor everything), and especially the jackbooted bozo Bialy’s boring blog.

  44. #44 cooler
    September 19, 2007

    no wainberg was talking about abolishing the first amendment and I have not heard any aids apologists condemn his statement.

    Elk, since you hate ron paul so much, why dont you go fight the war in Iraq, he voted against it, one of the very few people back in 2003, unlike your probable heroes hillary or ghouliani

    Because you think hes nuts bc of his “crazy” views of non intervensionism, go to Iraq and stop being a hypocrite, practice what you preach if you hate a persons beleifs than back it up with action by enlisting, sanctimonious hypocrite.

  45. #45 Obdulantist
    September 20, 2007

    WTF does Ron Paul’s laudable stance on Iraq and the Patriot act have to do with the validity or otherwise of his stance on HIV? A person can be right on one issue and wrong on another.

  46. #46 cooler
    September 20, 2007

    Ron paul has never said hiv does not cause Aids, hes never even mentioned it………….the nazi trolls here dont like him bc he tells it like it is, that hes anti CFR globalists/nafta/federal reserve/ no new wars every 5 years/follow the constitution/non intervention stance irks the obsequious sycophants who just want flip flopping hillary who now wants a war with Iran, then hillary will say in 10 years oops, if I knew what i knew now with Iran I wouldnt have started a new war………………….shes such an idiot.

  47. #47 DuWayne
    September 20, 2007

    cooler -

    Show me the statement, I will happily condemn it. I have absolutely no tolerance for anyone who argues against free speech, regardless of other agreed upon positions.

    All that said, if this were my blog, ELISA would have been banned a long time ago. Actually, one of the reasons that I do very little posting on this topic, is that I have no tolerance for woo that kills, such as yours. Your own comments would likely be deleted out of hand. This is not because I have a problem with dissenting views, I have guest posts that I disagree with on my front page. It’s just that yours are so vile and repugnant, that I have absolutely no interest in giving them any platform from which to be voiced.

    I would still, without question, fight with everything in me, with everything that I am, for your right to say what you believe. Anyone who suggests that it should be a crime to say nearly anything, is just plain wrong. Honestly, I find the suggestion of legal restrictions on speech, outside of extremely narrow parameters to be almost as repugnant as the bile you so regularly spew.

  48. #48 Michael
    September 20, 2007

    Tara said: “Is it any wonder that HIV researchers are so outraged by these people?”

    Yes indeed Tara. Just awful, isn’t it?

    Guess I’d be outraged too, if I was a fatheaded foolish HIV researcher, that failed to take the extreme stress and extreme emotions and feelings of loneliness, guilt, shame, helplessness, hopelessness, panic and fear and belief of inevitable slow and tortured death into any due consideration when considering the aetiology of a disease such as AIDS that ONLY hits those who are suffering the most from these extremely toxic emotions.

    Duhhh!

  49. #49 Chris Noble
    September 20, 2007

    If ELISA can pull herself out of the gutter for a few minutes she can respond to this post.

    Does drug use cause AIDS

  50. #50 Michael
    September 20, 2007

    DuWayne. As an indication of how far from scientific debate HIV researchers John P Moore and Mark Wainberg’s antisocial and medically irresponsible mentality is, their call for censorship is worth quoting in full, if you can stomach it.

    You can find Moore and Wainbergs latest attempt to silence and ban free speech, and to have even had it THE AUDACITY to have it published on American Independence Day, the very 4th of July of this very year, enshrined for posterity at the following:

    http://www.scienceguardian.com/blog/globe-and-mail-stink-bomb.htm

    GLOBE AND MAIL
    EXCLUSIVE COMMENT
    AIDS and the dangers of denial
    MARK WAINBERG AND JOHN MOORE
    Special to Globe and Mail Update
    July 4, 2007 at 12:46 AM EDT

    In Moore and Wainberg’s screed, you will even find the following:

    “We have long accepted that free societies do have an obligation to impose restrictions on freedom of speech in the interest of public safety.” AND “Our lawmakers need to enact legislation to put appropriate limits on such irresponsible expression and to counter the ongoing damage perpetrated by denialists.”

    I don’t know about you DuWayne, or anyone else here, but I find this pure trash and cry for censorship by British import John P Moore and Canadian Mark Wainberg especially repulsive, repugnant and utterly disgusting. And these two are the biggest mouths of the anti-dissident movement. Both are founders of the very AIDSTRUTH website. And I just don’t understand why.

    Could it be because Wainberg has patents and royalties on AIDS drugs as a conflict of interest, or because Moore has his many years of US taxpayer funding and grants, and even a $500,000 unrestricted grant from pharma companies to protect.

    Speaking for myself, and especially as one of my very own direct Ancestors, a Colonel Henry Geiger, who served directly under George Washington as a colonel in the 1776 War for American Independence, that was fought against the Brit Twits of the 18th century for the same freedoms of speech, and life, and liberty that we enjoy today, to be under threat by these pieces of conflicted crap who live off of our own tax dollars is really a bit much! Moore should be deported as a security threat. Wainberg should go to Nuremburg for all of the cases of Crix Belly, Neuropathy, and liver failure and death that his own AIDS drugs have caused.

    And I will tell you what else DuWayne. We beat the snot out of the Brits in the 1700′s, beat them right back across the ocean and right up into Canada, and I myself will be glad to do it again if any of them dare to threaten our very inalienable rights that my own ancestor gave up his own life for, so that future generations, including you and your children and their children, could all live free.

  51. #51 Tara C. Smith
    September 20, 2007

    “Dr. Smearah Tit,” ELISA?

    Funny how those supporting HIV causation of AIDS discuss actual scientific research, while the deniers post nothing but insults and really, really bad parodies.

  52. #52 Michael
    September 20, 2007

    Hello DuWayne. One more piece of video proof, right out of Wainbergs mouth, demanding the US Constitution be changed, can be found at the following:

    http://www.youtube.com/watch?v=hpkQ5OvRNbI

  53. #53 SmellyTerror
    September 20, 2007

    Wow. Just… wow.

    Denialists are nuts. They’re all nuts. Seriously, are there any sane ones?

    Why do you even bother to argue with them? I’ve got a better chance of convincing my neighbour that passing cars are NOT using lasers to mess up his tv reception.

  54. #54 Epidemiology-LISA
    September 20, 2007

    Funny how those supporting HIV causation of AIDS discuss actual scientific research, while the deniers post nothing but insults and really, really bad parodies.

    Funny, I must have missed the scientific discussion in your latest articles Dr. Smith. Would you mind cutting and pasting, so we can have look see here? Until then, fact remains Dr. Tit discusses more “actual scientific research” than you do. And she doesn’t crib her articles from AIDStruthy eiher.

    When are we gonna see you out in the real world debating Christine Maggiore, you know the case that got your bleeding heart involved with this thing in the first place. Funny again cuz it was alos what got Dr. Tit involved. Here’s how she aproached the science on that one:

    Dr. Smearah Tit has made a special study of DDV prevention strategies:

    “It’s important to avoid all human contact, especially if you suspect you’re dealing with a denialist, as we call those infected. When first I examined Christine Maggiore’s case, for instance I made sure never to discuss any of it with her in person. Even to this day I can hardly get any of the facts straight. I think that’s what’s kept me sane and successful in dealing with the horrors of DDV. Another thing I’d strongly advice against is sex under any circumstances. If, for reasons thankfully beyond me, you must have sex, there’s a simple test you can apply. Make sure your prospective mate has had a few glasses of wine, dim the lights, put him in a relaxed, romantic mood so you can catch him off guard. Then suddenly spring the question: Why does he think the hull of a ship disappears out of sight in the horizon before the sails? If he says it’s because the fossil records in the 4 known corners of the world cannot always explain the miraculous biological properties of retroviruses, you know you’re in bed with an advanced stage 100% infectious denialist.”

  55. #55 noreen
    September 20, 2007

    Dr. Smith, a study should be performed on HIV+’s and AIDS person who do not take the meds and are healthy. However, some would not like the outcome. We would be proof enough that the current hypothesis is flawed and for the most part, this is just hype and a money-maker.

  56. #56 ElkMountainMan
    September 20, 2007

    Michael seems to be just as confused as cooler about the United States Constitution and its Amendments, despite his claim to have an ancestor who fought in the Revolutionary War. (What does that make the rest of us, Michael? Second-class citizens, just barely better than the despised “foreigners”?)

    Since the Revolutionary War ended well before the Constitution and the Bill of Rights existed, it is unlikely that Geiger’s ancestor was fighting for the First Amendment. The “inalienable rights” Geiger mentions….well, that phrase and the concepts behind it are derived from the work of (who else?) British thinkers. This all makes Geiger’s new-found patriotic bluster seem a bit clownish.

    In truth, Michael, if you construe Mark Wainberg’s comments about imprisonment for Peter Duesberg as an attack on the Constitution, you are in for a shock: the Constitution has not only been attacked for the last 200 years and more, many of these attacks have been successful! In fact, criticism of the Constitution and proposed alterations to it are quite firmly protected under the free speech you so noisily claim to defend (at least when you’re not urging the deportation of Moore and the trial of Wainberg).

    Which of these successful “attacks” on the Constitution of your noble and storied ancestors do you object to, Geiger?

    The 13th Amendment (1865), which abolished slavery. What a dreadful affront to the Founders, Michael, who fought the British and held them off later in the War of 1812, fighting to preserve that “inalienable right” to hold fellow human beings in slavery in defiance of the British abolitionism! Had the Brits won in 1812, slavery would have been abolished in the States at the latest in 1834. What an insult to your ancestors that would have been, no, Michael?

    The 15th Amendment, which gave the vote to former slaves and prohibited discrimination at the polls based on race. What a disgrace to this government of the whites, by the whites, and for the whites…like your ancestors, Michael.

    The 19th Amendment which, (horrors!) granted the vote to women. My goodness, Michael, what would the blue-blood Founders have thought about all of those uppity women letting their voices be heard in the political process? Scandalous!

    Or the 18th Amendment (Prohibition) repealed by the 21st. Such a terrible defacing of Michael’s precious Constitution has never been seen! As if the document were nothing but a wall for scrawling graffitti!

    The 22nd Amendment, term limits for Presidents: a restriction on free speech, political speech, itself.

    There are now 27 Amendments to the Constitution. Many more have been proposed.

    I am glad that Mark Wainberg raised the issue about whether the Constitution should be changed to stop medical endangerment. I may have minor disagreements with him on this one issue, but I completely support his right to raise these important questions. While Duesberg does not present a “clear and imminent” danger or whatever the legal phrase is (see Schenck), he is still a danger to the health of people who make medical decisions based on his lies and distortions. We need to have a conversation about such behavior and what can be done about it.

    A conversation, Michael, not a war:

    We beat the snot out of the Brits in the 1700′s, beat them right back across the ocean and right up into Canada, and I myself will be glad to do it again if any of them dare to threaten our very inalienable rights that my own ancestor gave up his own life for,

    It must be frustrating to be so wrong about as many things as you are, Michael, but I suggest that violence is not the answer. Rather, education and an open mind will help you to overcome your rage and maybe some of your prejudices, too.

  57. #57 apy
    September 20, 2007

    noreen said:

    Dr. Smith, a study should be performed on HIV+’s and AIDS person who do not take the meds and are healthy. However, some would not like the outcome. We would be proof enough that the current hypothesis is flawed and for the most part, this is just hype and a money-maker.

    Uhh, like the ones that already are being performed?

    http://www.mgh.harvard.edu/aids/hiv_elite_controllers.asp

    Do you actually look up anything on your own?

  58. #58 noreen
    September 20, 2007

    Apy, I am aware that a few studies may be underway but I have yet to see any published results from these. It will be interesting to see these results and their conclusions!

  59. #59 apy
    September 20, 2007
  60. #60 DuWayne
    September 20, 2007

    ElkMountainMan -

    I am all about the notion that the constitution can be changed, that is one of the things that make it so great. However, I have to say that the statements made by Wainberg, in regards to free speech are absolutely repugnant. I am truly horrified by the notion of placing legal restrictions on dissenting speech, no matter how vile. That someone who has so much to offer in the fight against denialism, would say things like that, only undermines the fight against such deadly ignorance.

    The way to quell dissent is not by legally restricting the dissenter’s right to speak about it. The way to fight it, is to respond to it. Don’t let it drop, don’t assume that everyone else is smart enough to know bullshit for bullshit. All that legal restrictions do, is to make martyrs and make others wonder why it was necessary to pass laws against that type of speech. It makes people wonder about the potential validity of such speech.

    I am repulsed by what Wainberg had to say about this. I am also repulsed by the fact that it forces me to stand in solid agreement with the denialists here. While I am sure that there are probably many things that I would agree with these folks about, unrelated to their deadly woo, it is exceedingly distasteful to have to support anything they have to say in a thread such as this one.

  61. #61 cooler
    September 20, 2007

    Elisa,
    calling people names like Dr tit etc kind of makes us look bad, duesberg, shyh ching lo scientists that have questioned the hiv hypothesis would never talk like that.

    Wouldnt be suprised if aids inc is so desperate that they are hiring disinfo agents to make the “dissidents” look bad……..

  62. #62 Tara C. Smith
    September 20, 2007

    Wouldnt be suprised if aids inc is so desperate that they are hiring disinfo agents to make the “dissidents” look bad……..

    Ha! No cooler, y’all do that well enough on your own.

  63. #63 ElkMountainMan
    September 20, 2007

    DuWayne,

    I agree with you on the Constitution, but I also have a difficult time finding Wainberg “repugnant.” I suspect that he has looked at all of the restrictions of speech in the United States (many of them involving comparatively trivial infractions) and wondered why denialism that results in deaths is not also restricted.

    Consider all of the many, many ways in which the freedom of speech has been abridged in the United States. Consider, too, the many times when such restrictions have been upheld by the courts.

    If I defame you, DuWayne, and you can prove harm, I will be forced to pay. That is a very real restriction of my free speech. Yet, what harm has been done? I have hurt your feelings, perhaps, and if you are in business and I’ve dissuaded clients from dealing with you, I’ve also damaged your business. But no one is dead.

    Obscenity, too, is not fatal. Child pornography is usually not fatal. When anti-choice activists try to picket a doctor’s private residence, they are not usually engaging in violence. Yet the law has ruled against all of these forms of speech.

    A government employee who makes controversial statements about, say, religion, can be silenced constitutionally. The place and time of protected speech can be restricted constitutionally. But, again, no one would die or be harmed in any bodily way if these restrictions were not applied.

    Commercial speech is highly regulated: false advertising is prohibited. Advertising cigarettes within a certain distance of schools is prohibited. The airwaves are under strict control.

    If all of these restrictions were lifted tomorrow, I doubt that many people would die. Sadly, speech that has killed people–non-MDs giving medical advice to AIDS patients, amateur “experts” giving false information about a virus they know nothing about–is fully protected. If I walk down the street screaming obscenities, creating nothing more than a nuisance, I will be arrested. But Duesberg convinces a mother that all retroviruses are harmless, she surrounds herself with doctors who refuse to ask questions, and her child dies…and no one suffers a serious consequence.

    That is what irked Wainberg. Truth be told, even if I disagree with his conclusion (involving the Constitution), it irks me, too.

    DuWayne, why should obscenity be banned but my “right” to dupe my neighbor into stopping his meds and dying be protected?

  64. #64 Carter
    September 20, 2007

    Elite Controller studies are being performed under the auspices of the Mainstream AIDS medical research and AIDS societies.
    “Participation also involves documentation of current and past viral load and CD4 counts, patient demographics and HIV history.

    Don’t expect them to have any outcome other than to say, “We don’t quite know the mechanisms for which people live longer without anti-HIV intervention, more studies are needed”. After all if one looks most of the mainstream studies end in this typical fashion.

    Little do these bums of science know that the “Elite Controllers” are the ones who don’t believe in HIV to cause them harm nor do they give into pressures of medical interventions to begin with. All these studies are just throwing good money at bad science, like most of it.

    “HIV is like a boat, and a boat is just a hole in the water to throw money in…………”

  65. #65 cooler
    September 20, 2007

    nope, tara you guys cant even provide us with the first scientific paper that hiv causes AIDS. In 1983 only a small group of idiotic scientists thought hiv might caused by a retrovirus (Gallo, essex, levy) , coming off thier failed retrovirus causes cancer program (how dumb can these people be, cancer isnt contagious!) they now told us their cancer virus was now the AIDS virus!

    In 1985 everybody in the world thought hiv was the cause of AIDS.

    Can you please provide me with this scientific paper printed in between these years that proved hiv caused AIDS, or was this ubiquitious consensus caused by politics and not science……………………?

    Please dont tell of the 20 years of confirmatory evidence that confirmed Gallo’s partial correlation, barely detectable, 1/1000 blood tcells no animal model hypothesis, they all assumed hiv was the cause of aids, you cant confirm things you already beleive to be true, and design studies with that mindset, studies that would have been truly designed to test for verifying gallo’s claim would have been designed totally differently (control for confounding factors)

    Instead they kept extending the window period when no one got sick, made hiv species specific when mice/primates didnt get aids when inoculated……….talk about extending the goalposts to save a hypothesis!

    See hiv fact or fraud. google it.

    Read Project day lily. google it.
    mycoplasma biowarfare program/ this microbe found in some aids cases/CFS kills every animal injected, most amazing book ever by two phd’s scientists who uncovered a massive coverup.

  66. #66 apy
    September 20, 2007

    Don’t expect them to have any outcome other than to say, “We don’t quite know the mechanisms for which people live longer without anti-HIV intervention, more studies are needed”. After all if one looks most of the mainstream studies end in this typical fashion.

    If you mean they might come out and say that elite controllers seem to produce T-cells that lack a protien on the outside that makes it difficult for HIV to attach to then you might be right. It’s true, most of the main stream studies end in us learning something new that all the HIV dissident bitching in the world never thought of or suggested through their wide spread research. How do dissident studies typically end? Oh yes you don’t do any studies, how could I forget.

  67. #67 Braganza
    September 20, 2007

    Dear ElkMountainMan

    Are you really sharing Wainberg idea ?

    What about people living outside the US, would you also consider that they should not be allowed to propagate/ read/discuss “denialist” ** ideas ?

    I was thinking not only the EU/Australia/Canada etc…but about people in China/India and mainly about Africa, where the majority of HIV+ people are presently living.

    What about people who don’t want to use ARV’s for cultural reasons, for example many Chinese that I have spoken with, think that chronic diseases (not only AIDS) are better treated using traditional Chinese medicine than occidental medicine. They therefore would not accept such prohibition…

    I also know that in Africa many persons go first to so-called traditional doctors. . This is likely to continue, and this may be the most important reason of the lack of use of ARV’s in Africa, not, as some may be thinking, due to the existence of internet based “denialists” movements in the US/EU.

    Both Chinese Traditional Medicine, Ayurvedic medicine and African traditional doctors use mainly herbal drugs, and it may be possible that some herbal drugs would have similar effect than LDN that Noreen reported, and may at least also prolong AIDS sufferers life as ARV’s does, without ARV’s secondary effects that Noreen reported.

    It is unlikely that any internet prohibition in the US would have any major effect in these populations.

    So dear ElkMountainMan do you think that people that living in the US/Canada should be allowed to have less information, and therefore less opportunities to solve their problems than the non-Americans/ non-Canadians?

    As you look quite articulate in explaining your ideas, I am curious to read what you have to say.

    ———————————-

    ** I understand that part of the so called “denialist” ideology is proposing non-ARV’s treatments for AIDS sufferers.

  68. #68 Epidemiology-LISA
    September 20, 2007

    Cooler caling people names? what are you talking about? Making us look bad, who are you talking about? Anyway how could it be worse? Jehova, Jehova….

    Wanna see a real plant you paranoid bastard, watch out for the slimy, boooring prose and the truly laughable impersonation – I give you Carter and Mundt.

    http://medicine.plosjournals.org/perlserv/?request=read-response&doi=10.1371/journal.pmed.0040256

  69. #69 ElkMountainMan
    September 20, 2007

    Dear Braganza,

    I appreciate your questions, and I would like to say that this is a very difficult legal question, one that I can’t claim to address well for the United States, much less for the rest of the world. I’ll do my best to give you my thoughts, though.

    I do not share Mark Wainberg’s idea, but I sympathize with his frustration. A large group of relatively harmless types of speech are banned in the United States–and their banning has been upheld by the courts, the arbiters of the Constitution–while medical lies that have led to deaths are protected free speech.

    In my view, this is inconsistent. If libertarians in the United States wish to criticize Mark Wainberg’s (free) speech on this, they act inconsistently with their principles unless they also oppose other restrictions of speech, such as laws against obscenity, child pornography, defamation, commercial speech, and…well, I gave a list in my previous comment. Many libertarians do oppose such restrictions. While I disagree with them, I cannot call them hypocrites.

    In my view, Wainberg has the right to comment on the apparent hypocrisy under the law, and, in my view, this is an important issue, worth a serious conversation about whether enhanced legal protections are needed for vulnerable individuals. I, frankly, do not know the answer, but I do not think the Constitution needs to be changed. I think that the legal system can deal with medical lies on its own, and it usually does.

    It’s important to define what I mean by “medical lies,” and I suspect “lies” is too narrow a term for what I mean. I would not classify the examples you give, Braganza–of traditional healers and herbal remedies–as being “medical lies” in the places where they predominate. But what about a traditional healer operating in an immigrant community in North Carolina? I’ll throw up my hands on that one. I don’t know; this is why we have courts…to decide difficult cases. To me, a medical lie is when an unqualified person poses as a health professional and gives out advice, or when a qualified doctor knowingly lies or does not adhere to a standard of treatment. Cases like these can be found in the courts every day, and that’s why I don’t favor changing the Constitution.

    I don’t speak for Mark Wainberg, but I get the impression that the behavior he opposes is restricted to just a few individuals in the “denialist” community: people such as Peter Duesberg who have the training and should have the common sense to understand what they are doing is wrong.

    If a given individual has dispensed medical advice to AIDS patients who have followed that advice and died, that person could be sued. I don’t know how successful such a case would be. I have corresponded with one person who was persuaded to stop HAART by a “dissident” with no medical training. There are many others. The success of a lawsuit in any case would depend partly on the fake “doctor’s” knowledge.

    Many “dissidents” are surprisingly uneducated about the topic they build their lives around, and so can hardly be accused of “lying.” They believe what they say. But some dissidents are so well-versed in the literature, yet insist so strongly on lying about it knowingly, that their deception would be obvious in court.

    I’m probably wrong on some of this, and it could well be that laws (not the Constitution) would need some changing before any hope of a successful lawsuit against the more malicious, knowing “denialists.”

    To conclude, I hope that some of you can agree with me on the following example:

    Cigarette companies have been prohibited from advertising over the airwaves in the United States. In some countries, all tobacco advertisement is banned. The purpose is to protect public health. I’m not opposed to this, but it’s worth noting that it is a restriction on “free speech,” and much more widespread than what Mark Wainberg has proposed.

    Which is closer to a “clear and present danger”–cigarette ads or AIDS denialism?
    Cigarette ads encourage behavior that may kill in decades.
    AIDS denialism encourages behavior that may kill in months or years, depending on the patient.

    Which is more deceptive–cigarette ads or AIDS denialism?
    At least in the last few decades of their runs, cigarette ads could not imply health benefits from smoking.
    AIDS denialism, in contrast, not only states that going off ARVs is healthy, it says that ARVs are the cause of AIDS, and does so by knowingly ignoring the many studies showing the benefits of ARVs, in some cases actually distorting and lying about those studies.

    Which has a more captive audience?
    Cigarette ads were targeted broadly.
    AIDS denialism is targeted at affected individuals, often people who are sick and understandably desperate for answers, vulnerable.

    Which can be restricted under the current commercial speech laws in the USA?
    Cigarette ads, obviously.
    AIDS denialism–in many cases, in my opinion should be. “Rethinkers” make money from the vulnerable people they exploit; their propaganda could be, but often is not, restricted under commercial speech regulations.

    I think there is room for improvement in protecting vulnerable patients in the United States from the predatory practices of the AIDS denialists, but I think this can be done within the existing system.

    There’s a legal doctrine, I can’t remember the name of it right now, about imposing the least harmful way to achieve the desired effect. Better education of the public (or individuals) by science educators is certainly less harmful than lawsuits. If legal action ever happens, and I doubt it will, it should focus on the knowing lies of the denialists, not on restricting free speech.

  70. #70 Meredith M. CLancy
    September 20, 2007

    While I’m sure, considering the number of comments Dr. Smith receives on every posting regarding the “shoddy science” behind HIV/AIDS and retroviruses, that this has been covered before, it bears mentioning.

    Retroviruses are obviously not functionally the same. Some retroviruses cause immunodeficiency syndromes–i.e., Feline Immunodeficiency Virus; some cause cancer–the first discovered to cause cancer, the Rous Sarcoma Virus, and others like Bovine Leukemia Virus.

    The Family of Retroviridae is comprised of viruses with similar characteristics, and one of those defining characteristics is their ability to insert their own RNA into the host cells’ DNA and cause a huge array of problems.

    Just a point of pride among veterinarians, as Dr. Rous was the first to discover a viral cause of cancer, something for which he was rewarded with the Nobel Prize in Physiology or Medicine in 1966.

  71. #71 Chris Noble
    September 20, 2007

    Funny, I must have missed the scientific discussion in your latest articles Dr. Smith.

    I’m still waiting for any rational response to my earlier post.

    Does drug use cause AIDS

    In all the whingeing and whining about censorship you seem to forget that the collective response from the “dissidents” has been “Everyone knows that Ascher was Tony Fauci’s well paid buttboy and pet lapdog…”

    Nobody is censoring you here and yet the best you can come up with is calling people names like “Dr. Smearah Tit”.

    Accompanying every right is a responsibility.

  72. #72 cooler
    September 20, 2007

    This free speech issue is crazy, its about personal responsibility. If Duesberg or any other scientist advocated drinking gasoline and an adult did it, the person dumb enough to follow that advice is to most to blame.

    Another more subtle example, say someone followed the atkins diet and because of it he had a heart attack bc many docs dont agree with it, ? Is it Atkins fault?, no its the persons fault it’s his responsibility to look at all the data pro and con and then make a choice based on informed consent,his body, his choice, his life.

    All these calls for censorship are just plain fear……….the “rethinkers” have superior arguments and the moore/gallo/wainberg mob know this so they resort to calling for the abolishment of the 1st amendment and the firing of professors who dont agree with them.

    This is not the way people react to an absurd argument, an absurd argument doesnt scare experts, If a group of people started a movement called the “moon is made of green cheese” can you imagine a group of astrophysicists starting a group that said the “moontruth, the moon is not made of cheese” and getting all upset about it, no of course not they would just ignore it because its absurd and laughable, the moore mob does not act like they should if the rethinkers arguments were not valid, bc they know they have no arguments to back up their positions, and need to rely on censorship and the stifling of academic freedom.

  73. #73 Chris Noble
    September 20, 2007

    This free speech issue is crazy, its about personal responsibility. If Duesberg or any other scientist advocated drinking gasoline and an adult did it, the person dumb enough to follow that advice is to most to blame.

    Of course the person drinking the gasoline has reposibility for his own actions but if Duesberg tells people that drinking gasoline is not only safe but beneficial then he is also partly responsible.

    Duesberg told Raphael Lombardo that if he didn’t take recreational drugs or antiretrovirals that he wouldn’t get AIDS. Raphael didn’t take recreational drugs and he didn’t take antiretrovirals and yet he still got AIDS. To make matters worse Duesberg accused Raphael of lying after he was already dead and not able to defend himself. Duesberg is personally responsible for the eventual outcomes of his actions.

    Professional Responsibilities of biomedical scientists in public discourse

  74. #74 cooler
    September 20, 2007

    No as long as raphael heard both sides of the hiv debate its all on him, his body his life, and im sure many docs told him about the hiv myth over and over. Who knows what killed him, Ill have to look into it, was it HIV, mycoplasma incognitus, AZT, catastrophic stress?.

    One solid epidemiological study designed to test the hiv hypothesis could easily resolve the thousands of people that are starting to doubt the hiv hypothesis, too bad AIDS inc will never allow a study that would test Gallo’s dubious partial correlation/ no animal model/ 1/1000 blood tcell hypothesis.

    They are plenty of people who were killed by AZT that could have been LTNP’ers, so aids inc is responsible for their deaths, the big difference is that Rapheal was exposed to both sides of the argument, while people who were told to take monster doses of AZT were not, they were not even informed that they were being put under long term chemotherapy. Its about informed consent and doing what you want with your own body. Yes I do agree if you are hiv positive you should inform all prospective partners………..other than that Its your choice based upon what makes sense to you.

  75. #75 DuWayne
    September 20, 2007

    ElkMountainMan -

    Actually, it is very, very hard to actually sue for defamation, thanks in large part to Larry Flynt. As for obscenity laws, they are being struck down left and right, something that I strongly support. The right to protest, has unfortunately suffered in very large ways over the last few decades, something that I find horribly disturbing.

    Child porn is a whole different ball of wax. There is real harm being perpetrated in the production and to an extent with the dissemination of such materials. While it usually isn’t fatal, it is nothing short of rape, something that is definitely illegal and bloody well should be. It is not speech, it’s an act of violence, rape and degradation.

    I should be clear, that I am not saying that Wainberg is himself repugnant, I have not heard enough of his views to really judge that. But what he says about speech most certainly is. Just because there are unacceptable laws restricting speech in the U.S., does not justify more restrictions.

  76. #76 Michael
    September 20, 2007

    Hey Chris. You are totally full of SHIT about Ralph Lombardo’s death being on Peter Duesberg in any way shape or form.

    Lombardo had refused AZT even before he ever heard of Dr. Duesberg.

    The following are extracts from Ralph Lombardo’s VERY OWN WORDS from a letter of his to Dr. Duesberg, and the full letter can be found at:
    http://72.14.253.104/search?q=cache:wvgAw4w3zwYJ:www.virusmyth.net/aids/data/pdazt.htm+%22Raphael+Lombardo%22&hl=en&ct=clnk&cd=1&gl=us
    ————————————————–
    To: Dr. Peter Duesberg

    From: Raphael Sabato Lombardo

    Date: May 30, 1995

    Subject: Life without AZT !!!!!!!!!!!!!!!!!!!!!!!!

    Dear Dr. Duesberg,

    My name is Raphael Sabato Lombardo, 33 years old and from Cape Coral, FL. I am writing in regards to the enclosed magazine article from this month’s issue of Men’s Style. I was thrilled to read that there was someone in the medical profession who shared the same views I’ve had for so many years.……

    I am an HIV positive individual. I learned of my HIV status while in boot camp in the U.S. Navy back in 1985 (I could have very possibly been HIV positive 7 years before that)……
    Remember, this was 1985, a time when HIV was called the HTLV III virus and anything and everyone associated with it meant complete and utter doom (physically, spiritually, societally, politically, etc….

    Although met with discrimination and much verbal and physical abuse as well, I did go home and received my bachelor’s in business from the University of South Florida ­Ft. Myers.….
    Myself and the other recruits (those who are left) still remain a closeknit group. The bond will forever exist. Several have died of AIDS and several have AIDS. As for myself I’ve remained completely asymptomatic thank God!
    To be honest, in regards to HIV, I haven,t seen a doctor since the day I was discharged. While in the Navy, we were subjected to incompetent Navy doctors who often gave us inaccurate medical results. As a result, I came to trust no one in the medical profession. I decided to take things into my own hands.…. I spent countless hours in the medical library at the Bethesda Naval Hospital which is where we were being held and did research on one’s immune system and all AIDS information available up to that point in time. Since no drugs had yet been approved by the FDA, there were no forms of treatment available. I came up with my own form of natural healthcare…..
    Shortly after discharge, AZT was approved by the FDA. My family and friends wanted me to jump on the bandwagon immediately! I can’t explain why, but I outright refused. There was this inner voice that kept telling me, and continues to tell me, to just stay away from medication. Even back then I had a feeling that taking this medication and going on drug experimental trials would do nothing more than provoke the onset of the disease. Again, this feeling was based not on medical data or research, just an inner gut feeling.…. I guess you could say my spirit guides or guardian angels have been working overtime. By not going on medication, my family and friends felt I was exhibiting the same “ignorance” and “foolishness” that got me into this mess in the first place. We had countless heated argument over this, but I told them my mind was made up and that was that-period. We Italian men can often times be quite stubborn! Actually, my dad is the only one who agrees with me.… That is reflective in our conversations which last no longer than a couple of seconds.

    During those years of experimenting, exploring and even rejoicing in my God given sexuality, I did the bathhouse scene, the “Saint” parties, the S&M sex clubs, the backroom bar scenes, the group sex, etc. I guess you could say that sexually, I did it all. I was curious, knew exactly what I wanted to do and experience, and did just that. Something I’m proud of? No! It’s just the way it happened. Again, this was all society felt, and still feels, gays are worthy of. While I was part of the “gay scene” in this respect, I always felt I wasn’t at all in other respects.

    At about the same time as my Navy situation, I began hearing more and more of guys I had dated in N.Y.C. who had died or were dying of AIDS. I speak of approximately 2 dozen friends (that I am aware of, there’s probably more) who have died of AIDS from 1985 to 1995. They are all gay men (except for 1 woman). These men were also very much into recreational drugs (steroids, poppers, marijuana, cocaine, ecstasy, etc.). They ranged in age from mid twenties to mid forties. I don’t know at what point they started using the drugs such as AZT, ddI etc. I found out my HIV status while I was in the Navy and didn’t even know I was being tested and had not experienced any signs or symptoms of the disease. I don’t know if these other friends of mine had already progressed to ARC and full­blown AIDS before finally deciding to get tested and go on medication or they took it upon themselves early on to have the test done before experiencing any symptoms and then progressed from simply testing HIV positive and then progressing to ARC, full­blown AIDS and eventually death. My personal suspicion is that these individuals were not aware of their HIV status until they started experiencing physical complications. My friends who were sick and died since the late eighties were taking mega doses of AZT (approximately 12 pills a day). I hear that dosage has been greatly reduced. My friends today take several pills of AZT daily. I’m not sure what the dosage is for any other drugs that they’re on.

    In regards to the woman I mentioned, she was a heterosexual, and in her late twenties. I am not certain how she contracted the disease. She was married with a set of twins that were merely a few years old at the time of her death last year. I believe she suffered approximately 3 years and was on AZT and several other drugs for most of that time. An unfortunate tragedy! Her husband and children test negative.

    With regards to HIV, I’ve always sensed that drugs, or lack of them, has played a big part in keeping me going while so many others have been less fortunate. Another thing I’d like to add is that as a workout enthusiast, I’ve never experimented with steroids, which unfortunately runs so very, very rampant amongst gays and in my opinion is ravaging the gay community. Amongst other things, it severely compromises one’s immune system. To me, there’s nothing wrong with good old fashioned, honest hard work.

    According to the article I’ve read, it sounds as though you’ve had a pretty rough time of things in trying to gain support in the medical community and gay community as well. I just wanted to let you know that I share the same views and sentiments as you.….
    This year, 1995, marks the 10 year anniversary of my Navy situation, a milestone in many, many ways.

    Respectfully,
    Raphael Sabato Lombardo

  77. #77 Michael
    September 20, 2007

    Chris, you piece of shit liar, you act as if Duesberg had somehow led this guy around by the nose. Lombardo had decided NOT to take AIDS drugs 10 YEARS before he ever heard of Duesberg. Lombardo HIMSELF chose not to accept standard treatment. Lombardo HIMSELF witnessed the deaths of those he knew who took AZT.

    And as for his death, Chris, please take note of all of the emotional pain and INTENSE STRESS AND LONELINESS that Ralph endured.

    For being gay. (shamed and guilted)
    For being gay in the military. (shamed and guilted)
    For being diagnosed as HIV poz.(stressed, panicked, rejected, shamed and guilted)
    For NOT taking meds.(stressed, with projections of death put on him regularly)
    For losing those close to him.(major grief)
    For not having a lover.(loneliness)

    And a thousand other reasons that you, Chris, know nothing about. You do not know what he went through, and you do not know what he suffered emotionally.

    Ralph was another gay man, who had an intensely stressed and intensely emotional difficult life.

    And YOU CHRIS NOBLE, are nothing but a simple minded ass-wipe know-it-all who knows nothing about anything!

  78. #78 Michael
    September 20, 2007

    THE SCIENTIFIC AND MEDICAL COMMUNITY IS GUILTY OF PROMOTING AND PROJECTING THE THEN INEVITABLE SELF FULFILLING PROPHESIES OF SICKNESS AND DEATH OF GAY MEN.

    All of you HIV promoters fail to ever acknowledge what we gay men have endured over the last 25 years and what we continue to endure from you. You FAIL to own up to YOUR OWN part in it. You fail to own up to continually and nonstop project upon us our sickness and our deaths. You refuse to own up to, and admit that the very source of Gay Mens ills has been completely due to your own projections at us. Projections that we are not good enough, that we are defective. That we will die or sicken of disease. You project these things on my gay brethren, and then my gay brethren accept, believe, and self create the now self fulfilling projections that you yourselves have heaped upon them.

    The Scientific, Medical, and Heterosexual society has failed to own up to their own part in:

    THE SOCIETAL AND FAMILY REJECTION WE HAVE ENDURED.

    THE HARASSMENT WE HAVE ENDURED.

    THE SHAMING and GUILTING WE HAVE ENDURED.

    THE CONSTANT PANIC AND FEAR FROM YOUR PROJECTIONS OF OUR INEVITABLE DEATH FROM HIV/AIDS THAT WE HAVE ENDURED.

    THE POISONING BY TOXIC PHARMA DRUGS WE HAVE ENDURED.

    THE GRIEF WE HAVE ENDURED AS THOSE WE LOVE DIED FROM THE ABOVE

    THE LONELINESS WE HAVE ENDURED AS OUR RELATIONSHIPS HAVE BEEN REJECTED OR SHAMED OR DIED FROM BATTLING THE NEGATIVITY AND BELIEFS IN DEATH THAT HAVE BEEN HEAPED UPON THEM.

    THE DEATH WISHES THAT ARE DUE TO THE STRESS THAT WE HAVE ENDURED.

    THE EXPECTATIONS OF SICKNESS AND DEATH THAT WE ENDURE.

    And EACH and EVERY ONE OF YOU, that continues to project death by HIV or AIDS upon us is guilty of CONTINUING the creating of such by further stressing us with your nonstop and stress causing debilitating projections at us, until we do succumb to sickness, disease, and death.

    You heap upon us your prophesies and projections of inevitable doom and sickness and death until we ourselves are so sickened by it that we fulfill these prophesies.

    What you have done and continue to do is WRONG.

    YOU CAN ALL SHOVE YOUR PROJECTIONS OF INEVITABLE HIV AIDS DEATH, THAT YOU HAVE HEAPED ON GAYS FOR THE LAST 25 YEARS, STRAIGHT UP WHERE THE SUN DOES NOT SHINE.

    YOU CAN KEEP YOUR VOODOO AND YOUR BLACKMAGIC AND YOUR PROJECTIONS OF SICKNESS AND DEATH TO YOUR OWN SELVES.

    You HIV=DEATH believers and promoters ARE THE CAUSE OF AIDS BY YOUR OWN PROJECTIONS OF DEATH BY HIV AIDS AT US GAYS!

    AND YOU CAN ALL GO SHOVE YOUR HIV/AIDS “SCIENCE” STRAIGHT UP YOUR OWN ASS!

  79. #79 Michael
    September 20, 2007

    In the words of Ralph Lombardo himself: “Remember, this was 1985, a time when HIV was called the HTLV III virus and anything and everyone associated with it meant complete and utter doom (physically, spiritually, societally, politically, etc….”

    Yes Ralph, that was 1985, and ten years later nothing had changed, and even now 20 years later little has changed as the world continues to heap upon us death, and disease, both physical, spiritual, societal, and political.

    I dedicate my own efforts in this very thread, to wake the world up from its own self perpetuating and self creating disasters, to the late Raphael Lombardo, who succumbed nearly 10 years ago of the stress and pain that was heaped upon him as a gay man, and as someone diagnosed as HIV positive, who was simply struggling to live and to love and to serve and to be free in a world that projected nothing upon him but rejection, shame, guilt, grief, fear, sickness and projections of inevitable death.

  80. #80 Michael
    September 21, 2007

    Any of you remember Kimberly Bergalis, who supposedly died of AIDS that she supposedly got from her dentist in Florida in 1987? AIDS Incorporated used her case as the big proof that HIV is contagious.

    Unbeknownst to any of you, the reality is that she died from AZT poisoning:

    Bergalis meanwhile sought medical care at the University of Miami, where she was treated with an unidentified “experimental” method. Certainly this was the appropriate place for such therapies. Margaret Fischl, the head of the Phase II AZT trial, worked at that medical center, which had served as one of the twelve facilities sponsored by Burroughs Wellcome for the study. So Bergalis was prescribed AZT.

    Suddenly she started a precipitous decline in health. In an angry letter, she herself acknowledged her symptoms resulted from the toxic drug:

    “I have lived through the torturous ache that infested my face and neck, brought on by AZT. I have endured trips twice a week to Miami for three months only to receive painful IV injections. I’ve had blood transfusions. I’ve had a bone marrow biopsy. I cried my heart out from the pain.”

    First, she was stressed to poor physical health to begin with, then further stressed by the panic and fear of being given a diagnosis of HIV. Then, she was finally poisoned to death by AZT. The aches and pains, and poisoned blood marrow and blood transfusions are ALL well established effects of AZT.

    Self Fulfilling Prophecy.

  81. #81 Tyler DiPietro
    September 21, 2007

    Those last four comments were awesome. And by awesome I mean drop-dead hilarious. Thanks for the entertainment, Michael.

  82. #82 Michael
    September 21, 2007

    Glad you liked them Tyler, and your very welcome. Yes, emotional pain and iatrogenic illness and societal projections of sickness and death are quite humorous, now aren’t they?

    Your own post was very enlightening as well. You are obvioulsy so well spoken and such a brilliant intellectual.

  83. #83 Chris Noble
    September 21, 2007

    Unbeknownst to any of you, the reality is that she died from AZT poisoning:

    Of course it is unknown to me because it is not true.

    Bergalis meanwhile sought medical care at the University of Miami, where she was treated with an unidentified “experimental” method. Certainly this was the appropriate place for such therapies. Margaret Fischl, the head of the Phase II AZT trial, worked at that medical center, which had served as one of the twelve facilities sponsored by Burroughs Wellcome for the study. So Bergalis was prescribed AZT.

    Suddenly she started a precipitous decline in health. …

    I’ve already been through this several times.

    Bergalis had systemic candidiasis, severe weight loss, PCP and a CD4+ count of less than 50 before she was diagnosed with HIV infection let alone prescribed AZT.

    Bergalis perfectly healthy before AZT?

    You’ve fallen for another one of Duesberg’s lies.

    How does AZT travel backwards in time to cause AIDS before it was taken? Bergalis would probably never have been tested for HIV infection if she hadn’t been extremely ill in the first place. So the diagnosis cannot have been the cause of the illness.

    Raphael Lombardo’s letter says the same thing:

    My personal suspicion is that these individuals were not aware of their HIV status until they started experiencing physical complications.

    The same thing is still true today. A large proportion of people are only diagnosed with HIV infection when they turn up in hospital with AIDS.

  84. #84 Chris Noble
    September 21, 2007

    Here’s a question for Michael.

    What does Duesberg tell HIV people to do?

    As far as I can tell he says a) HIV is harmless b) AIDS is caused by recreational drugs and antiretrovirals c) if you are HIV+ and don’t take recreational drugs or antiretrovirals you won’t get AIDS.

    Raphael didn’t take recreational drugs or antiretrovirals and he still progressed to AIDS. Did Duesberg reappraise or rethink his ideas? No. He accused Raphael of lying.

    At some stage you have to give up on the hero worship.

  85. #85 Chris Noble
    September 21, 2007

    From the virusmyth webpage that Michael cited.

    In London HIV­ positive male homosexuals ar risk for AIDS formed a survivor group called “Continuum.” In August 1993 there was no mortality during 1.25 years in all 918 members of that group who had “avoided the experimental medications on offer” and chose to “abstain from or significantly reduce their use of recreational drugs, including alcohol.” (105) Assuming an average ten­year latent period from HIV to AIDS, the virus ­AIDS hypothesis would have predicted at least 58 (half of 918/10 x 1.25) AIDS cases among 918 HIV­ positives over 1.25 years. Indeed, the absence of mortality in this group over 1.25 years corresponds to a minimal latent period from HIV to AIDS of more than 1,148 (918 x 1.25) years. As of July 1, 1994, there was still not one single AIDS case in this group of 918 HIV ­positive homosexuals. (106)

    Apart from the shocking maths (where’s Darin Brown when you need a mathematician?) something else should stand out. What happened to the editorial staff of Continuum? They all died of AIDS! Huw Christie. Jodie Wells. Is Duesberg going to rethink his position? No they all must have been liars.

    Why do you guys worship Duesberg? You should realise by now that if you are HIV+ and you follow his advice and don’t take antiretrovirals or recreational drugs and yet still progress to AIDS and die then Duesberg is going to lie about you when you’re dead.

    The man deserves nothing less than contempt.

  86. #86 Michael
    September 21, 2007

    Hey Chris. You PIECE OF SHIT LIAR! Right in the New York Times Interview, Bergalis overtly states and even overdramatizes a few mostly very minor complaints and a simple case of common thrush. She herself said:

    Within a month of the 1987 tooth extraction, Miss Bergalis said, bumps broke out on her face, and she began to suffer from a sore throat. (A month later she had a sore throat? Bumps on her face? Since when are sore throats a sign of HIV infection only one month after the supposed infection by HIV occurred? Since when are bumps on a face linked to 30 days of HIV infection? Totally obvious that this is pure and complete hyped up bullshit Chris! No such thing happens to anyone else 30 days after people are supposedly infected!)

    ….Then these symptoms disappeared until late in the spring of 1989, as she was about to graduate from the University of Florida. Then came a parade of infections, big and little — sore throats, weakness, coughing, white patches in her mouth. (She was obviously VERY Stressed out by finals and by graduation and by who knows what else and then came down with what looks like symptoms of any common cold and flu along with a more or less common case of simple oral thrush that lots of run down or emotionally/physically stressed HIV negative people get quite often.)

    ….But she had a hectic schedule. “I thought I was just stressed out,” she recalled (TOTALLY ADMITTED TO BEING STRESSED OUT). A Doctor Was Puzzled (Must be because he was a complete idiot like Chris Noble)….

    When she saw a doctor for the infection in her mouth, he said it was peculiar; it looked like thrush. (What the fuck? A doctor who never saw a common case of thrush? Was this imbecile just a month out of med school or what?)

    “Are you a diabetic?” he asked.

    “No,” she said.

    “Are you on antibiotics?”

    “No.”

    “That’s funny. Usually, you only get thrush when you’re a newborn, a diabetic, on antibiotics. Or if you have AIDS.”
    ———————————————————–
    Chris, who are you trying to bullshit besides yourself?
    Once Again,
    we find a doctor paralyzing a stressed out minorly ill patient’s immune system even further, with the devastating panic and fear of death by telling her she most likely had AIDS, when all she had was a not uncommon oral thrush infection!

    And Chris, you lying piece of shit. You lie and said before she was HIV diagnosed that she had wasting, PCP, systemic candidiasis, Low CD4 counts (when nobody EVER took her count before being diagnosed as HIV!)

    Quite obvious again, Chris, that you do nothing but lie, exagerate, and bullshit! Shove it up your ass Chris. Bergalis simply got caught up in the wave of mass hysteria in 1987 to 89 that swept the country. Another more than obvious case of iatrogenic death combined with the patients own self creating prophesy due to stress, fear, panic, brainwashing, and more of your voodoo blackmagic bullshit.

    Hey Chris. One more time. This ones just for YOU. GO Shove your voodoo and blackmagic BULLSHIT STRAIGHT UP YOUR OWN ASS CHRIS.

  87. #87 Michael
    September 21, 2007

    “The man deserves nothing less than contempt.”

    The only one that deserves contempt here, Chris, is YOU!

    The only things you have EVER PRESENTED to us in the last few years, Chris, are rants, screeds, easily picked apart and easily exposed as lacking any substance, very circumstantial, very flimsy, very third hand, very he said-she said, very conflict of interest filled and are also full of nothing but your own projections of your own hatred, homophobia, rascism, germaphobia, paranoia of aids and the projection at others of your own hypochondriacal illness.

    Go fuck yourself.

  88. #88 Chris Noble
    September 21, 2007

    Michael. You are correct. Bergalis’ CD4 cells were probably not measured before the diagnosis of HIV infection.

    They were measured before she was prescribed AZT.

    Happy now?

    She was extremely ill before ever getting near AZT.

    Duesberg’s claim that she was perfectly healthy before taking AZT is a complete lie.

  89. #89 Tyler DiPietro
    September 21, 2007

    “Yes, emotional pain and iatrogenic illness and societal projections of sickness and death are quite humorous, now aren’t they?”

    When I can numb the empathy enough, hell yeah!

    But on the other hand, no, that’s not what I intended. I was thinking more along the lines of hysterical cranks tossing around borderline accusations of murder to an online community.

  90. #90 Michael
    September 21, 2007

    You are welcome to take it any way you want Tyler. Hysterical? Or direct? Crank? or striking nerves because it is a bit too much reality? Borderline accusations of murder? Or pointing out another quite valid perspective?

    I am open to suggestions if you think there is perhaps some other way to wake people up to the iatrogenic and societal aspects of the discussed situation. Seems you yourself did not take it too well, though you also did not take it as badly as some do. Especially as you yourself admit to the need to “numb the empathy”. Can’t say I blame you, Ty. Not your fault that you perhaps find it difficult to stomach some of the quite possible or even probable, if not even “absolute” “realities” that I have presented here.

    You know it has oft been said that “the truth hurts”. Sometimes the truth hurts so much that people, or at least their egos, go right into escapism, denial, anger, humor, and a lot of other interesting but quite human egoic responses as I quite knowingly probe and poke at this festering sore on the ass of all of mankind in hopes of cleaning the would by exposing it to the light of truth. I do understand. I have seen most all of the responses possible in reacting to what I have pointed out quite clearly. I have yet to hear any admit to what I have said. To do so is far too painful. And I certainly do not expect an apology from anyone’s ego. Certainly not one online or in public. Would be nice, wouldn’t make up for or change any of the losses, and it is certainly not necessary, as al must take its course, but from my own ego’s viewpoint, it most surely it would be nice. However, I certainly do not expect or demand one from anyone.

  91. #91 Michael
    September 21, 2007

    “Duesberg’s claim that she was perfectly healthy before taking AZT is a complete lie.”

    Strange Chris, but I have never seen where Duesberg claimed she was “perfectly healthy” before taking AZT. Perhaps you will show us the quote, and where exactly it is to be found, other than in the dark recesses of your own imagination.

    On the other hand, the now verified “truth” is, that Chris Nobles’s claim that Kim Bergalis had a low CD4 count of 50 before being diagnosed as HIV positive, is absolutely, as you yourself even just admitted, was a complete lie.

    Hmmmm. Who should I believe more, Chris or Dr. Duesberg? Hmmmm…..

  92. #92 Tyler DiPietro
    September 21, 2007

    “Not your fault that you perhaps find it difficult to stomach some of the quite possible or even probable, if not even “absolute” “realities” that I have presented here.”

    This is really funny. What you’ve presented here is a series of long winded rants that consist of cut and pasted articles that demonstrate nothing regarding the various claims you’ve made (hint: someone claiming that they experienced stress does not necessitate to notion that they died of the stress). And to top it off, they’re complete with RANDOM CAPITALIZATION, unnecessary boldface and baseless accusations of “lying” to people like Chris. “Crank” is almost too generous for this tripe.

  93. #93 Chris Noble
    September 21, 2007

    And Chris, you lying piece of shit. You lie and said before she was HIV diagnosed that she had wasting, PCP, systemic candidiasis, Low CD4 counts (when nobody EVER took her count before being diagnosed as HIV!)

    Have you read the article? She had candidiasis, weight loss, hair loss and PCP before she was diagnosed with AIDS or tested for HIV.
    The pneumonia wasn’t just any pneumonia it was PCP. Duesberg lies about Bergalis in “Inventing the AIDS virus”. Duesberg claims she was perfectly healthy before taking AZT. All of the symptoms that Duesberg ascribes to “AZT posioning” occurred before she took the drug.

    Only when the crisis passed and tests revealed that she had pneumocystis pneumonia, typical of AIDS patients, did the doctors treating her suggest she be tested for HIV infection.

    If you are going to accuse me of lying then try to get your facts straight.

  94. #94 jspreen
    September 21, 2007

    Just a point of pride among veterinarians, as Dr. Rous was the first to discover a viral cause of cancer, something for which he was rewarded with the Nobel Prize in Physiology or Medicine in 1966.

    Yeah! Discovered in 1966. Then, from 1973 to 1981 or so the whole world has been tracking down the viral cause of cancer. ZERO result. So the budget went low. Came smart Gallo&Co with HIV=Aids. All virologists moved over from cancer research to Aids research and the budget went rocking sky high again. They seem to have learned from the cancer distaster and now their research money may well last forever. HIV, west-nile, marburg, ebola, HxNx, corona. I tell you, it’s a gold mine. And the lie may be stupid and deadly, but also she’s so big, only few seem to be able to imagine it’s a lie.
    Right on Michael, Dan, cooler, carter, Noreen and whoever else I didn’t notice.

  95. #95 noreen
    September 21, 2007

    Actually, the virus theory of cancer goes farther back to Royal Rife and a collegue of his, Virginia Livingston, who publicly acknowledged the first cancer virus. I think that Gallo and others may have been on the right track but with their closed minds in other areas such as pleomorphism were not able to duplicate results that had already been proven.

    Yes, no one wants to give up the gravy train so they all play the game and assume that HIV causes AIDS. If AIDS went away so would their funding. They may be unethical but not stupid. In the interim, the patient suffers from the grade four events, side effects from the long-term use of the meds. Thank you Tara as you are helping the world to see the truth!

  96. #96 carter
    September 21, 2007

    Bergalis said in that article, “Here I was, 21 years old,” she says. “Faced with a diagnosis of AIDS. It’s a fatal illness. It’s hard enough to deal with the stress of having a terminal illness.”

    Chris, do you think that the mere suggestion implanted into Kim’s psyche that she had several years to live could manifest itself into several illnesses such those ones she complained about? Take any of those illnesses one by one and without the death sentence can be fought off easily by western and/or natural remedies. Oh, but no, no, no, wait just a minute! It must be HIV! Even if AZT or it’s water down version, still being prescribed today has side effects somewhat indistinguishable from AIDS itself, Kim’s ATZ monotherapy is without a doubt is the icing on the cake. No amount of your psycho babel is going to change that hard core reality.

    Bergalis is all but just one example. AZT singularly was pushed so readily then you cannot ever call into question that it was not the final means of slow and excruciating painful death when a person is handed the dreaded “So sorry for you but you have just so many years to live.”

    You Chris are distorting that we say and making it seem like we’re saying AZT causes HIV, obviously because the public is taught the notion HIV/AIDS, “HIV disease” and all the like. AZT causes several of the AIDS defining illnesses and you cant dispute that.

  97. #97 apy
    September 21, 2007

    Chris, do you think that the mere suggestion implanted into Kim’s psyche that she had several years to live could manifest itself into several illnesses such those ones she complained about?

    Your timeline seems a bit skewed here carter. Are you suggesting that stress can travel back in time and make someone sick (with fairly classic AIDS diseases) which then causes the diagnosis of stress that caused the diseases which then goes back in time and make someone sick …?

    Are you saying that she was not sick prior to being diagnosed as HIV+ and with AIDS?

    If you went into a hospital with a runny nose, cough, and phlegm and were diagnosed with a cold, would you then conclude that the diagnosis of a cold was the reason you originally felt sick?

  98. #98 franklin
    September 21, 2007

    Michael,

    For someone whose lover was diagnosed with HIV infection six years ago and who claims to know so much about HIV/AIDS, every time you post you reveal a profound ignorance of the medical and scientific literature.

    You say Kimberly Bergalis “overdramatizes a few mostly very minor complaints”:

    Within a month of the 1987 tooth extraction, Miss Bergalis said, bumps broke out on her face, and she began to suffer from a sore throat. (A month later she had a sore throat? Bumps on her face? Since when are sore throats a sign of HIV infection only one month after the supposed infection by HIV occurred? Since when are bumps on a face linked to 30 days of HIV infection? Totally obvious that this is pure and complete hyped up bullshit Chris! No such thing happens to anyone else 30 days after people are supposedly infected!) [Michael's Emphasis]

    Since when? Well, these symptoms have been identified within 30 days of HIV infection since at least 1985:

    Cooper DA, Gold J, Maclean P, Donovan B, Finlayson R, Barnes TG, Michelmore HM, Brooke P, Penny R. (1985). Acute AIDS retrovirus infection. Definition of a clinical illness associated with seroconversion. Lancet Mar 9;1(8428):537-40.

    Abstract: In the course of a prospective immunoepidemiological study of homosexual men in Sydney, seroconversion to the AIDS-associated retrovirus (ARV) was observed in 12 subjects. Review of the clinical files defined an acute infectious-mononucleosis-like illness in 11 subjects. The illness was of sudden onset, lasted from 3 to 14 days, and was associated with fevers, sweats, malaise, lethargy, anorexia, nausea, myalgia, arthralgia, headaches, sore throat, diarrhoea, generalised lymphadenopathy, a macular erythematous truncal eruption, and thrombocytopenia. In 1 subject an incubation period of 6 days after presumed exposure to ARV was determined and in 3 subjects seroconversion took place 19, 32, and 56 days after onset. Comparison of T-cell subsets before and after the acute illness showed inversion of T4:T8 ratio in 8 subjects, due to increased numbers of circulating T8+ cells. These findings support the notion of an acute clinical, immunological, and serological response to infection with ARV which should be considered in the differential diagnosis of mononucleosis-like syndromes in groups at high risk for the development of AIDS.

    Later, you suggest that Tyler may find “it difficult to stomach some of the quite possible or even probable, if not even “absolute” “realities” that I have presented here.”

    Michael, you have told us several times how you believe that by denying the role of HIV in AIDS you will save your lover’s life. Every one of your posts is an exercise in the denial of the terrifying reality that has invaded your life.

    As you, yourself said:

    Sometimes the truth hurts so much that people, or at least their egos, go right into escapism, denial, anger, humor, and a lot of other interesting but quite human egoic responses

    There is no better description of your response to the very real and frightening personal crisis you face.

  99. #99 jspreen
    September 21, 2007

    If you went into a hospital with a runny nose, cough, and phlegm and were diagnosed with a cold, would you then conclude that the diagnosis of a cold was the reason you originally felt sick?

    No, stupid. Now, have a strong coffee, wake up and think. If one goes into a hospital with a running nose, is diagnosed with AIDS and falls severly ill, after the shock of the diagnosis and the life-saving killer-drugs, then one may reasonably presume that something else than “The initial running nose caused a severe disease”.

    But I guess you’ll never understand that because you simply don’t want things to be like that. Thus it’s not stupidity but something else that keeps you looking away from where you should look. Sorry for the No, stupid. It makes no sense. Sorry.

  100. #100 ElkMountainMan
    September 21, 2007

    Carter suggests that AZT

    has side effects somewhat indistinguishable from AIDS itself.

    This is another noxious nugget from Duesberg…and wrong.

    Duesberg’s “Drug Diseases” review from 1998 (page 118) lists two AIDS-defining conditions out of the 25 or so CDC clinical diagnostic criteria that are also side effects of AZT…according to Duesberg, of course.

    One of them is muscle wasting. It’s true that AZT can cause myopathy. But muscle weakness on its own is not AIDS-defining. AIDS-defining wasting involves

    profound involuntary weight loss of greater than 10% of baseline body weight plus either chronic diarrhea (at least two loose stools per day for greater than or equal to 30 days), or chronic weakness and documented fever (for greater than or equal to 30 days, intermittent or constant) in the absence of a concurrent illness or condition other than HIV infection that could explain the findings (e.g., cancer, tuberculosis, cryptosporidiosis, or other specific enteritis). (From the CDC 1993 definition)

    In other words, an AIDS diagnosis based on wasting requires profound weight loss AND chronic weakness in the presence of fever. This type of wasting can be caused by numerous conditions, including several AIDS-defining conditions; that’s why the CDC insists that other possible causes be ruled out.

    Duesberg’s evidence is a report of “four out of five” patients who recover from myopathy after going off AZT (as reported in 1990). Duesberg doesn’t bother to confirm for his readers that the myopathy experienced by these patients is in fact related to AIDS-defining wasting. He backs up his assertions by mentioning that Rudolf Nureyev and Kimberley Bergalis both had muscle wasting.

    Duesberg either confuses myopathy with AIDS-defining wasting or fully understands the difference but neglects to enlighten (i.e. misleads) his readers.

    The other condition mentioned by Duesberg is HIV-associated dementia. AZT causes dementia, says Duesberg, and he refers to one article from 1991. His thought process is: AZT is said to inhibit mitochondrial DNA synthesis, neurons have mitochondria, therefore AZT causes AIDS-defining dementia.

    Since Duesberg doesn’t study AIDS or work with clinicians who treat it, I suppose he doesn’t realize that many patients who show up in the clinic with HIV-associated dementia have never taken anti-HIV drugs. Many of these patients experience marked cognitive improvements on HAART. Treated HIV dementia patients also survive about seven or eight times longer than untreated patients.

    To reference his assertion, Duesberg cites a report from a cohort study (Bacellar et al, 1994). The authors note an increase in HIV-associated dementia among men who reported antiviral use. The sample size was small, and there was no statistical significance. Duesberg, obviously unfamiliar with this concept, comments, “The result is interpreted by its authors with little concern for percentages.” “Percentages,” Professor Duesberg? In any case, the authors also note that the men who began taking antiretrovirals did so because they were less healthy than the men who did not. This simplest explanation is discarded by Duesberg in favor of his own relatively unsupported theory.

    (What about drugs of abuse and HIV-associated dementia? Drug use is a confounding factor, and it is considered at diagnosis. For a diagnosis of HIV dementia, no known confounding factors should be present. See the CDC’s definitions.)

    No, Carter, AZT’s side effects are not indistinguishable from AIDS. That’s just another Duesberg distortion.

    Carter, I encourage you not to rely on non-experts, quacks, and ideological partisans to address your health concerns. Please be sure to consult a qualified doctor. Denialism has killed too many people already.

  101. #101 apy
    September 21, 2007

    No, stupid. Now, have a strong coffee, wake up and think. If one goes into a hospital with a running nose, is diagnosed with AIDS and falls severly ill, after the shock of the diagnosis and the life-saving killer-drugs, then one may reasonably presume that something else than “The initial running nose caused a severe disease”.

    This goes a whole lot faster if you actually pay attention to the thread jspreen. The use of a runny nose was what people in the English speaking world refer to as an “analogy”. The claim is not that someone came in with a runny nose and was diagnosed with AIDS and then all the AIDS symptoms came up magically after that diagnosis. No, it is that they came in with symptoms that suggest AIDS (such as PCP), and was then tested and determined to have low CD4+ count and HIV+ with high viral load. This means that the AIDS like symptoms came before the diagnosis of AIDS, which makes them rather difficult to attribute to the diagnosis.

    The question is if this is the timeline that actually happened, which there appears to be some dispute about but as usual AIDS rethinkers try to push the conversation in a new direction without answering questions.

  102. #102 jspreen
    September 21, 2007

    The claim is not that someone came in with a runny nose and was diagnosed with AIDS

    Yes, in a certain way it’s exactly that. But if you wish you can replace runny nose with anything you want, it doesn’t matter. What matters is that there’s absolutely no way you can tell who has AIDS and who has not. HIV tests are worthless because you don’t know what exactly HIV is and have never found exactly what you think it is in a persons blood or elsewhere. Low CD4+ counts are worthless, so many people’s count are low. Starving people, people on chemo, etc etc.
    Telling a person has Aids is just arbitrary. But it won’t make him or her fell better. On the contrary. It will make him or her feel terribly bad. Deny that, if you dare.

  103. #103 apy
    September 21, 2007

    Yes, in a certain way it’s exactly that. But if you wish you can replace runny nose with anything you want, it doesn’t matter.

    No, it’s completely different. One is saying someone comes in with an illness, gets diagnosed with another illness and comes down with the symptoms of the other illness. The other is saying someone comes in with the symptoms of an illness, and is diagnosed with it.

    Telling a person has Aids is just arbitrary.

    No, it is based on a series of tests that give specific results and these results are then used to determine if someone has a particular disease. You can disagree with the tests if you desire, but the diagnosis is based off these tests, not arbitrary.

  104. #104 jspreen
    September 21, 2007

    No, it is based on a series of tests that give specific results

    Specific results, certainly, but specific for what, you can’t tell.

    Diseases have not changed, what you call “AIDS symptoms” is nothing new but before nobody called them “AIDS symptoms”. In the olden days people where ill, more or less severely. But today self-proclaimed experts, who know nothing about the answer to the question “What is life”, dare tell people “You have one month/ten years” to live. They act as if they were God but they don’t know shit about how many hours/weeks/monts/years a man has yet to go.

  105. #105 apy
    September 21, 2007

    Diseases have not changed, what you call “AIDS symptoms” is nothing new but before nobody called them “AIDS symptoms”.

    So it is your belief that all diseases have come to their final resting point in terms of what they do and how?

    Is it fair to come to the conclusion that you do not believe in evolution as well?

  106. #106 ElkMountainMan
    September 21, 2007

    apy,

    Spreen doesn’t know the first thing about HIV or infectious disease, and he refuses to learn. Your logic falls on deaf ears. He doesn’t understand that it was precisely the massive increase in PCP cases that alerted the medical community to the presence of a new problem almost 30 years ago.

    Bergalis displayed typical acute phase symptoms in 1987 and then became sick again in early 1989. She had candidiasis. For months, she was constantly sick, weak, and losing weight until she finally was forced to enter the hospital. She was treated for pneumonia and the doctors discovered that it was PCP. Only at this point did anyone propose a test for HIV. The test was positive.

    Here’s how Duesberg describes Bergalis’ health on page 349 of “Inventing the AIDS Virus”:

    “…a brief pneumonia that December sent her to the hospital, where the doctor decided out of the blue to test her for HIV. As chance would have it, she had antibodies against the virus.”

    Distorting further, Duesberg continues

    “Up to this point, none of her occasional diseases differed from the common health problems many HIV-negative people encounter.”

    A “life-threatening bout” of PCP (to quote the New York Times of 9 Feb 1991) becomes a “brief pneumonia” and a “common health problem” in Duesberg’s hands. Faced with an AIDS-defining illness in a patient with no apparent risk factors, any competent doctor would test for HIV…to Duesberg, this is “out of the blue.” Only by “chance” did Bergalis have “antibodies” to HIV…and Duesberg ignores Bergalis’ positive PCR results.

    Duesberg’s version of the Bergalis case, like most of what he has written on HIV, is an embarassment to UC Berkeley and to science in general.

  107. #107 jspreen
    September 21, 2007

    So it is your belief that all diseases have come to their final resting point in terms of what they do and how?

    Of course. But if you introduce new elements in the system you may have the impression that something has changed. Like car accidents were quite rare in the middle ages. But the broken bones are the same, whether you were hit by a horse, an axe or a car. Today people see things they never saw before, with a electronic microscope for instance. But what they see is not new.
    Isn’t it remarkable, the virus-shit hitting the fan just now we can have a closer look to microbes? Millions of years have past by but HIV waited for modern techiques and chose 1981. Of course. Like no TV stars before the 2Oth century.

  108. #108 apy
    September 21, 2007

    Well you put me in my place!

  109. #109 Kausik Datta
    September 21, 2007

    I guess it is of no use whatsoever to point out to the denialist crowd a nice review article that came out recently in Immunity, about HIV Controllers, and mechanisms of durable virus control in the absence of antiretroviral therapy (Immunity, Volume 27, Issue 3, 21 September 2007, Pages 406-416 by Steven G. Deeks and Bruce D. Walker). The denialists and crazy conspiracy theorists won’t be convinced by any rational argument anyway, but long-term survivors like Noreen may understand better that they happen to belong to a small, but extremely fortunate, subset of HIV infected people, in whom in vivo attenuation of the virus, host genetics and innate immunity – singly or in combination – may provide the benefit of long-term survival, even without anti-retrovirals. It is a pity that Noreen has decided to join the throng of the denialists, but in reality, studying people like her – the so-called HIV controllers – offers an excellent and exciting opportunity to understand the nuances of the physiological defences and therapeutic options against HIV infection and AIDS.

  110. #110 Ben Gorman
    September 21, 2007

    ElkmountainMan,

    You’re a fucking idiot and a poseur. You entirely ignore the FACT that Kimberly Bergalis was treated with AZT, and complained about it. Here’s her testimony to Congress

    “I have lived through the torturous acne that infested my face and neck, brought on by AZT. I have endured trips twice a week to Miami for three months only to receive painful IV injections. I’ve had blood transfusions. I’ve had a bone marrow biopsy. I cried my heart out from the pain.” (Lauritsen, AIDS War, Page 324.)

    The toxic cancer chemo, AZT, that Duesberg was right to decry, was used to kill the first generation of AIDS patients, most of which were young gay men. Little Kimberly — the only person in the world to allegedly get HIV from a dentist(!) was a nice, little casualty that helped scare small-town America (everyone is at risk!) and grease the wheels of government funding.

  111. #111 Franklin
    September 21, 2007

    Ben,

    Nobody is ignoring Kimberly Bergalis’s treatment with AZT. The only ones ignoring the facts are the Denialists, who continue to ignore that Bergalis had a severe immune deficiency with Pneumocystis pneumonia prior to being diagnosed with AIDS and prior to being treated with AZT.

    You are so lacking in compassion and ignorant of the facts that as you mock her you claim Bergalis’s case was unique:

    Little Kimberly — the only person in the world to allegedly get HIV from a dentist(!) was a nice, little casualty that helped scare small-town America (everyone is at risk!) and grease the wheels of government funding.

    To you AIDS victims are objects of scorn simply because their deaths are the inconvenient reality that you are so desperately trying to deny. The facts mean nothing to you:

    The Associated Press, Sat, 17 Dec 94

    Dentist AIDS Victim Dies

    STUART, Fla. (AP) — The fourth of six people infected with the AIDS virus by a dentist died Saturday. Barbara Webb, 68, slipped into a semi-coma earlier in the week, according to Hospice of Martin. She died on her 45th wedding anniversary to her husband, Robert. “She was never bitter about her death,” said hospice counselor Pam Jett. “She didn’t dwell on the future, she lived in the present.” Two years ago, a federal study concluded that six of Dr. David Acer’s patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus. Acer, of Jensen Beach, Fla., died in 1990. He is the only health professional ever known to have transmitted HIV to his patients. Among those infected was Kimberly Bergalis, who waged a crusade for mandatory testing of health care workers before she died in December 1991. Webb, a former high school English teacher and grandmother of eight, gave dozens of speeches nationwide about living with AIDS. She was the teacher of the year in 1986-87 at Martin County High School. Webb is survived by her husband and three grown children.

  112. #112 ElkMountainMan
    September 21, 2007

    Ben,

    Do you deny that Kimberly Bergalis had experienced profound weight loss, a life-threatening bout with PCP, and candidiasis, in addition to many other health problems, all before being tested for HIV? And that her CD4+ T-cell count was depressed before she took AZT?

    These are all matters of public record. As are the problems with AZT monotherapy, problems that I don’t deny.

    AZT can cause anemia, and it can cause myopathy. It can also cause depletion of neutrophils. None of these is on its own an AIDS-defining condition.

  113. #113 Michael
    September 21, 2007

    Franklin, please do EXPLAIN to us, just how a dentist transferred his own strain of your beloved HIV to six of his patients.

    Two years ago, a federal study concluded that six of Dr. David Acer’s patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus.

    Baffled? BAFFLED???? STILL FREAKING BAFFLED?????? Only the simplest of minds could yet be baffled by this.

    What is so baffling about scaring six people plus the dentist into taking and dying of high dosage AZT monotherapy iatrogenic poisoning in the late 80s?

    Poor baffled and conflict of interest laden Franklin, please unbaffle us so we can rejoin you and the rest of the the faithful believers in HIV.

    Franklin, you must explain this great mystery of life to us.

    Now tell us. How did the naughty disgusting HIV infected bad ole boogeyman dentist transfer HIS OWN STRAIN OF HIV to his patients?

    Did he have anal sex with his patients including the grandma?

    Did he have his dental instruments up his ass just before cleaning their teeth?

    Did he drool blood into their mouths?

    Did he fail to sterilize his bloody instruments that he must have just used on himself to have transmitted his own supposed virus to the patients?

    Until you explain how Acer transmitted the virus to 6 of his patients over a vast period of time, you are to be considered nothing but a cornflake swirling through the clouds of a still mass hysteria driven false belief system.

    The indisputable fact is that HIV fails every scientific test to be called the cause of AIDS, including Koch’s Postulates, Farr’s Law, the first epidemiological law of viral and microbial diseases, cluster formations, and
    even the definition of the word ‘infectious’ itself – tried and true criteria that have been in use in medical research for decades, but are now discarded to support the theory that HIV=AIDS.

  114. #114 jspreen
    September 21, 2007

    but long-term survivors like Noreen may understand better that they happen to belong to a small, but extremely fortunate, subset of HIV infected people,

    Ha! Ha! Ha! The guy just realized that a person like Noreen is one of the pillars of the Aids rethinkers movement so now he smears honey all around to attract her over into his camp.

    . . . Extremely fortunate . . . Ha! Ha! Ha! In a certain way you’re right but it has a lot more to do with being intelligent than with being fortunate. OK, you’re right. Noreen is fortunate to be intelligent. But I bet that that was not what you meant to say.
    Anyway, all HIV-deniers are intelligent. Being intelligent is the most important criterium to become a denialist. Being a HIV-denier means you’re part of the few against herds of nerds. Didn’t you know?

  115. #115 Michael
    September 21, 2007

    Franklin, please do EXPLAIN to us, just how a dentist transferred his own strain of your beloved HIV to six of his patients.

    Two years ago, a federal study concluded that six of Dr. David Acer’s patients contracted HIV from him. Scientists are baffled as to precisely how Acer transmitted the virus.

    Baffled? BAFFLED???? STILL FREAKING BAFFLED?????? Only the simplest of minds could yet be baffled by this.

    What is so baffling about scaring six people plus the dentist into taking and dying of high dosage AZT monotherapy iatrogenic poisoning in the late 80s?

    Poor baffled and conflict of interest laden Franklin, please unbaffle us so we can rejoin you and the rest of the the faithful believers in HIV.

    Franklin, you must explain this great mystery of life to us.

    Now tell us. How did the naughty disgusting HIV infected bad ole boogeyman dentist transfer HIS OWN STRAIN OF HIV to his patients?

    Did he have anal sex with his patients including the grandma?

    Did he have his dental instruments up his ass just before cleaning their teeth?

    Did he drool blood into their mouths?

    Did he fail to sterilize his bloody instruments that he must have just used on himself to have transmitted his own supposed virus to the patients?

    Until you explain how Acer transmitted the virus to 6 of his patients over a vast period of time, you are to be considered nothing but a cornflake swirling through the clouds of a still mass hysteria driven false belief system.

    The indisputable fact is that HIV fails every scientific test to be called the cause of AIDS, including Koch’s Postulates, Farr’s Law, the first epidemiological law of viral and microbial diseases, cluster formations, and
    even the definition of the word ‘infectious’ itself – tried and true criteria that have been in use in medical research for decades, but are now discarded to support the theory that HIV=AIDS.

  116. #116 Jim
    September 21, 2007

    “You know it has oft been said that “the truth hurts”. Sometimes the truth hurts so much that people, or at least their egos, go right into escapism, denial, anger, humor, and a lot of other interesting but quite human egoic responses”

    Oh the irony in that statement is just beautiful. Thanks Michael, I needed a good laugh.

  117. #117 Michael
    September 21, 2007

    Hey Elk. Same question to you as well?

    How did the evil dentist transfer his own strain of HIV to 6 patients?

    It is obvious to all but the deluded, upon looking at this very case, that only a hysteric and panicked mind could rationalize itself into believing or making anything sensible out of this.

    Hey Elk, ever consider that in believing such nonsense yourself, that your overactive imagination is simply trapped by its own living nightmares that upon anyt rational inspection are obviously composed of completely irrational nonsense?

    If you were deluded, how would you even know?

    Certainly looks to be the case to me.

    Until you figure it out, please do explain, along with Franklin, just how the doctor, over quite a period of time, gave six of his patients, including the Grandma Franklin presented above, his very own genetic strain of HIV?

    Personally, I think the buttf**k option is the most intriguing and rational choice to me! But then again, I am gay!

  118. #118 Michael
    September 21, 2007

    Franklin and Elk,

    after you finish explaining to us how the dentist gave six people his own strain of HIV, that was supposedly verified genetically by the wonder team at Los Alamos, then explain how HIV caused the Grandma: “Barbara Webb, 68, slipped into a semi-coma earlier in the week, according to Hospice of Martin”.

    Do you guys, especially you, Dr. Franklin, the world renowned HIV researcher, get some kind of perverse cheap thrill, that the rest of us have not clued in on, in scaring lots of people, including little old grandma school teachers, to death?

  119. #119 ElkMountainMan
    September 21, 2007

    Michael,

    Let’s start with what we know about Bergalis. We know that Kimberly Bergalis was infected with HIV and died of AIDS.

    How did Bergalis contract HIV? That, we don’t know. I don’t know, and neither do you. The CDC report found similarities between the virus recovered from Bergalis and other infected dental patients and HIV from the dentist, David Acer. These similarities were not found in other HIV+ persons in the surrounding community. Later reports disputed these findings. Acer’s insurance company and the referring insurance company both found the evidence for transmission convincing and settled suits with Bergalis.

    But that’s not proof. I’m not sure if we will ever know how Acer’s patients were infected. Some have alleged that Bergalis herself was not a virgin, that she may have been infected during sex but refused to admit it for religious and family reasons. Maybe they’re right.

    A motive for intentional infection by the dentist has also been suggested. James Dawes reports in Narrating Disease: AIDS, Consent, and the Ethics of Representation (Social Text, 43, 27-44) the concerns of Acer’s friend Edward Parsons. According to Parsons, Acer was frustrated with the public perception of AIDS as a “gay disease” and the resulting inaction on the part of the government. Acer once said something would only be done “when it starts affecting grandmothers and younger people.” Grandmothers like Ms. Webb, who died at 68? Younger people like Bergalis, who was allegedly infected at 19? If Acer indeed transmitted HIV to his patients, it was no accident.

    I’ll agree with you on that, Michael. There’s no conceivable way for a dentist following proper procedures to infect a patient…other than injecting her with infected blood (or having sex with her, which the investigators ruled out…but who knows?). The motive appears to be present: Acer wanted to force a more effective government response to the spreading AIDS pandemic. But of course that doesn’t mean he really did it.

    However Bergalis got infected, it’s a matter of public record that she developed several AIDS-defining illnesses before being tested, and that she died despite (not because of) subsequent medical treatment.

    Here’s something you might be able to help me with, Michael: did Dr. Acer commit suicide? Media reports state that he died of AIDS, but word on the rethinker street (especially in the Chicago area) is that he killed himself, hounded by the media and government. Is this true? Are there any records? Thanks.

  120. #120 Michael
    September 21, 2007

    Franklin, When did slipping into a coma become an AIDS defining illness due to HIV?

  121. #121 franklin
    September 21, 2007

    Michael,

    You continue to heap scorn on the dead who are unable to defend themselves.

    How that makes you feel better about the gravity of your situation is beyond me.

    But as you said:

    You know it has oft been said that “the truth hurts”. Sometimes the truth hurts so much that people, or at least their egos, go right into escapism, denial, anger, humor, and a lot of other interesting but quite human egoic responses

    “Interesting” wouldn’t be my first choice to describe your “egoic response,” but then again psychopathology has never been a primary interest of mine. You are just a sad case.

    Here is a serious discussion of the case of the Forida dentist, for any who are ineterested.

  122. #122 apy
    September 21, 2007

    Ha! Ha! Ha! The guy just realized that a person like Noreen is one of the pillars of the Aids rethinkers movement so now he smears honey all around to attract her over into his camp.

    Judging from the long stream of posts to noreen to have her explain how she comes up with her information and being either ignored or given some more copy&pasted website junk I would be hesitant to say noreen has done any thinking, much less rethinking.

  123. #123 Michael
    September 21, 2007

    Elk. You said:

    “Let’s start with what we know about Bergalis.”

    Good idea. That means we empty our minds of all preconceived beliefs and start back at the beginning, and ADMIT, that in reality, we KNOW NOTHING FOR SURE.

    Then you said:

    “We know that Kimberly Bergalis was infected with HIV and died of AIDS.”

    No Elk, you are jumping the gun here. You are putting the cart before the horse. In reality we DON”T KNOW such. You only “believe” such, and “presume” such to be true.

    But your ego fails to allow you to view anything from such a perspective. See Elk, I really do understand you and how your mind operates.

    Further down you even ADMIT that you do not know.

    Then you go on to suspect the victim had sex with someone who just so happened to have HIV. Yet heterosexual sex is quite verified by Nancy Padian to result in HIV transference in less than 1 out of a thousand episodes. And for all we know, it is 0 out of a thousand, cause Padian noted zero transfer in sero-opposite heteros.

    Then you want to jump, like a Mexican jumping bean, to accusing the dentist of intentionally giving people HIV. No proof, just your bit about someone said that someone said that Acer had motive to intentionally infect someone.

    Yet, the simplest explanation, and by far the most rational, is that you sir, unbeknownst even to your own self, are seemingly quite delusional.

    And if Acer did commit suicide, certainly it would be no surprise that he was driven to such, by those such as even your very own self, and others such as Franklin, and all those who pursue their “witch hunt” of unverified, unsubstantiated, unproven, and irrational accusations.

    So which was it, Elk, was Kim a hooker, a drug addict, a slut,

    or was she simply an emotionally overwrought stressed young women, as she herself admitted, who was already susceptible to illness, and perhaps even further susceptible to suggestion of death, and sickened by her own negative focus on what she believed was to be an inevitable death by AIDS.

    Was the dentist really an evil heartless killer, or was he too falsely accused and driven to sickness or death, or even to suicide by being caught up in the frenzy of the witchhunt and frenzy of mass public hysteria at that time?

    Now Elk, be sure to also carefully explain to us how HIV caused grandma to slip into a coma. Cause I swear, that the HIV retrovirus is so cunning, it can undoubtably jump through flaming hoola hoops while dancing, singing, and drinking a martini and all the while being actively involved in the cell by cell cellular destruction taking place in ones mind.

  124. #124 Michael
    September 21, 2007

    Franklin, ease up on the babbling, and simply explain the baffling.

    Until you do, your very own words, “You are just a sad case” are gonna keep on commin’ right back atcha!

  125. #125 noreen
    September 21, 2007

    Apy, are you HIV+ or have you had AIDS? I would not be so fast to throw stones at others. I had AIDS so therefore I do have some experience in the matter. You believe studies yet some of you will not listen to those of us who have the disease. I have lived almost two years without the antiretrovirals and haven’t had one opportunistic infection. Therefore, I don’t need either side to convince me of anything as I am living proof that it can be done. So both sides can argue this until hell freezes over and I will not change sometime that is working quite well for me!

  126. #126 ElkMountainMan
    September 21, 2007

    Michael,

    You are misrepresenting what I wrote, just as Duesberg misrepresents the literature on AZT. I understand that what you’re going through must be very painful and stressful, so I don’t hold it against you. I would certainly rather see you vent your frustration on a weblog than act out the violence you’ve fantasized about in the past.

    Please understand, though, that I won’t argue with an irrational person. I’m sorry.

    Take care of yourself, Michael, and good luck to you.

  127. #127 Ben Gorman
    September 21, 2007

    Elkmountainman,

    You write:

    Let’s start with what we know about Bergalis. We know that Kimberly Bergalis was infected with HIV and died of AIDS.

    You are so fucking stupid it boggles the mind! Do you understand what the word “know” means? You don’t “know” either of those 2 things, for chrissake!

    Here’s what “we” (I hate to lump myself in with you) know:

    1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

    2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV

    3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

    4. Kimberly Bergalis died.

    That’s what we know, Einstein. Now, you can begin your analysis.

    I swear, Elkmountainman and Franklin have to be 2 of the dumbest bastards on planet earth.

  128. #128 noreen
    September 21, 2007

    Some of you don’t have a concept to what it is to be HIV+ or have full-blown AIDS. And adding gay onto the matter can only complicate the issue. I believe that Michael is on the right track about how the mind can affect one’s health. Being told that one is HIV+ or that one has AIDS is certainly devasting to most. Add the fact that one is labeled with a sexually-transmitted disease, an incurable illness and the worse part is that the doctor drills into one that if one misses one dose of medicine, one will die. One must be really strong to cope with all of these issues. Most aren’t and take the meds out of fear.

    Even researching the matter, it took me awhile to be strong enough to stop them. It is not a decision that is taken lightly. I had to go with my inner feelings to who I believed was more right in the matter. One’s frame of mind is key to survival, whether one takes the meds or not. If one accepts AIDS as a death sentence, one’s chances of survival are not so good. I have done well because I do not believe that most diseases are incurable. I would have tackled cancer the same way, positive attitude, supplements, and good clean living.

  129. #129 Kausik Datta
    September 21, 2007

    jspreen:

    The guy just realized that a person like Noreen is one of the pillars of the Aids rethinkers movement so now he smears honey all around to attract her over into his camp.

    “This guy” is willing to give Noreen the benefit of doubt. She has been HIV+, is a long-term survivor not on retrovirals (as she has indicated), and “this guy” would like to hope that she understands the rarity of her situation and studies in greater detail about the possible mechanisms that lead to her good fortune (which is why “this guy” offered the link to the review article). In trying to be a “pillar” of the denialist crowd, she is eschewing that opportunity, which is a pity.

    Most other denialists here are hopeless. Elkmountainman, you are wasting your breath. None of them understand the concept of AIDS defining illnesses; an example is Ben Gorman’s illogical post. All he had to do is put his (2) before (1), which would have represented the actual course of events. But no, that would upset his apple-cart, wouldn’t it?

    I have worked with scores of patients of PCP, cryptococcosis, cryptosporidial diarrhoea, MA complex, recurrent salmonella septicemia, among others (all of which have come under WHO’s AIDS defining illnesses), and as a matter of routine, testing for HIV was recommended. Almost all of them turned out to be HIV+. Initiation of anti-retroviral therapy, along with supplemental anti-microbial therapy as necessary, saved the lives of many, many of these patients. HAART has changed the spectrum of our fight against AIDS across developed and developing nations, helping millions of people to live their lives despite HIV infection.

    And I am expected to believe the ill-informed, misguided (often fraught with outright lies) denialist bullsh*t from a few crazy crackpots? They can live in their corner and wallow in their conspiracy theories for all I care. But that does not change the reality, the benefits of proper anti-retroviral therapy that can truly make a difference in people’s lives.

  130. #130 Michael
    September 21, 2007

    “Please understand, though, that I won’t argue with an irrational person. I’m sorry.”

    Elk, dear boy, your ego is simply projecting again.

    Are you really so sure that I am the one who is irrational here. Naturally, your ego would not allow you to consider for even a moment that you might be the irrational one. I do understand.

    However, I am not the one who believes that the dentist mysteriously somehow either gassed his patients and had anal sex with them while cleaning their teeth, or that he had somehow intentionally murdered them. You are.

    I am not the one who believes in a mysterious retrovirus as somehow causing 30 diseases while being found in one of 10,000 t cells and in only a few of the most severe of AIDS patients. You are.

    I am not the one who believes that those who disagree with me and my beliefs should have constitutional amendments enacted to shut them up. You are.

    Are you really so sure that I am the irrational one here?

    Okay, whatever you say, cause if Elk says it, it must be true.

    However, the case could very well be that You are the one who completely and unquestioningly believes in an irrational fantasy. Not I sir.

    And now you are irrationally dreaming that I am in some way violent?

    Well perhaps someday I will upturn the tables of the changemakers at the NIH’s temple of HIV/AIDS beliefs, but not yet at least. I usually wait until passover to do such things.

    With Love and kisses, and good dreams to you and your ego,

    Michael

  131. #131 Kausik Datta
    September 21, 2007

    Noreen, no one (particularly the much-maligned HIV researchers) has denied the effect of psychological status on health. The paper that Michael Geiger cited with great flourish simply says that certain psychological conditions, including depression, can suppress the overall immunity of the body. Studies like these have been around for quite some time, ever since the interface between psychology and sociology began to be explored better. Positive attitude and good, clean living (though I am not sure exactly what you mean by ‘good, clean’ living) are attributes which predispose one towards good health. But if you have an infection, just like any other infection, it needs to be treated – particularly an infection like HIV, which shanghaies body’s own defence mechanism.

    By your own admission, you are a long-term survivor not on meds. Rather than using crackpot ideas to bolster an illogical hypothesis built on foundations of lies, wouldn’t you rather try to find out more about how exactly your body managed to ward off the virus? Doesn’t that prospect excite you at all?

  132. #132 Kausik Datta
    September 21, 2007

    Damn! Not psychology and sociology, I meant, psychology and physiology…
    Must remember, preview is my friend…

  133. #133 noreen
    September 21, 2007

    Antiretrovirals can help when one is being attacked by many diseases as I had many of the AIDS defining diseases. I have been on both sides of the fence. The problem that I have with them is the long-term use or for the rest of one’s life use of them. Ideally, they would be used when the patient has symptoms, which may not respond to traditional treatments, then stopped when the patient has managed to restore health thus eliminating all the nasty side effects of these drugs.

  134. #134 Lee
    September 21, 2007

    God, this stuff is sickening, and the level of self-deception is amazing to me.

    We had a family friend, a nurse, who was one of the first needle-stick AIDS victims in the country. She died with PCP, KS, and AIDS-related dementia. She was infected while nursing dying GRID and then AIDS patients in the days before AZT arrived. AZT was not killing those early patients she was treating – it was not yet being used.

    I have an acquaintance who was at ground zero in SF in the early days of the plague years. He buried all his friends. All of them. Every one. More than 50. At least half of them died of GRID /AIDS before HIV was even identified, much less AZT was available. He himself nearly died before AZT arrived – AZT saved his life, then started failing, and he nearly died a second time before next-generation therapies arrived and saved his life a second time. AZT did not kill these people. For many of them, it hauled them back from the edge of death and gave them beck several years of life. For my friend, it is the first of several reasons he is still alive today – he was within a week or two of death before AZT pulled him back.

    The ignorance of history is astounding. People were dying terrible deaths, with no known cause or treatment. Labs went looking for an infectious agent, which turned out to be HIV, because people were dying terrible deaths. When early AZT trials were successful, people were clamoring for the drug, and dying while waiting for it.

    AZT monotherapy is a hard road. It is not a good drug to take. People who took it often found they could not tolerate it, or they recoiled from the side effects and bought into the woo and relied on crystals and cleansing diets and such – and when they discontinued AZT, they mostly then died of AIDS. HIV evolved resistance, and patients then died despite AZT. But the drug added years of life for a lot of people, and it kept some few of them alive long enough for the next generation drugs to extend their lives yet further.

    To see the denialism, the self-delusion, the willful ignorance of history here, all of which denies the stark truth of these people’s stories… well, as I said, it sickens me. It is the reason I do not often comment on these denial threads. But this – for this I could not remain silent.

  135. #135 ElkMountainMan
    September 21, 2007

    Ben,

    Are you a solipsist? That would explain how we don’t really “know” anything. Truthfully, I never met Kimberly Bergalis, so I don’t really “know” she existed. I never met David Acer, so I don’t “know” that he existed. I have never observed the solar system from somewhere in the Kuiper Belt, so I don’t really “know” that the earth goes around the sun. I have never been to Alaska, so I don’t “know” that Alaska is real.

    But back to reality…you claim that,

    1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

    Actually, Kimberly Bergalis tested positive for both nucleic acid sequences that are unique to HIV AND for antibodies to HIV-specific proteins. As you may or may not know, HIV proteins are encoded by those HIV-specific sequences, which are found only in HIV-infected people.

    2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV

    Actually, Kimberly Bergalis developed several conditions that, taken together, are only found in severely immunocompromised individuals. Before being diagnosed with HIV, she almost died of PCP, a condition that was almost unheard-of outside of chemically immunosuppressed patients before the AIDS era. The challenge to you, Mr. Gorman, is to find a single person who is not a drug addict, a cancer patient, or a transplant recipient, but who displays all of Bergalis’ symptoms in the absence of HIV. Perhaps someone could even put up a $50,000 prize as an incentive for you!

    3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

    Your wording is vague, so I’m not sure what you’re getting at. AZT can cause anemia, depletion of neutrophils, and myopathy. These are not, by themselves, AIDS-defining conditions.

    4. Kimberly Bergalis died.

    Right. More specifically, she died of AIDS. Or are you perhaps a qualified pathologist who has reviewed her autopsy report and wishes to issue a “differential diagnosis?”

  136. #136 noreen
    September 21, 2007

    I am not a non-progressor as I had full-blown AIDS. I don’t think that there is a label for persons such as myself who had full-blown AIDS, took the meds, came off of the meds and now I am healthy as ever. Doesn’t this strike you odd that someone who has a high viral load, CD4′s of 83 and is extremely healthy? How do you reconcile this according to the mainstream’s theories. This in itself goes a long way to prvoe that something is drastically wrong with this equation. Many are in the same boat as me and have stopped the meds and are fine.

  137. #137 Kausik Datta
    September 21, 2007

    No Noreen, you are slightly mistaken here. The symptoms that you mention (for example, the ones you had) are often related largely to the underlying super-infection. People have mentioned PCP and candidosis here. But there are many others. When HIV infection undermines the body’s immunity, it basically becomes a petriplate for diverse organisms (some which are normally avirulent) to grow and cause disease. Which is why it is also important to treat HIV infection at source, and currently anti-retrovirals (ART) are the best options we have for that purpose.

    But I also agree with you that many individuals react adversely to ART, if not immediately, over a period of time. Not only ART, all pharmacological substances that one takes are processed by the liver, and pass through kidney. Therefore, these are the major organs that are always involved in drug metabolism. So, patients on ART need to be monitored from time to time for dysfunctions occurring in any of the major organs. Think about what happens in chemotherapy or radiotherapy; it also has certain side-effects, but they are mostly reversible.

    However, the risk-benefit ratio analysis shows that since secondary symptoms of physical discomfort can be treated separately, it is much better to start an HIV+ person on ART than not. The point that you raise is a valid one, that researchers need to find out about further modifications (newer generations) of ARTs that may be more targeted, or interact less non-specifically, thereby causing less side-effects. But till scientific research (yes, the same research that is the bane of denialists’ existence) finds out a better alternative, the current therapies are our best available option.

    The tapering off of dosages etc, that you mention are routinely done for many medications, including ARTs.

  138. #138 Kausik Datta
    September 21, 2007

    Noreen, if you can, please read the article whose link I provided in the beginning. Your idea of ‘mainstream theories’ may be a bit on the shallow side. Your condition, while rare, is not unknown. You did take the medications to begin with, right? So even if you are off them now, it may have had an initial effect. In vivo viral attenuation is known to happen in HIV, particularly in certain subgroups or clades of the virus. Don’t think that CD4+ T-cells are the only components of immune system that are affected by HIV or are involved in anti-retroviral defence. However, if you have persistently low CD4 (as you say), you do run the risk of getting secondary (and potentially fatal) infections. If by making certain lifestyle choices you can ward those off, well and good, and good-luck to you.

    But that does not discount the utility of anti-retroviral therapy to millions of HIV+ individuals across the world.

  139. #139 noreen
    September 21, 2007

    My own doctors do not “taper” off of medicines as you put it but it would seem to make more sense. I would disagree that radiation side effects are reversible as I have had that too. Think about this, we would never give radiation
    and chemotherapy long term, yet we give chemotherapy to HIV persons this long term. This is what I have heartburn with, especially since there are better options out there such as, Low dose naltrexone. Don’t hold your breath on the drug companies pushing this harmless and effective drug though because the patent has long expired and much more money is made selling antiretroviral medication.

    Lastly, I don’t believe that HIV is capable of all that it is given credit for especially since too few can be found in the patient in the first place.

  140. #140 Michael
    September 21, 2007

    Kausik Datta, I for one, am well aware of your work in India. What you fail to look at Kausik, is the co-factors of poor nutrition, poverty, hygiene, and emotions of helplessness, hopelessness, fear, guilt, shame, and other intense stress filled lives of those who you have treated or whose sera you have observed. You simply blame all of the problems on HIV, which if anything, is simply a co-factor, not a cause, in all of this.

    Your eye is glued so intently to your microscope, even though it has never seen HIV, that you fail to see the greater picture of hopelessness, malnutrition, beliefs, and all else that first and foremost lies behind the susceptibility to PCP, cryptococcosis, cryptosporidial diarrhoea, MA complex, recurrent salmonella septicemia, among others.

    Certainly it is wonderful that you have assisted in reaching out and treating these people. Certainly it is wonderful that you have successfully treated some of their infections with antibiotics, antifungals, etc.

    It is unfortunate that they must come to you half dead, before you and they will see that serious changes are necessary in their lives and thinking to maintain life and health. Usually coming for treatment also means for most that they will be attended to with a better diet and better self care.

    Certainly it is wonderful that for many people their belief in a magic haart pills to be taken forever to ward off death by HIV/AIDS assists them in being lifted out of their immune system destroying states of panic and fear and belief in imminent death.

    However, this does not mean the HAART drugs are of any real or proven benefit.

    Haart quite often works placebo-like, simply by removing their fear and by giving them hope…. At least until the toxicities of the haart drugs overwhelm them or destroy their livers or kidneys or hearts, or cause lipodystrophy or neuropathy or a multitude of other effects.

    You fail to see that only by solving the greater issues of patients being scared to death, or by solving the effects of the list that I partially stated above of extreme emotional pain and poverty, will the origination of the entire problem be solved.

  141. #141 noreen
    September 21, 2007

    The reason that I am extremely healthy is that I eat right, exercise, normal weight, positive attitude, take supplements and LDN, which is the secret to warding off the horrible opportunistic diseases, which causes harm to AIDS persons. Stopping or curing AIDS is no great secret. Anyone can do it with a little work on their part.

  142. #142 Kausik Datta
    September 21, 2007

    Noreen, it is human nature that oftentimes, when situations tend to get the better of us, and there is no way to channel that frustration, we tend to let off steam by blaming something or the other. Very natural. Drug companies are often the targets of the ires of patients frustrated with an inefficient, careless, medical care system. I state clearly that I do not support the underhanded, sales-oriented, unethical practices engaged in by some pharmaceutical companies in the US (as have come to light in recent years); but it is also not all dark and evil skulduggery on that side. Pharmaceutical research is a very time-consuming tenuous task; each drug that you see on the market usually takes 12-15 years from bench to drugstore. These pharmaceutical companies have also given us some wonderful life-saving medicines – I hope you don’t forget that or discount that off-hand.

    I don’t know of course why your doctor did not choose to keep you in the loop as far as the prescriptions are concerned. I can say, my own doctor always discusses my medications with me, talking about possible side-effects etc and how to deal with them. If there is some inadvertent side-effects, he is not averse to changing my medications accordingly. For any medication, there is always a possibility that it will act for you differently than it will for the next person, because human beings are similar, not identical – as you can understand. Usually, good physicians will interact with patients for all around therapeutic benefit.

    But if you talk about beliefs – like not believing “hat HIV is capable of all that it is given credit for especially since too few can be found in the patient” – that is your prerogative, of course. However, is that your informed opinion? Are you aware that HIV has been isolated from almost all tissue types present in the body? Are you willing to discount the AIDS ravaged nations of sub-Saharan Africa and Southeast Asia, where millions of people died of AIDS and AIDS-associated infections before ART in any form reached them? And that use of ART has drastically reduced the incidence of AIDS-associated infections?

    Belief is well and good, Noreen. But do open your eyes and look around the world. If you need a belief system, let it be based on sound logic and rationality.

  143. #143 noreen
    September 21, 2007

    I have yet to have HIV isolated from my body. Having antibodies is not the same as having an active virus. Those of you who believe in HIV, surely you should look into low dose naltrexone, which has been successfully used to treat AIDS persons. Even if it has been isolated from the body that in itself does not prove that it causes AIDS.

  144. #144 Kausik Datta
    September 21, 2007

    Noreen, it saddens me to find you would rather stick to your irrational belief system than listen to reason. Ask Michael; if he has indeed gone through my work (as he says), he will be able to back me up on this one, at least. OPPORTUNISTIC INFECTIONS, once present, will not go away simply by positive attitude, supplements, and low dose Naltrexone. You would need to treat the infections with anti-microbials. A case in point: Vitamin C (espoused by the great Linus Pauling) is known to boost body’s immunity and is considered to possess antiviral properties. But if you are infected with a particularly virulent strain of the influenza virus (say, of the type that severely affects elderly people, or people with chronic diseases), you’d need to treat it to prevent lasting damage; just chugging vitamin C supplements will not help you. An infection, any infection, particularly in the setting of diminished immunity, needs to be treated. What is so difficult in understanding that?

    And Michael… I am curious… How exactly do you know about my work? Are you relying on a simple PubMed search? Let me answer your points in the next post.

  145. #145 noreen
    September 21, 2007

    So I am irrational because of my beliefs and because I am healthy. You folks are irrational and cannot get beyond HIV and antiretrovirals. Duhh, LDN works to PREVENT the infections, of course if one has them then they would need to be addressed. There again, practice what you preach and do some reading about LDN before you condemn it.

  146. #146 Kausik Datta
    September 21, 2007

    Noreen, AIDS is a syndrome, a culmination of many detrimental situations that occur in the body as a result of a severely diminished immune system, and HIV is certainly a virus that attacks and affects the immune system in this way. That is why it is called ‘Acquired Immunodeficiency’. There are some genetic defects that can cause similarly severe immunodeficiency in individuals, but those are not considered AIDS because they are not ‘accquired’ in the same way.

  147. #147 noreen
    September 21, 2007

    So, it the same old argument, HIV causes AIDS, HIV cause AIDS, HIV causes AIDS. What if it doesn’t then what are you folks going to say? Did you know that Merck dropped its vaccination program for AIDS. Why hasn’t one been effective? Could it be that AIDS is basically a life-style, cumulative medical issues, environmental issues, etc.? It’s very possible and probable. That’s why more and more are dropping the meds and are living normal lives. If HIV was so deadly, then we could not do this.

  148. #148 Kausik Datta
    September 21, 2007

    Michael:

    However, this does not mean the HAART drugs are of any real or proven benefit.

    No, Michael, that statement is simply untrue. Work amongst AIDS patients in sub-Saharan Africa and Southeast Asia (in both pre- and post-HAART era) has provided ample evidence for that. Please go through the relevant literature and look at the evidence yourself (not through hearsay, no matter who is telling you what) before you make these wild assertions.

    Once again, Michael, none of the HIV researchers here have argued against psychological conditions that you mentioned having a profound effect on a patient’s physiology. But we are dealing with an infection (or multitude of infections) here, Michael. Wishing it all on psychological conditions is terribly naïve, as is thinking that the so-called booster of immunity, low-dose Naltrexone, will be an effective barrier against opportunistic infection in the setting of severe immunosuppression caused by HIV.

    You seem to be intelligent, Michael (I am not condescending, just that I don’t know you beyond your blog handle), at least more cogent that most of the raving denialists here. Give a bit of thought to what I said about the infection scenario.

    I cannot post any more tonight, since I have a prior engagement, but I shall check back this thread later.

  149. #149 Kausik Datta
    September 21, 2007

    No, Noreen, one major problem in failure of vaccination programs is HIV’s ability to mutate rapidly, and thereby change the target against which vaccination is going to work. If it had been a larger organism, say a fungus, bacteria or parasite, it would have been easier since there would be a number of targets to look for; if one did not work, possibly another would. But that is not the same with a relatively structurally simple (yet profoundly functionally complex) organism such as HIV.

    What of Merck… Did you know that vaccines effective against HIV strains prevalent in the United States did not work as effectively against HIV strains prevalent in some parts of Southeast Asia? The virus’s functional complexity is amazing, and therefore, vaccination efforts are not going to be so easy to direct against HIV.

    But wait, aren’t there people of your ilk who say vaccination of any sort is injurious to health?

  150. #150 noreen
    September 21, 2007

    If one checks out lowdosnaltrexone.org, there is information about the use of ldn to treat AIDS patients with it only and with a combination of drugs. This is not naive and it works. Many of us are using it without incident, contrary to what Kausik Datta believes. Also, a study is currently being conducted in Africa using only LDN to treat AIDS patients.

    This wonder drug is being used to treat many diseases, which effect the immune system such as, cancer, chron’s disease, alzheimer’s disease, MS, autism, and so many more. It has been around for 25 years and is the best kept secret. However, more and more patients and doctors are learning about this drug and the great hope that it offers patients, especially those with incurable and chronic diseases.

  151. #151 Ben Gorman
    September 21, 2007

    Are you a solipsist? That would explain how we don’t really “know” anything.

    No. I didn’t claim “we don’t really ‘know’ anything.” I claimed that YOU didn’t know the 2 things you asserted.

    1. Kimberly Bergalis tested postive for antibodies, which are claimed to be uniquely associated with HIV;

    Actually, Kimberly Bergalis tested positive for both nucleic acid sequences that are unique to HIV AND for antibodies to HIV-specific proteins.

    She died in 1991. PCR was not widely used until Ho’s paper in 1993. So, I doubt they did PCR analysis before she died. HIV has only 9,000 base pairs. The human cell as 3 billion base pairs, about 8% of which is retroviral genes, long dormant.

    You’re guessing here. My statement is correct.

    2. Kimberly Bergalis developed some clinical symptons that are not unique to HIV

    Actually, Kimberly Bergalis developed several conditions that, taken together, are only found in severely immunocompromised individuals.

    Do you read English? She had clinical symptoms that are not unique to HIV. That is a fact. I didn’t mention immunocompromised individuals. She may have been immunocompromised. I don’t dispute that. Do you not understand the difference between “effect” and “cause”?

    Before being diagnosed with HIV,

    Do you not understand the distinction between virus and anti-bodies? Being diagnosed with anti-bodies, doesn’t equate with HIV infection. There’s no evidence they cultured the virus from her. So, you, again, are sloppy and inaccurate.

    The challenge to you, Mr. Gorman, is to find a single person who is not a drug addict, a cancer patient, or a transplant recipient, but who displays all of Bergalis’ symptoms in the absence of HIV. Perhaps someone could even put up a $50,000 prize as an incentive for you!

    Easy. (NEJM, 1993) Please send the 50K to your Momma.

    3. Kimberly Bergalis took toxic AZT, which required blood tranfusions.

    Your wording is vague, so I’m not sure what you’re getting at. AZT can cause anemia, depletion of neutrophils, and myopathy. These are not, by themselves, AIDS-defining conditions.

    The second clause may be a bit vague, so I’ll just repeat what Kimberly said about AZT.

    “I have lived through the torturous acne that infested my face and neck, brought on by AZT. I have endured trips twice a week to Miami for three months only to receive painful IV injections. I’ve had blood transfusions. I’ve had a bone marrow biopsy. I cried my heart out from the pain.” (Lauritsen, AIDS War, Page 324.)

    Also, your list of AZT side effects is deliberately under-inclusive, which makes you dishonest. Here’s the current package BLACK BOX WARNING from AZT.

    “WARNING: Retrovir (Zidovudine) has been associated with hematologic toxicity including neutropenia and severe anemia particularly in patients with HIV disease. Prolonged use of Retrovir has been associated with symptomatic myopathy. Lactic acidosis and severe Hepatomegaly with steatosis, including fatal cases have been reported with the use of nucleoside analogues, alone or in combination.”

    4. Kimberly Bergalis died.
    Right. More specifically, she died of AIDS.

    Have you heard of “affirming the consequent.” She died. We agree. Idiotic scientists and politicians, however, ignored the terrible, fatal effects of AZT that killed her, and instead blamed her death on AIDS.

  152. #152 Carter
    September 21, 2007

    Oh Jesus Jiminy Christmas! – Here we go round the mulberry bush. I SEEN it a coming!

    “RARE”

    “like to hope that she understands the rarity of her situation”

    “Noreen may understand better that they happen to belong to a small,….” “Your condition, while rare, is not unknown..”

    BULL SHIT!

    How the hell do they know? Truth is they don’t! Can anyone remind these morons of the huge disparity in numbers of whats reported as to how many are supposedly carrying the dreaded almighty virus VS the numbers under anti-HIV treaments?

  153. #153 apy
    September 21, 2007

    Antiretrovirals can help when one is being attacked by many diseases as I had many of the AIDS defining diseases.

    noreen, could you please explain to us your specific belief system here? Does HIV exist? Does it cause AIDS? Are ARV’s a good treatment?

    Also, are you aware of how ARV’s work? You realize that the ARV’s are not attacking the PCP or the Karposi Sarcoma right? They are meant to attack the HIV, which makes your statement somewhat confusing.

  154. #154 ElkMountainMan
    September 21, 2007

    Right, Ben, HIV is just part of the human genome and nobody did PCR for HIV before 1993. How, then, did the CDC compare sequences from Acer, Bergalis, other patients of Acer, and individuals from the surrounding community who were HIV positive? Silly question, though; I’m sure you have an answer to paste from virusmyth.

    Yes, and antibodies have nothing to do with HIV. Antibodies are just non-specific proteins floating around in everyone’s bloodstream.

    I’m still waiting for your proof that AZT killed Bergalis…or anyone else, for that matter. Where are the cases of HIV negative AZT deaths?

  155. #155 Franklin
    September 21, 2007

    Ben,

    Your utter disregard for the truth and for any standards of scholarship lead to the many fallacies sprinkled through your comments.

    With respect to Kimberly Bergalis you state:

    She died in 1991. PCR was not widely used until Ho’s paper in 1993. So, I doubt they did PCR analysis before she died.

    You doubt? You doubt therfore you draw a conclusion?

    What is the name for this logical fallacy? Is this the “ostrich fallacy” where the speaker makes up his mind and buries his head in the sand lest he uncover evidence that conflicts with his “doubts”.

    Did you ever consider reading the actual papers that describe the evidence?

    Ou CY, et al. (1992). Molecular epidemiology of HIV transmission in a dental practice. Science 256:1165-71.

    Abstract: Human immunodeficiency virus type 1 (HIV-1) transmission from infected patients to health-care workers has been well documented, but transmission from an infected health-care worker to a patient has not been reported. After identification of an acquired immunodeficiency syndrome (AIDS) patient who had no known risk factors for HIV infection but who had undergone an invasive procedure performed by a dentist with AIDS, six other patients of this dentist were found to be HIV-infected. Molecular biologic studies were conducted to complement the epidemiologic investigation. Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and sequenced. Three separate comparative genetic analyses–genetic distance measurements, phylogenetic tree analysis, and amino acid signature pattern analysis–showed that the viruses from the dentist and five dental patients were closely related. These data, together with the epidemiologic investigation, indicated that these patients became infected with HIV while receiving care from a dentist with AIDS.

    Doubting is not enough. Criticial thinking requires that one also has to examine the evidence. In the future, please provide the evidence for your claims.

  156. #156 cooler
    September 22, 2007

    for the newbies not informed of the dissidents views, here is a primer

    This is a straw man argument Dr. Smith. I think what micheal was referring to is catastrosphic long term stress that accompanies an hiv positive test, nevertheless this “lonliness” argument does not represent the rethinker movement.

    The main reason many credible scientists doubt hiv is
    1) the lack of a relaible animal model, tons of chimps/mice were injected and they dont die of aids even after 20 years.
    2) The lack of a carefully controlled study that would be designed to see if if hiv positive people with no other possible risk factors get AIDS, risk factors that include the cell killing chemotherapy drug AZT, coinfections w/ mycoplasma incognitus, catastrophic stress, intense drug abuse etc.

    all the studies so far assume hiv is the cause of Aids, so they didnt do much to test gallo’s claim, if you want to prove me wrong please provide me with a study done by honest scientists that dont view dissidents as nazis that clearly states in the study aims ” a study to follow hiv positive people with no other risk factors to see if Gallo’s hypothesis is correct.”

    3) the low amount of blood tcell infection, which is around 1/1000 t cells

    4) The very low rates of transmission, the Padian study followed serodiscordant couples for years and who had all kinds of unprotected sex and there were 0 seroconversions!

    5) most viruses cause the most havok before antibodies not ten years later, thats why we get vaccines………..the are some marginal exceptions, but exceptions are not the rules

    Many more reasons. Lurkers should do a google search and see a film called hiv fact or fraud that explains the positions well, its free.

    scientists that have doubted the hiv hypothesis at one time or another

    Peter duesberg phd retroviral expert, California scientist of the year.

    kary mullis phd Nobel prize winner, inventor of the PCR

    Shyh ching lo md phd cheif of the infectious unit of the armed forces of pathology

    Richard Strohman ucb mcb professor

    Harry rubin ucb mcb professor

    Walter gilbert nobel prize winner Harvard mcb professor

    Lynn Margulis phd national academy of sciences member

    many more………..

    I would suggest people read a book called Project Day Lily, this microbe called mycoplasma incognitus killed every animal injected (Dr. Lo injected mice primates and they all died) a riveting book by garth and nancy nicolson phds found out how it was part of the biowarfare program, found in some AIDs cases and in CFS etc, google it and read a chapter for free.

  157. #157 Kausik Datta
    September 22, 2007

    Carter sayeth:

    How the hell do they know? Truth is they don’t! Can anyone remind these morons of the huge disparity in numbers of whats reported as to how many are supposedly carrying the dreaded almighty virus VS the numbers under anti-HIV treaments?

    Carter, you are amazing. Every time you open your mouth, is it with the express purpose of putting your foot in it? Truly, no one other than you and your ilk knows anything, is that it? Try a simple test – type in HIV Controller in PubMed and do a search. Can you do that? If you can, do take a moment to check out the articles; your doubts shall be cleared…

    Oh, wait! It is all a grand conspiracy, right? Ah, well…

  158. #158 carter
    September 22, 2007

    “Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and sequenced.”

    Criticial thinking? The above is science gone wild to the side of science fiction.
    _______________________

    ELITE Controller, HIV Controller? WTF is that? That’s just another “AIDS” boondoggle. A way to get rid of the LTNP problem, change the language and get support (money) into another dead-end of “AIDS” research.

    All these crazy f–ked up contoller studies willfully are not and will not investigate the most obvious factor that separates “controllers” from the rest – they don’t take “AIDS drugs” – science gone wild yet again. Virus hunters all at it again desperately trying to find the gene responcible, which merely amounts to more lunacy.

    I tend to think term Elite Controllers, or rather Elitist Conrollers define Tara et all.

  159. #159 carter
    September 22, 2007

    RARE? So you nit wits think LTNP, controllers, whatever are rare? like I said before thats bull shit!

    The CDC estimates that 1.1 million Americans are HIV+, with 40,000 new cases and a little less than 20,000 deaths each year. This accounts for a quite stable figure, and in spite of varying definitions, there have been about 1 million HIV+ Americans for well over ten years now. Yet, only 250,000 take meds and of these it is said that it’s hard to keep them taking the meds. This leaves 750,000 HIV+ Americans who haven’t been taking meds in any given year, yet there is no upsurge in the number of ‘AIDS’ cases, which remains pretty steady at 250,000, and there have been fewer than 200,000 deaths in the past ten years. So we can pretty well accept that the figure is around 75% – yes, 75% – and the other 25% are indeterminate, because they’re on the meds.

  160. #160 noreen
    September 22, 2007

    Apy, once again, I will state my position about AIDS. I do not believe that HIV is the cause of AIDS due to many reasons that the rethinkers believe and due to the fact that I have managed to survive nicely for almost two years with a high viral load, low CD4′s and no sicknesses.

    My feelings on the antiretrovirals is that they should only be used when the patient has symptoms that are not alleviated by normal treatment options and as a last ditch option. Then, used temporary until the patient has restored one’s health.

    I am not the exception to the rule as many HIV+s are waking up to the inconsistencies about HIV and are doing the same thing. Most are only less vocal about it. We realize that it is not necessary to poison our bodies and that AIDS is not a death sentence.

  161. #161 franklin
    September 22, 2007

    Carter Says:

    “Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and sequenced.”
    Criticial thinking? The above is science gone wild to the side of science fiction.

    No actual criticism of the methodology, results, or interpretation. No discussion of the actual evidence. Just a blanket statement that this is “science fiction”.

    The ostrich buries her head in the sand.

    On the other hand, for the umptheenth time Cooler direct us to “Project Day Lily”:

    I would suggest people read a book called Project Day Lily, this microbe called mycoplasma incognitus killed every animal injected (Dr. Lo injected mice primates and they all died) a riveting book by garth and nancy nicolson phds found out how it was part of the biowarfare program, found in some AIDs cases and in CFS etc, google it and read a chapter for free.

    Now, “Project Day Lily,” that is science fiction.

    What does it say that the denialists prefer to base their arguments on science fiction over actual scientific papers? What do you think, Noreen? Would you like your health care providers to base your treatment plan on a science fiction book?

    Perhaps this preference for fictionalization explains why Professor Maniotis’s fictitious “quotes” that he attributes to scientific papers have appeared on Denialist web sites for years–and continue to appear–without any of the regular users complaining about his fraud.

  162. #162 franklin
    September 22, 2007

    Noreen,

    If you don’t believe that HIV causes AIDS, why do you advocate treatment with antiretrovirals “when the patient has symptoms that are not alleviated by normal treatment options and as a last ditch option.”

    Do you only advocate antiretroviral as a “last ditch option” for AIDS patients–even though you don’t beleive HIV causes AIDS?

    Or do you advocate antiretrovirals for all conditions that have not responded to “normal treatment”–say a myocardial infarction or pulmonary embolus?

    Do you advocate antiretrovirals “as a last ditch effort” for someone paralyzed from an automobile accident who has not recovered the abilty to walk “despite normal treatment”.

    If you don’t advocate antiretrovirals “as a last ditch effort” for these other conditions, what is it about AIDS that makes you think antiretrovirals might be appropriate for this disorder but not other illnesses that fail to respond to treatment.

  163. #163 noreen
    September 22, 2007

    When one’s immune system is basically non-existant and one is being attached by numerous viruses, such as hepatitis, Epstein Barr, etc. then to me it does make good sense to use these to try and save the patient’s life. We can go on the “first do no harm” premise but if we did then many more would die. Sometimes drastic situations call for drastic measures.

  164. #164 apy
    September 22, 2007

    noreen:

    I do not believe that HIV is the cause of AIDS

    Antiretrovirals can help when one is being attacked by many diseases as I had many of the AIDS defining diseases.

    You’ll have to explain this one to me noreen. If you don’t believe HIV causes AIDS then why do you think ARV’s would be useful in any way?

    I had AIDS so therefore I do have some experience in the matter. You believe studies yet some of you will not listen to those of us who have the disease

    So far you’ve taken your singular experience with AIDS and applied them to the entire population. Do I believe studies with a lot of people vs one single persons experiences? Yes I do. Especially when that person can’t even keep straight if they have been to Alive & Well website or not and don’t seem to be capable of researching a single concept on their own (really, Gallo pardoned by Bill Clinton? How trivial is that to verify and you couldn’t). You’ve shown yourself to be a completely untrustworthy source of information so I take anything you say with a grain of salt.

  165. #165 noreen
    September 22, 2007

    Apy, all you know is what you read. You did not answer my question if you are HIV+ or have AIDS so why should anyone listen to your two cents? Antriretroviral drugs are not just specific to HIV and have other uses. In fact, I recently read where they may have some benefit for treating cancer. Whether I believe HIV causes AIDS or not is not the point in whether there is any benefit of these drugs. Where you don’t get it is when I state that they, along with other chemotherapy drugs, should not be a long-term fix.

  166. #166 franklin
    September 22, 2007

    Noreen,

    So you think that antiretrovirals make sense

    when one’s immune system is basically non-existant and one is being attached by numerous viruses, such as hepatitis, Epstein Barr, etc.

    Do you advocate antiretrovirals for heart transplant patients who get sypmtomatic EBV infections while taking the immunosuppressive drugs needed to prevent rejection of the donor’s heart?

    Do you advocate antiretrovirals for leukemia patients who get opportunistic infections because their bone marrow is unable to produce immune cells due to the leukemia or effects of chemotherapy?

    Do you advocate antiretrovirals for viral infections in patients with DiGeorge Syndrome who are born without a thymus and therefore do not produce T-cells?

    Do you think antiretroviral therapies would make any sense in these clinical scenarios, given that the patients are not infected by HIV and don’t have AIDS?

    They have a “practically nonexistent immune system” and suffer from multiple viral infections–just not from HIV infection.

    Do you advocate antiretroviral therapies for these immune deficient patients, or just for AIDS patients?

  167. #167 noreen
    September 22, 2007

    Some of the examples that you describe, such as heart tranplants patients who need immune-supressive medicines would not be a good canidate. I think that the antiretrovirls should be used to help full-blown AIDS persons, who usually have more than one AIDS-defining diseases, that is why their immune system is so weak to start with. Obviously, for instance, those with thrush would need fungal medications.

  168. #168 franklin
    September 22, 2007

    Noreen,

    It sounds like you only advocate antiretrovirals for viral infections in patients with immune deficiency due to AIDS, not for viral infections in patients with other conditions that lead to immune defiiciency–such as DiGeorge Syndrome, leukemia, cancer chemotherapy, etc.

    Why do you think antiretrovirals are appropriate for AIDS patients but not for patients with other immunosuppressive disorders?

  169. #169 noreen
    September 22, 2007

    Mainly because I do not know if they would work for these particular diseases or not. Probably, most would be reluctant to prescribe the meds off-label without good cause.

  170. #170 carter
    September 22, 2007

    “No actual criticism of the methodology, results, or interpretation. No discussion of the actual evidence. Just a blanket statement that this is “science fiction”.

    I’m sure you dont want me to cut and past the multitude of agruments against each and every single point. Why don’t you read Henry Bauer’s book, “The Origin, Persistence and Failings of HIV/AIDS Theory” McFarland & Company; 1st edition, June 30, 2007 ?

  171. #171 franklin
    September 22, 2007

    Noreen,

    Given that you “do not believe that HIV is the cause of AIDS,” what makes you think that there is good cause to prescribe antiretrovirals as a “last ditch” effort for AIDS but not for other conditions that cause severe immune suppression?

  172. #172 Roy Hinkley
    September 22, 2007

    Carter,

    Instead of just cutting and pasting why don’t you use your vast knowledge of the subject matter to give us a synopsis of the arguemnts against using DNA sequence comparisons to show that one sample of HIV is genetically similar to another. Then provide a link to your sources.

  173. #173 ElkMountainMan
    September 22, 2007

    Noreen writes about anti-cancer properties of ARV and also states,

    Where you don’t get it is when I state that they, along with other chemotherapy drugs, should not be a long-term fix.

    I think it would be great if somebody could test Noreen’s no “long-term fix” idea, especially in the context of her anti-cancer statement, by conducting a randomized trial.

    How could we set up this trial? We could have a group of HIV-positive people who take ARVs continuously, and a second group who take ARVs only when their CD4+ T-cell counts drop below a certain level. Perhaps this second group would discontinue drugs when CD4+ T-cell counts go above, say, 350, and resume them when counts fall under, say, 250.

    What outcomes would we expect if Noreen’s statements are correct?

    We would expect that people in the continuous treatment group would be much sicker than people in the interrupted treatment group due to Noreen’s claimed toxic effects of unnecessary ARVs that should only be taken as a last-ditch measure. Both morbidity and mortality should be higher in the group that receives continuous “poison” compared with the group that gets these “toxic” chemicals only when they are very sick, as Noreen urges.

    From Noreen’s anti-cancer claim, we would predict a lower rate of cancers in the continuous treatment group than in the “conserved” treatment group.

    Does anyone know of such a study? Is anyone willing to perform a study like this? We really need to know these results to evaluate Noreen’s claims.

  174. #174 franklin
    September 22, 2007

    Carter,

    I think we may have identified the reason you are having so much trouble understanding the scientific understanding of the AIDS epidemic.

    We are discussing the following paper:

    Ou CY, et al. (1992). Molecular epidemiology of HIV transmission in a dental practice. Science 256:1165-71.

    For some reason, you seem to think that the key to understanding the scientific evidence presented in this paper can be found in “Henry Bauer’s book, “The Origin, Persistence and Failings of HIV/AIDS Theory” McFarland & Company; 1st edition, June 30, 2007.”

    Here’s a clue, if you want to understand Ou et al. (1992), you have to read Ou et al. (1992).

    Study the methodology, examine the results, pay close attention to the logical arguments made by the authors and form your own opinion as to whether their arguments are supported by the data.

    You seem to think that you can form an intelligent opinion about the science without ever reading the science–just by reading Denialist diatribes filled with distortions of the science.

    Just bury your head in the sand, little ostrich.

  175. #175 noreen
    September 22, 2007

    A great study would be a group on LDN verses a group on the antiretrovirals. The interesting results would be the comparison of the blood and liver enzymes and which group had the most opportunistic diseases. Actually, there is one study being done in Africa but none in other parts of the world. It is generally assumed that antiretrovirals are the only treatment for AIDS. Now, there are enough people who LDN to perform such a study.

  176. #176 Roy Hinkley
    September 22, 2007

    Noreen,

    To say that your stance on HIV and ARVs puzzles me would be an understatement.

    How do you explain your high HIV viral load and low CD4 count prior to HAART, reduction of HIV viral load to 0 and increase in CD4 to 240 while on HAART, then after quitting your medications your HIV viral load shot straight back up to 100,000 and CD4s have been dropping continuously to about 80 (I think you said).

    For me it’s simple to explain. HIV was depleting your CD4 cells. HAART prevented HIV replication (hence the drop of HIV viral load to 0 while on medication), blocking HIV from killing more CD4s allowed CD4 cell counts to rise while on HAART. Then, after stopping HAART, HIV was again able to replicate (hence the HIV viral load of 100,000) and CD4 cells began to be depleted by the large amounts of HIV in your bloodstream.

    I’m glad you feel well and that you have no Opportunistic Infections. I hope LDN does work. But as long as HIV continues to replicate in your body and your CD4s continue to fall I don’t see how anyone can conclude anything other than that the standard theory of HIV/AIDS is correct and that as your CD4s continue to drop you are putting yourself at risk of new Opportunistic Infections.

  177. #177 ElkMountainMan
    September 22, 2007

    Wait! I just remembered a paper I just read in the journal “AIDS.” Conveniently, it answers all of the questions in my previous comment.

    Silverberg MJ et al, “Risk of cancers during interrupted antiretroviral therapy in the SMART study,” AIDS, Sept 2007; 21(14), 1957-63.

    Silverberg et al examine cancer rates in a randomized trial. One arm of the trial involves continuous use of antiretroviral drugs. The other allows CD4+ T-cell counts to direct the use of therapy. When the count rises above 350, therapy is discontinued. When the count falls below 250, therapy is resumed.

    For participants on continuous therapy, viral loads are lower and CD4+ T-cell counts are consistently higher than for participants in the interrupted arm. By these measures, the continuous therapy is better for one’s health than interrupted therapy. Our prediction based on Noreen’s “last-ditch” comment is not validated by this study.

    What about general health, since Noreen and other rethinkers dispute the validity of viral load and CD4+ T-cell counts? In this cohort, confirming the results of numerous previous studies, opportunistic infections and deaths are higher in the interrupted arm than in the continuous arm. Keep in mind that this is a randomized study. Continuous ARV treatment is therefore a better strategy than discontinuous ARV treatment as advocated by Noreen for minimizing outcomes such as OIs and death.

    What about cancer rates? Again, what we predicted based on Noreen’s comments is not seen. The non-AIDS cancer rates are similar between the two arms. The AIDS cancer rates, however, are six times higher in the group that takes ARVs on an interrupted basis–consistent with the drugs’ role in stopping retroviral replication and protecting against immune-system damage and resulting susceptibility to certain types of cancer that are closely influenced by immune system function.

    In other words, for the average AIDS patient, going off HAART is much riskier in terms of mortality and morbidity than staying on HAART.

    I don’t deny that some HIV-positive people do not need ARVs. The difficulty lies in identifying these people. The literature to date, however, suggests that those who follow Noreen’s advice–advice that issues from a study with an ‘n’ of one–and use ARVs only as a measure of last resort, are more likely to suffer health consequences including death than those who take ARVs continuously.

  178. #178 noreen
    September 22, 2007

    The HAART can wipe out the “viral load” and secondly there isn’t a large amount of HIV in the body, it is a math. formula. Yes, CD4′s do increase with the meds but this does not necessary equal to health. I have had low CD4′s and be dying and have had low CD4′s for two years and I am perfectly healthy. So, overall, CD4′s are a bad measurement of health. Even oplympic athletes have had low CD’4 and are extremely healthy.

    The problem with studies that you quote in regards to survival is that they do not take into account other factors such as, diet, health habit, supplements and certainly the positive effects of LDN. It is the combination of all of these that has maintained my health.

    Even by most standards, one has to wonder how can she do it? I have found a better way than the HAART to help maintain my immune system and without the side effects.

  179. #179 ElkMountainMan
    September 22, 2007

    Carter writes,

    Why don’t you read Henry Bauer’s book, “The Origin, Persistence and Failings of HIV/AIDS Theory” McFarland & Company; 1st edition, June 30, 2007 ?

    Why, Carter, do you assume that none of us has read Bauer’s book? Just as you assume none of us has read Duesberg, Maggiore, Hodgkinson, and on and on. To be honest, I haven’t read the whole thing, mainly because there’s a limit to the amount of amateurish ramblings of a non-expert I can stomach in a given month. But I’ve read enough to know that Bauer is just as wrong as Duesberg, if not as well-informed. This does let him off the hook, in a sense, since it means that he may not be trying to deceive his readers intentionally. But there is really no excuse for someone with scant knowledge of biology and statistics who writes a book claiming to bring down the entirety of HIV epidemiology. No, scratch that: HIV/AIDS science! That is the height of presumption. Who is this Bauer person, anyway, and why do you believe him, Carter?

    Because you like his conclusions, I suppose, and you are just as scientifically unequipped as Bauer himself, unable to recognize his flaws.

  180. #180 Roy Hinkley
    September 22, 2007

    “I have had low CD4′s and be dying and have had low CD4′s for two years and I am perfectly healthy. So, overall, CD4′s are a bad measurement of health.”

    You’ve also been deathly ill with AIDS defining OI’s while your CD4 cell counts were minimal haven’t you?

    Have you ever had AIDS defining OIs with normal CD4 cell counts that you know of?

    Anyway, it’s the continuously dropping CD4 cell count that concerns me more than a single static number would.

    Yes, CD4′s do increase with the meds but this does not necessary equal to health.

    Not only do CD4′s increase but the viral load drops from 100,000 to 0. Then after quitting the medications viral load jumps back to 100,000 and CD4′s begin declining.

    These phenomena are exactly what the standard explanation of HIV, AIDS, and HAART predict. Aren’t they?

  181. #181 franklin
    September 22, 2007

    Noreen,

    Given that you “do not believe that HIV is the cause of AIDS,” what makes you think that there is good cause to prescribe antiretrovirals as a “last ditch” effort for AIDS but not for other conditions that cause severe immune suppression?

  182. #182 noreen
    September 22, 2007

    High viral loads and low CD4′s is the current definition for AIDS but what is alarming is that HIV-Negative persons have had high viral loads. It is difficult to know what an individual’s CD4′s were prior to HIV or AIDS. Many other illnesses can bring them down too.

    There may be other conditons that the HAART could possibly help but this has not been studied or generally practiced. I may be one of the few rethinkers who believes that there is a purpose for the use of the HAART under certain conditions. I never stated that it did not help me only that I do not believe that it is wise to take it for the rest of one’s life. I was fortunate to learn about LDN and to have progressive doctors who also felt that it would benefit me.

  183. #183 ElkMountainMan
    September 22, 2007

    Noreen,

    I have not been able to find information about Olympic athletes who have CD4+ T-cell counts as low as yours…or even anywhere close. Would you mind giving me your source for this? I would really appreciate it.

    A total of perhaps several hundred cases of CD4+ T-cell counts below 300 have been found in the United States since 1985 in HIV-negative persons who do not have any other obvious reason for immunosuppression. For many of these people, the dip is transient, but for some, it persists. HIV rethinkers suggest that these rare cases prove that low CD4+ T-cell counts are a “normal” phenomenon. They are not. Just because a cause has not been identified does not mean that the low counts are normal or without cause. People with unexplained CD4+ T-cell lymphocytopenia sometimes suffer from OIs that affect AIDS patients.

    Low CD4+ T-cell counts are in no way “normal,” and anyone who has such counts, whatever the cause, has elevated risk of OIs and death. Noreen may consider herself an exception, but she should remember that her personal study has n=1, and the studies contradicting her collectively have n’s in the hundreds of thousands.

  184. #184 ElkMountainMan
    September 22, 2007

    Noreen,

    It seems I have much to learn from you, as I can’t find credible information about HIV-negative people with confirmed high viral loads, either. I would appreciate it if you could post your source for HIV-negative individuals with high viral loads (that is, high levels of plasma HIV RNA). Has anyone made such a claim since reliable HIV RNA assays were worked out? Have you heard of any HIV-negative person who consistently has viral loads as high as your own?

    Thanks in advance.

  185. #185 noreen
    September 22, 2007

    We all have a lot to learn in regards to HIV. I first stumbled upon the fact that athletes have low CD4′s years ago. Off hand, I do not know what the source was. You see, I had many hundreds of pages about AIDS years ago when I was trying to sort all of this out. However, I questioned my infectious disease doctor about this and he admitted that yes it was so but they did not know why. Bear with me, I am sorting through three-hundred pages to get the info on HIV-Negatives and viral loads.

  186. #186 noreen
    September 22, 2007

    Surfing the net, I found that one study was performed in 1980, cited in a report to the Un Human Rights Commission presented by Project AIDS International showing that atheletes had low CD4′s, although not as low as mine. I also found this quote, “As in other studies, we found that survival was not influenced by demographic characteristics or CD4 lyphocyte count” Narasimham M et al. Intensive Care in Patients with HIV Infection in the Era of Highly Active Antiretroviral Therapy.

    “False positives occur with a RNA assay including the newer generation of viral load test.” Mendoza 1998.
    Few labs will run a viral load test unless the patient is HIV-Positive because too many HIV-Negatives were having high viral load results. To rectify this problem, the CDC issued an order for laboratories not to run this test on HIV-Negatives.

    You might wonder how can this happen? The probes and primers used in the PCR are not specific or unique to HIV. Most of the copies made by the PCR represent non-infectious viruses. Basically, we do not know what the PCR is measuring. If one tests positive on the HIV antibody test it is assumed that it is HIV on the PCR test. The CDC stated that the specificity and the sensitivity of the PCR has not been determined and is not known. Similarly, all manufactures of the HIV viral load have written disclaimers, not to be used as a diagnostic test to confirm the presence of HIV infection.

    Both of these tests are routinely used and the patients health care is based upon them, even though they have their faults.

  187. #187 carter
    September 22, 2007

    Henry H. Bauer is Professor Emeritus of Chemistry and Science Studies and Dean Emeritus of Arts and Sciences at the Virginia Polytechnic Institute and State University. He was born in Austria and educated in Australia. After researching electrochemistry at the Universities of Sydney, Michigan, Southampton, and Kentucky, he turned to general issues relating to scientific activity, in particular how to differentiate science from pseudoscience. He has taught both undergraduate and graduate programs in humanities and science and technology studies. Upon retirement from teaching at the end of 1999, he became Editor-in-Chief of the Journal of Scientific Exploration.

    Bauer has challenged the HIV/AIDS hypothesis in several papers, based primarily on the fact that the data on HIV seroprevalence are incompatible with the notion that the HIV antibody tests are detecting a sexually transmissable virus.

    You morons are starting to bore me.

  188. #188 Carter
    September 22, 2007

    About the book
    “Thanks to enormous funding for educational programs, the whole world ‘knows’ that HIV causes AIDS. But is what we know compatible with the facts? This book challenges the conventional wisdom on this issue. Collating and analyzing, for the first time, the results of more than two decades of HIV testing, it reveals that the common assumptions about HIV and AIDS are incompatible with the published data. Among the many topics explored are the failings of HIV testing, statistical evidence that HIV is neither sexually transmitted nor increasingly prevalent, and problems caused by the differing diagnostic criteria for AIDS around the world… But how could everyone have been so wrong for so long? This vital question, unaddressed in previous works questioning the HIV/AIDS connection, is central to this book. The author considers comparable missteps of modern science, and discusses how funding influences discovery in today’s scientific circles.”

  189. #189 Milt
    September 22, 2007

    It would be great to have ElkMountain, Tara, Franklin, and the rest of these zealots take some AZT on a daily basis for a month, and report to the group here, what it does to them.

  190. #190 DT
    September 22, 2007

    Noreen, you have yet to tell us how you think ART helps in some cases of AIDS/advanced immunodeficiency. You imply that it helps manage infections. This is incorrect. There is some very inconsistent and unimpressive data that protease inhibitors have some in vitro effect against some fungal infections – but this is at concentrations well above what would ever happen in vivo.

    Recall that ART is a mixture of drugs specifically designed to inhibit elements of the life cycle of HIV. So drugs have been designed/engineered to inhibit CD4/gp120 binding, inhibit CCR co-receptor binding, to inhibit fusion, to inhibit RT by analogue substitution as well as a specially designed configuration of inhibitor that attaches into the 3 dimensional “palm” of the RT enzyme, to inhibit viral integration into the genome, to inhibit proteases and other processes in virus assembly.

    Each and every one of these drugs has shown lab and clinical effects in reducing viral levels and restoring immune function.

    Why is this?

    Is it possible for you to think the unthinkable, and dare to imagine that these drugs act against a virus, namely HIV?

    These drugs should have no effect against other microbiological organisms – well certainly not the bacteria, fungi and parasites that afflict those with advanced HIV. Some of the drugs do have an effect against Hep B and are used to treat it (eg tenofovir, lamivudine, emtricitabine). You see, the researchers have looked into all this, extensively.

    How come drugs like AZT (widely ridiculed as a “cause” of AIDS because it supposedly destroys people’s immune systems (according to denialist dogma) form part of successful ART regimens? How does giving a drug that should increase the susceptibility to infection actually reduce it?

    Please think this through. Your own experience (n=1) amounts to very little. As others have shown, major studies such as SMART have conclusively demonstrated the greater risks that prevail if people stop therapy. Not only is there an increase in AIDS diagnoses, but an increase in liver disease and malignancy (yes, that’s right! – the drugs that supposedly destroy your liver and cause cancer actually protect HIV patients against these things).

    I have no agenda except a desire to see people with HIV do the right thing, yourself included.

  191. #191 ElkMountainMan
    September 22, 2007

    Carter,

    Let me give you a friendly tip: copying text without giving your source doesn’t exactly impress anyone. Did you copy that Bauer bio from Henry Bauer’s website, or from where?

    Carter, Henry Bauer is no more qualified than you to write a book about HIV…well, except that Bauer is at least able to give sources for his quotes. Since the 1970s he’s been teaching “science studies,” a bunch of pomo nonsense about how science is dead. For lack of a better term, “science studies,” like most of the rest of what passes for philosophy these days, is mental masturbation. The influence of “science studies” on actual science and actual society is nil. I suppose its existence adds a bit to employment figures, but that’s about it.

    A teacher of “science studies” who doesn’t know the first thing about virology is bound to make a fool of himself if he writes a treatise on how everything we know about HIV and AIDS is wrong. Predictably, Bauer makes a fool of himself in a grandiose way. I don’t believe Bauer understands how wrong he is, which is why I find him more amusing or pitiful than despicable, like certain more qualified scientists who know very well that they are trying to deceive people like you, Carter, who believe them in an understandable wish to deny your own health problems.

    If you would like specific examples of the sort of head-scratching, eyebrow-furrowing inanity in Bauer’s writing, I will give you a few. But you’ve already wasted my time with Duesberg. Nobody responded to any of the many flaws that I along with Franklin, Chris, DT, apy, adele, and others I’m forgetting gave you from Duesberg’s writings. We gave you quotes, references, page numbers and everything, and it doesn’t seem that any of you even checked them. You certainly didn’t respond.

    Carter, you and your friends here are hero-worshiping Bauer just like you hero-worship Duesberg: because what Bauer says soothes your fears and helps you deny reality.

  192. #192 DT
    September 22, 2007

    Noreen, RE CD4 counts in Olympic athletes:

    Also surfing the net, I can find only indirect reference to this. You appear to have got your “evidence” from the Alive and Well site:

    One study on Olympic athletes in the early 1980s (cited in a report to the UN Human Rights commission presented by Project AIDS International) showed their T cell counts averaged between 400 and 600.

    A few other web references exist, all of them seeming to be extracts from denialist sites (one of which actually says the study was in 1984). Forgive me for being a little cynical, but where is the original paper? Can we read what it says exactly and in context, or do we (and you) have to rely on rethinker reinterpretation of the findings? Can you tell us the precise, specific source of your data on these athletes?

    Also I would point out that the athletes have CD4 counts five times as high as yours. I am afrid that a count of 500 is not, as A&W put it, “facing imminent illness and death”. Most labs have 500 as the lower limit of normal. This means that between 2.5% and 5% of normal healthy HIV-uninfected people will have a count below this level.

    About 15 years ago I was a volunteer in a lab study looking at CD4 variability through the day and from day to day. My counts ranged from 400 to 700. Hardly evidence HIV does not cause AIDS, I would have thought.

  193. #193 ElkMountainMan
    September 22, 2007

    Noreen,

    Thank you for looking up those references for me. I would give you the same advice I gave Carter: when you get your information from a website, please tell us what that website is.

    You wrote,
    Surfing the net, I found that one study was performed in 1980, cited in a report to the Un Human Rights Commission presented by Project AIDS International

    Noreen, can you tell us honestly which websites you visited to find this report, along with the quote and the Mendez et al study?

    Please, Noreen, remember that these websites are giving you only a small portion of the big picture. They are filtering out all of the data that disprove their pre-selected fantasies about HIV and AIDS.

    In truth, there are hundreds of studies about the effects of various types of exercise on CD4+ T-cell counts and other immune parameters. Not just one report from the early 1980s that a “rethinker” organization reportedly sent to the UN. Endurance athletes at the Olympic level are in effect torturing their bodies; there are consequences for the immune system. Some do have transient dips in peripheral blood CD4 counts. However, I have not seen any reports of an HIV-negative athlete with a CD4 count below 200. Have you, Noreen?

    As for CD4 counts, they of course have a relation to general health! I’m not sure where you got this quote, but please remember that rethinker websites often take quotes out of context. They will only present quotes and data they “agree” with, even if that means a bit of distortion.

    Noreen, I don’t have the time right now to address your comments on viral load measurements and “non-specific” primers, other than to say that you are absolutely and completely wrong on this. The primers and probes used in these assays do not bind to anything in the human genome. False positive samples are usually not reproducibly positive, and are the result of laboratory errors. Noreen, I really don’t wish to come across as pompous, but Matt Irwin and others you rely upon for your information are flatly wrong, and I encourage you to consult with a knowledgeable, non-partisan doctor to learn about the viral load assay and how it applies to you.

  194. #194 Jim
    September 22, 2007

    “The probes and primers used in the PCR are not specific or unique to HIV. Most of the copies made by the PCR represent non-infectious viruses. Basically, we do not know what the PCR is measuring. If one tests positive on the HIV antibody test it is assumed that it is HIV on the PCR test.”

    I would really love to see a source for this gem. Do you even know how PCR works and how one designs the primers and probes used? In case you didn’t know:

    We have the sequence of the human genome:
    http://www.sciencemag.org/cgi/content/abstract/291/5507/1304
    and thousands of sequences from HIV isolates:
    http://www.ncbi.nlm.nih.gov/sites/entrez?term=human%20immunodeficiency%20virus&cmd=Search&db=nuccore&QueryKey=1

    I’m sure we have the ability to form primers and probes unique to HIV. If you don’t believe me, find an alighnment program (they are available online for free) and take the time to check the available HIV sequences against the human genome if you don’t believe it’s true.

    As an undergrad I worked in an HIV lab and regularly performed PCR reactions to detect various forms of the HIV genome in infected cells. And guess what, in uninfected cells I never detected HIV but I always detected HIV in infected cells. Don’t believe me? Go to a lab, infect some cells and perform PCR with HIV specific primers and see for yourself.

  195. #195 noreen
    September 22, 2007

    Hello, DT welcome back! DT how can you argue with a perfectly healthy human being? If I were not HIV-Positive, we would not be having this conversion. I am not the only HIV+ who is doing the same as many have contacted me. It is you who is stuck with this study and that study, which may have some valid points but does not represent the entire HIV population. I would expect more inquistive questioning from some one who is suppose to be scientifically minded. Instead, from most, I get the same old gloom and doom reports, who try to instill fear back into the equation. Well, at least my doctors are following me in amazement and will have to address the obvious, maybe the patient knows better how to deal with this than the same old routine of antiretrovirals.

  196. #196 Chris Noble
    September 22, 2007

    The CDC estimates that 1.1 million Americans are HIV+, with 40,000 new cases and a little less than 20,000 deaths each year. This accounts for a quite stable figure, and in spite of varying definitions, there have been about 1 million HIV+ Americans for well over ten years now. Yet, only 250,000 take meds and of these it is said that it’s hard to keep them taking the meds. This leaves 750,000 HIV+ Americans who haven’t been taking meds in any given year, yet there is no upsurge in the number of ‘AIDS’ cases, which remains pretty steady at 250,000, and there have been fewer than 200,000 deaths in the past ten years. So we can pretty well accept that the figure is around 75% – yes, 75% – and the other 25% are indeterminate, because they’re on the meds.

    If the median CD4 count at initiation of HAART is about 200 and the median time from infection to AIDS is about 10 years then what percentage of people would be expected to be on HAART?

  197. #197 Chris Noble
    September 22, 2007

    Are any of the Deniers still denying that Kimberly Bergalis had severe candidiasis, weight loss, hair loss and almost died from PCP before she was tested for HIV and was severely ill before she was ever prescribed AZT?

    I’m getting sick of going through the exact same points every few months.

  198. #198 Jim
    September 22, 2007

    “Well, at least my doctors are following me in amazement”

    Maybe they’re following you in amazement because you have something to teach us about the complex interactions between a pathogen and its host. You seem to be lucky enough to have factors that make HIV infection different from the norm.

    “and will have to address the obvious, maybe the patient knows better how to deal with this than the same old routine of antiretrovirals.”"

    You don’t think it’s arrogant as hell to think you know more than someone who’s made it their life’s work to study HIV?

  199. #199 cooler
    September 23, 2007

    yeah experts hacks like gallo announced a plague to the public without any published evidence, then a week later we found out about his partial barely detectable correlation with no animal model, not one study since designed to confirm his sorry hypothesis, you cant confirm something you already beleive to be true, so where left no evidence at all, besides Gallo’s flimsy paper. His failed cancer virus turned into the AIDS virus overnight.

    If im wrong please provide me with a scientific paper that states ” an experiment to test whether or not hiv is the cause of AIDS, to examine Gallo’s claim” Cant find it, bc it does not exist, they all had to assume it to be true.

    “Experts” will say anything especially if the government is behind it, If gallo and heckler came out and said “mycoplasma” is the cause of AIDS you guys would be parroting that in Orwellian fashion.

    Experts have a tendancy to follow the states propaganda, they did in Stalins Russia, Orwells 1984, Nazi Germany, and the AIDS apologists are doing it now, thank god more and more experts are speaking out like Margulis and Pollock, and this consensus you people gloat about evaporating.

    Your consensus is manufactured consent ie, if experts heard both sides of the issue you artificial “consensus” would dissapear, youd be left with only a few crackpot scientists like moore/wainberg drinking the hiv kool aid. If you hear only one side of an issue you tend to believe it.

    For lurkers
    See hiv fact or fraud google it

    Read project day lily to find out about the mycoplasma incognitus biowarfare program, a microbe that shyh ching lo killed every animal he injected with, dr garth nicolson found out it was part of the biowarfare program, a true story slightly fictionilized to stay out of court, rave reviews from several scientists, including a nobel laurete.

    Project Day lily google it. read a chapter for free

  200. #200 Chris Noble
    September 23, 2007

    ….you cant confirm something you already beleive to be true…

    Huhhh?

  201. #201 Tyler DiPietro
    September 23, 2007

    “Experts have a tendancy to follow the states propaganda, they did in Stalins Russia, Orwells 1984, Nazi Germany…”

    Did you just cite a work of fiction as an example of how real experts tend to follow “the states propaganda”?

  202. #202 Epidemiology-LISA
    September 23, 2007

    If the median CD4 count at initiation of HAART is about 200

    Ah thank you Dr. Noble, for finally offering us your definition of “advanced stage AIDS”. Trust me I shan’t forget it.

  203. #203 cooler
    September 23, 2007

    If i am already convinced a Black man broke into my house (when it could have been anybody) and all subsequent investigation was based on that essential premise, and failed to investigate any alternative scenarious, it makes the investigation flawed, for not considering alternative hypothesis.

    If every study I conduct assumes as its premise a black man broke into my house, its fallacious research. IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis, and would ignore evidence that didnt support your prexisting beleif that youd never abandon.

  204. #204 Chris Noble
    September 23, 2007

    Trust me I shan’t forget it

    If you are interested in anything other than rhetorical wordgames then you could attempt to answer the question I posed to Carter.

    Your complete lack of any rational response to this post is also noted.

    Does drug use cause AIDS

  205. #205 Chris Noble
    September 23, 2007

    IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis, and would ignore evidence that didnt support your prexisting beleif that youd never abandon.

    For the past 100 years every single experiment in aeronautics assumes that heavy-than-air flight is possible. Nevertheless these experiments all confirm this assumption.

    Vaccine trials use the SHIV/macaque model. They all assume that HIV causes AIDS and yet they also provide confirmation from the reproducible AIDS produced in these animals. The experiments are not designed to test the theory and yet the results provide evidence that can only be ignored by people that are afraid to face reality.

  206. #206 cooler
    September 23, 2007

    none of those studies were designed to test whether or not hiv causes AIDS, the asher study is a total fraud bc they viewed dissidents as nazis, If duesberg conducted a study and he came to the conclusion that hiv was not the cause of AIDS, everyone would say it’s invalid bc hes partial. Well same rules apply to hacks like winklestein etc

    Im not asking for much, a study by honest scientists not tied to either side that would read” “in 1984 Gallo claimed hiv was the cause of AIDS, bc of the lack of a reliable animal model, we are going to conduct a rigorous epidemiological study to see if hiv positive people with no other possible risk factors such as AZT, Drug use, mycoplasma incognitus, catastrophic stress/mental illness develop AIDS at a higher rate compared to matched controls that are hiv negative.

    Kind of pathetic you guys dont have one study like that………….just babble about macaque monkeys and siv, while ignoring virtually every other species of animal doesnt get AIDS when inoculated, siv doesnt even occur in the wild………..you guys have nothing, not one properly designed study as shown above, no animal model, thousands of ltnp’ers, no explanation why it takes 10 years, how it kills cells when it only infects 1/1000 blood tcells or so…………we need more investigation, maybe hiv does cause AIDS but its not 100% sure like you guys make it out to be………….more studies are needed, deal with it, start thinking for yourselves.

  207. #207 Chris Noble
    September 23, 2007

    none of those studies were designed to test whether or not hiv causes AIDS, the asher study is a total fraud bc they viewed dissidents as nazis, If duesberg conducted a study and he came to the conclusion that hiv was not the cause of AIDS, everyone would say it’s invalid bc hes partial. Well same rules apply to hacks like winklestein etc

    If none of studies since 1984 have been designed to test whether or not HIV causes AIDS then they can’t possibly be used as evidence that HIV does not cause AIDS according to your logic. This has never stopped Denialists from arguing exactly this. In the absence of any experimental results of their own this is their sole argument. You can’t have it both ways. If these studies can be used to argue against HIV causing AIDS then they can also be used to provide evidence for HIV causing AIDS.

    There are labs around the worlds using animal models such as the SHIV/macaque model of the HIV/SCIDhu mice. These results complete destroy Duesberg’s bullshit claim that retroviruses do not cause AIDS. They provide overwhelming evidence that HIV causes AIDS.

    I also notice the ad hominem attacks on Ascher and Winkelstein. At least you didn’t call them “Fauci’s buttboy” and “Winkelstinkel”. If you have any factual criticisms then present them. If we use your logic then we should also ignore anything Duesberg says because he obviously isn’t impartial.

  208. #208 noreen
    September 23, 2007

    What is the height of arrogance is doctors who won’t listen to the patient, who don’t believe that supplements, alternative treatments and old drugs such as LDN have any relevance to health and who won’t take the time to learn about these and other treatments. Caring and competent physicians are to few and far between. I requested that my orthopedic doctor run a complete blood count and he stated that he could not read it. I would have been embarrassed to admit this to the patient. Anyone can go on line and learn how to do this. This is basic med shcool material. I have asked my doctors where is the epidemiology study that proves HIV causes AIDS, they state that it is “somewhere” in PUBMED. That’s fine if that is their belief but after being in the field for years, they should do better than that and tell me specifically where or that it has not been done.

  209. #209 Adele
    September 23, 2007

    Well noreen thats the problem with going to a orthopedist!! just kidding everyone, sort-of!

    So your doctor can’t do a blood count, but you believe it when a doctor tells you olympic people have cd4 counts like AIDS patients??!! Why would you believe that? Well gee because you want to think your not just healthy you’re as healthy as an olympian. Therfore low CD4 counts are HEALTHY. Noreen it makes me so sad how you’re twisting things in your head, you’re smarter than that I know it.

    I think DT was right you got that info from our make your own positive baby friends at A&W. You got the name of the deniosaur organisation wrong like Christine “The Mom The Legend” Maggiore. ITs not Project AIDS International its Project: AIDS International. Noreen these people don’t care about babies even why do you think their giving you good information.

  210. #210 carter
    September 23, 2007

    I will tackle something you make reference to over and over…
    Do recreational drugs cause AIDS? PMID: 8876838. My bracketed comments/questions [ ]

    “We evaluated the associations [sounds like "oh never mind seeking causation, That's not going to help us with our virus theory, we'll just evaluate associations here'] of specific recreational drugs [which ones?] and alcohol with laboratory [test tube] predictors [Is this another one of those probable math equations?] of AIDS at entry into the San Francisco Men’s Health Study (SFMHS) in 1984 [out of these men, were they the occasional user or the chronic user? How was that determined?] and with the development of the acquired immunodeficiency syndrome (AIDS) during 6 years of follow-up. [where's the follow up to nearer today, 17 years later?] Marijuana use was associated with a decreased rate of progression to AIDS in the univariate analysis (RR = 0.7; P = 0.01). Marijuana use was more common among individuals with elevated HIV viral core protein antibody (p24Ab) titer (> 1:16) at baseline (P = 0.03); this finding suggests that marijuana users were healthier at baseline. When the data were adjusted for p24 Ab and other laboratory parameters, no association with progression to AIDS was observed for marijuana, suggesting that the observed univariate result was due to a difference in HIV-related disease at the time of enrollment. [All this talk on marijuana. Marijuana has been around virtually since recorded history, The focus seems to be sided to a rather weak drug in order to mislead] No statistically significant associations were observed for nitrites, methylene dioxyamphetamines, ethyl chloride, downers, cocaine, stimulants, narcotics, or psychedelic drugs. These data suggest no substantial association between use of these drugs and the development of AIDS among HIV-infected men.

    “Laboratory predictors” does not mean real world observations. I saw, more than one can imagine, friends that took verbatim their doctors death sentence and partied like there was going to be no tomorrow, whom became ill because of drug use then were prescribed AZT/HAART because that was standard protocol just because they registered HIV+. They’re dead because of the standards the establishment’s fucked in the head thinking imposed upon them.

    The refutation abounds here that drugs are not a factor and your subterfuge suggests we all say drugs cause HIV. Both are farthest from the truth. There is no logic what you say, studies are designed to look for a predicted outcome in favor of HIV being the end all be all and more often then not accounting for the mental devastation caused by the prescribed death sentence is not taken into consideration.

  211. #211 noreen
    September 23, 2007

    Adele, the facts speak for themselves, HIV has not been islolated in pure form, there hasn’t been one study that proves HIV causes AIDS, the HIV test is for antibodies and not an actual virus, Grade four events are real for HIV-Positives and so is liver disease, heart attacks, abnormal blood, anemia, buffalo humps, neuropathy, and diarrhea, Viral loads are only 6 to 8% accurate, CD4′s are not the best yardstick for health, Gallo only found 40% of patients with HIV, Gallo was investigated for scientific misconduct, Nancy Padian could not find one couple who the negative partner converted to HIV-Positive and the majority of AIDS cases are still predominately in the male population. These are some of the reasons that I am a rethinker because the mainstream’s math does not add up.

  212. #212 noreen
    September 23, 2007

    Add the fact that full-blown AIDS persons are living without the antiretroviral medications does seem to challenge what we have been told.

  213. #213 Epidemiology-LISA
    September 23, 2007

    If you are interested in anything other than rhetorical wordgames then you could attempt to answer the question I posed to Carter. Your complete lack of any rational response to this post is also noted.

    Dr. Noble, your incessant torture of the word word “rational”, here used as a variant of the “no true scotsman” fallacy, may seem clever to your fellow political dogs in the AIDStruth kennel, but you’ve got to up your game a wee bit if you want me to take the bait.

  214. #214 franklin
    September 23, 2007

    Noreen,

    You ask for the “epidemiology study that proves HIV causes AIDS”.

    Here is a link to an essay of less than 1000 words that summarizes much of the epidemiologic evidence that HIV infection is the cause of AIDS: Koch’s Postulates Fulfilled. It includes a few dozen references to the primry research literature.

    I’ve posted this link before–have you read this essay? If so, do you have any specific criticisms of the scientific evidence summarized in this essay? If not, please stop claiming that no one has directed you to the “epidemiology study that proves HIV causes AIDS”.

  215. #215 Adele
    September 23, 2007

    Noreen, remember how you said apy “believes everything you read?” Thing is, apy gets information from peer-reviewed stuff. You get all your information from alive and well and virusmyth. Its like getting all you information about evolution from discovery institute.

    All that stuff you just said? Its all wrong but how can anyone prove it to you you already decided what to want to believe.

  216. #216 Epidemiology-LISA
    September 23, 2007

    Noreen here’s the epidemiological proof in just a couple of hundred words that anti-HIV drugs cause AIDS. Let me know if you have any specific criticisms of the scientific evidence summarized in this essay(-;

    the Palella-study found that the mortality of
    initially asymptomatic, HIV-positive people, which are
    treated with new anti-HIV drug cocktails, is 8×8% (“8×8
    per 100 person-years”) and the Hogg-study found it is 6×7%.
    But, in the absence of untreated control groups, the
    effects of the new anti-HIV drugs on the morbidity and
    mortality of HIV-positive recipients can not be determined
    scientifically from the results of these surveys.
    However, the average annual AIDS mortality of all HIVpositives on this planet [including the minority that is on anti-HIV drugs (The Durban Declaration 2000)] can be
    estimated for 2000, the year that falls in between the two
    surveys, based on data provided by the WHO and the
    Durban Declaration: The WHO and the Declaration report
    in 2000 34×3 million “living with HIV”, and the WHO
    reports 471,451 AIDS cases for 2000 (World Health
    Organization 2001b) (obtained by subtracting the WHO’s
    cumulative total of 1999 from that of 2000, see also table
    4). Thus, even if we assume that all AIDS cases were
    fatal in 2000, the resulting global mortality rate of HIVpositives would only be 1×4% – and thus 4 to 6 times
    lower than the 6×7-8×8% mortality rate of HIV-positives
    treated with anti-HIV drugs in the US and Canada.
    Therefore, the claims that anti-HIV drugs reduce the
    mortality of, and delay progression to AIDS are at odds
    with the AIDS facts reported by the Durban Declaration
    and the WHO. Contrary to these claims, the controlled
    trials and uncontrolled surveys listed above prove that
    anti-HIV drugs (possibly in conjunction with recreational
    drugs) increase the mortality of HIV positives 4- to 6-
    fold. It would appear that anti-HIV drugs are prescriptions
    for, rather than treatments of AIDS.

    http://duesberg.com/papers/chemical-bases.html

  217. #217 Brad
    September 23, 2007

    http://www.aidstruth.org/science-sold-out.pdf

    “As an aside, the Duesberg review from 2003 [7 - http://duesberg.com/papers/chemical-bases.html is representative of the denialist literature in its willful manipulation and misrepresentation of more scrupulous scientists' data. In this 30-page review, the authors complain that earlier versions of their manuscript had previously been rejected (or not accepted) by two journals with wider circulation than the eventual publisher, the Indian Journal of Biosciences. Reading the paper closely raises the question of why this third journal did not also reject it. Take the following sentence fragment as one example.

    ...the Palella-study found that the mortality of initially asymptomatic (sic), HIV-positive people, which (sic) are treated with new anti-HIV drug cocktails (sic), is 8.8%...and the Hogg-study found it is 6.7% (sic) [7]

    Palella and colleagues document a steady decline in death rates from 35.1/100 person-years in early 1994 to 8.8/100 person-years in the second quarter of 1997. These strikingly high death rates are seen because the authors restricted their study to HIV+ individuals with CD4+ T-cell counts below 100 per microliter (ul), meaning that these patients were already severely immunocompromised. Many had CD4 counts below 50/ul. Analysis was not restricted to “initially asymptomatic” individuals. Some patients did not take antiretrovirals at all (the highest mortality rate in the second quarter of 1997–51.6/100 person-years–was in this group), while still others were on monotherapy (i.e., not the “new anti-HIV drug cocktails”).

    In the FJ Hogg et al paper, 6.7% is not, as implied by Duesberg et al, an annual mortality rate; the estimated annual mortality rate is 2.9%, as stated in the paper. 1219 HIV+ patients were followed for a median of 28 months. During the study, a total of 82 patients died of AIDS. 73% of the deaths occurred in patients (36% of the total) with CD4 counts below 200/ul. As in the Palella et al study, the patients were not all “initially asymptomatic”: 158 had been diagnosed with AIDS (73% with opportunistic infections, 17% with malignancies, others with neurological symptoms or wasting) prior to enrollment.

    These mistakes are grave and indicate, at best, the low standards of scholarship to which Duesberg, Koehnlein, and Rasnick adhere. Even worse is an example of what can only be described as true scholarly misconduct–the following misquote from the Palella article, truncated to leave the impression that all study participants were “initially asymptomatic”:

    Patients with a diagnosis of cytomegalovirus retinitis or M. aviarum complex disease before study entry or during the first 30 days of follow-up and patients with active P. carinii pneumonia at the beginning of follow-up were excluded. (Note the period here–KW) [7]

    In the original paper, this sentence does not end with a period. Instead, it continues:

    …from the analyses of the incidence of that opportunistic infection. [83]

    Thus, all patients were included in the overall study, including the mortality calculations, but patients with pre-existing or early-presenting conditions were not counted as having developed those specific conditions during the course of the study. Duesberg, Koehnlein, and Rasnick manipulate the quote to make it say what they want it to say, in effect lying about the patients’ health status and the study’s methods to support their own assertion that most deaths reported here were due to drug toxicity. It is unfortunate that Culshaw looks to this class of scholars for her information and inspiration.”

  218. #218 Shalini
    September 23, 2007

    Duesberg, the liar? His antics remind me of William Dembski all the time.

  219. #219 sohbet
    September 23, 2007

    thanks you…

  220. #220 Epidemiology-LISA
    September 23, 2007

    The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

  221. #221 cooler
    September 23, 2007

    Im still convinced a black man broke into my house, I refuse to consider another hypothesis, a witness tells me he saw a white man break into my house, i ignore him bc i will never abandon my hypothesis, this is the way AIDS research works.

    YOU inject hundereds of chimps/mice with HIV, they were all supposed to die of AIDs none did after 20 years, instead of considering a new hypothesis, I cling on and extend the goalpoasts to save the hypothesis, hiv is now species specific

    People were supposed to die within a few years, not 10 years……….when no one did just double the window period, ignore failed predictions and just carry on ………….ignore evidence, just extend the window period.

    Hiv was supposed to be directly killing tcells thats what youir lord gallo said………..reserachers find out hiv only infects about 1/1000 blood t cells……….instead of realizing that youve come across evidence that hiv might be harmless, you know say hiv , according to that fool joel gallant, its now a diffuse immune response that kills cells! LOL keep on extending the goal posts to save your idiotic theroy.

    Back to my analogy, a witness says hey i saw I white man break in your house, I ignore him and keep coming up with convoluted speculations that it had to be a black man……….this is the AIDS research since Gallo’s orwellian Press conference.

    See hiv fact or fraud google it

    read Project Day lily………mycoplasma biowarfare program uncovered by the nicolsons, greatest book ever slightly fictionilized to stay out of court google it

  222. #222 carter
    September 23, 2007

    Sir John Franklin,
    You say, “epidemiology study that proves HIV causes AIDS”, as referenced above.

    Wikipedia definition: Epidemiology is the study of factors affecting the health and illness of populations, and serves as the foundation and logic of interventions made in the interest of public health and preventive medicine. It is considered a cornerstone methodology of public health research, and is highly regarded in evidence-based medicine for identifying risk factors for disease and determining optimal treatment approaches to clinical practice.

    Wikipedia Furthermore states: Epidemiology as causal inference: Although epidemiology is sometimes viewed as a collection of statistical tools used to elucidate the associations of exposures to health outcomes, a deeper understanding of this science is that of discovering causal relationships. It is nearly impossible to say with perfect accuracy how even the most simple physical systems behave beyond the immediate future, much less the complex field of epidemiology, which draws on biology, sociology, mathematics, statistics, anthropology, psychology, and policy; “Correlation does not equal causation,” is a common theme to much of the epidemiologic literature. For the epidemiologist, the key is in the term inference.

    Can you not see here the common most and grave error in your logic, and in the logic of your sacred HIV nonsense? Epidemiology is a big word that encompasses a great deal. However, one can certainly see that from the mere definition one cannot just simply allow studies of epidemiology to make a 100% concrete proof of anything. Therefore your crybaby attitude of “BUT you guys don’t look at the studies shit” , is simply bull shit and seen as nothing more than a desperate attempt to hold on to HIV as if it’s something that fits your need to continue selling it.

    Why are you not listening and thinking without any basic logic? Stop pissing in the wind John.

  223. #223 noreen
    September 23, 2007

    You will have to better than that to fulfill Koch’s Prostulates. The article stated “most” cases it did not state 100%, which by the way is required. To cover this obvious flaw, a new term was invented for HIV-Negative cases, idiopathic CD4T lymphocytopenia.

    The virus must be found freely in the fluids of the patient, it is not in anyone’s saliva, blood or other fluids. In fact PCR in required to even find remnants of anything.

    The viurs must be taken out of the patient, be transferred to an animal species and the animal must develop AIDS. This has not happened with HIV, maybe similar viruses but not HIV.

  224. #224 Roy Hinkley
    September 23, 2007

    Noreen,

    Whether or not you accept CD4 counts as a good predictor of risk of opportunistic infection, how do you explain your personal health history of:

    - Illness with AIDS defining OIs, low CD4 counts, high viral load, and HIV+ antibody test before HAART.

    - After starting HAART and treating the OI’s your viral load dropped, and CD4s rose.

    - Then after stopping HAART your viral load rose to 100,000 and CD4s started falling?

    Isn’t this exactly what one would predict based on the current scientific understanding of HIV, AIDS and HAART?

  225. #225 Michael
    September 23, 2007

    DT, You said: About 15 years ago I was a volunteer in a lab study looking at CD4 variability through the day and from day to day. My counts ranged from 400 to 700.

    OH MY GOD DT! You had CD4 counts of ONLY 400! Don’t you know that according to the “1993 Revised Classification System for HIV Infection”, http://www.cdc.gov/MMWR/preview/MMWRhtml/00018871.htm

    By your OWN ADMISSION DT, You yourself had counts of less than 500 CD4 cells.

    WITH ONLY 400 CD4 CELLS, YOU, DT, ARE GOING TO DIE OF AIDS AND YOU SHOULD BE TAKING AZT!!! Even the CDC absolutely agrees:

    Measures of CD4+ T-lymphocytes are used to guide clinical and therapeutic management of HIV-infected persons (22). Antimicrobial prophylaxis and antiretroviral therapies have been shown to be most effective within certain levels of immune dysfunction (23-28). As a result, antiretroviral therapy should be considered for all persons with CD4+ T-lymphocyte counts of less than 500.

    But since you DT, have NOT been taking your AZT for the last 15 years, it is HIGH TIME you get sick with AIDS and get on with your dying! Now take your damned AZT and antiretrovirals, DT, or get off the damned planet!

  226. #226 Michael
    September 23, 2007

    By the way, DT, I, just like you yourself said, “have no agenda except a desire to see people with ‘Low CD4 Counts’ do the right thing, yourself included.”

  227. #227 Anonymous
    September 23, 2007

    Noreen, have you ever imagined such absurdity or stupidity?

    DT, who by the way is an HIV/AIDS clinician, has verified that as an HIV negative individual him/herself, DT has had results of only 400 CD4 cell counts which was proclaimed by the CDC as well into the immune deficient range of less than 500.

    Further, the CDC itself recommends since 1993 that those individuals with less than 500 take antiretrovirals.

    However, DT, as a clinician, does not and would not self prescribe nor take antiretrovirals for DT’s own low CD cell count, but is rather insistent that YOU and OTHERS SHOULD simply because you had a highly flawed HIV antibody test show as positive.

    DT, a devout follower and believer in all of the edicts of the CDC, NIAIDS, and big pharma, would further seek to brainwash you into believing that DT’s own low CD counts are somehow meaningless because he/she has not had a positive HIV antibody test, BUT, your low CD counts, Noreen, mean to DT that you will sicken and die without the highly toxic meds that DT has pushed unthinkingly and gleefully onto many others after brainwashing them into believing they would die without them.

    DT, what can I say? You are one sick puppy.

    I can only imagine it is your own ego’s denial of culpability and your own ego’s guilt in the role you yourself have played in the disfigurement of many who were diagnosed as HIV and who you yourself peddled disfiguring drugs to, that further drives you to continue your ranting against the dissidents.

    There is an old saying DT, that “one is only as sick as their secrets”.

    So come clean DT. Tell someone, or tell us your dirty little shamefilled secret and clear your soul. How many have you helped to poison or helped to scare to death and disfigurement with your stubborn scared little ego’s own error in believing that HIV was the cause of AIDS?

    Come clean DT. Tell someone. Seriously.

    Do not agonize yourself into further insanity over it, DT. We all understand that at the time, you were doing the very best you could with what you believed was right.

    The truth, as they say, shall set you free.

  228. #228 ElkMountainMan
    September 23, 2007

    “E-LISA”: did you or did you not read Brad’s quote, above? I’ll repeat the good part for you.

    the authors restricted their study to HIV+ individuals with CD4+ T-cell counts below 100 per microliter (ul), meaning that these patients were already severely immunocompromised. Many had CD4 counts below 50/ul.

    You claim that despite Duesberg’s outright lies, which are repeatedly referenced by rethinkers as “proof” that healthy people are immediately killed by antiviral drugs, you still believe:

    The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

    You can’t compare the Duesberg’s misrepresentation of data to “global statistics.” You have to compare the results of the study with results from cohorts with the same immunologic characteristics: people with CD4+ T-cell counts below 100.

    Where’s your data, E-LISA?

  229. #229 noreen
    September 23, 2007

    Roy, going by your synopsis, then I should also have been very sick for the past two years because most of this time, my CD4′s have stayed in the eighties. We will never know what was normal for me prior to getting sick. Perhaps, mine have always been on the low side. This is why, none of this makes much sense according to the mainstream’s standards.

    Personally, I was very sick mainly due to undiagnosed and untreatet medical conditions, unhealthy living habits, and past health issues. Due to all of the above, I proceeded to go downhill, which is not impossible to do when one is immune compromised. All of my conditions were around prior to the new classification of AIDS.

  230. #230 Shalini
    September 23, 2007

    E-LISA simply can’t, or won’t read.

  231. #231 Chris Noble
    September 23, 2007

    The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

    Duesberg has been caught with his pants down again.
    Why does Duesberg deliberately misrepresent these studies?
    Why was the manuscript rejected by two high ranking journals?
    Why was it finally published in a low impact factor journal where the corresponding editor was a friend?

  232. #232 franklin
    September 23, 2007

    Noreen,

    After reviewing the info on Koch’s Postulates Fulfilled you said:

    You will have to better than that to fulfill Koch’s Prostulates. The article stated “most” cases it did not state 100%, which by the way is required. To cover this obvious flaw, a new term was invented for HIV-Negative cases, idiopathic CD4T lymphocytopenia.

    I realize the essay is less than 1000 words, but I guess you somehow managed to miss the part that shows that HIV can be detected in 100% of AIDS patients.

    The following link will take you to one of the papers that demonstrates this experimental fact:

    Jackson JB, et al. (1988). J. Clin. Microbiol. 26:1416-1418.

    Abstract: Peripheral blood mononuclear cells from 142 consecutive patients with antibodies to human immunodeficiency virus type 1 (HIV-1) were cultured for HIV-1. All 72 patients with symptoms of HIV-1 infection were culture positive, as were 69 of 70 asymptomatic patients. Of the 142 patients, 132 (93%) were culture positive within 10 days after initiation of the culture.

    If you read the paper, you will see that while HIV was cultured from 100% of symptomatic patients with antibodies to HIV, the virus was cultured from none of thirty patients who lacked antibodies to HIV.

    This finding has been reproduced many times. For example: Jackson JB et al. (1990). Human immunodeficiency virus type 1 detected in all seropositive symptomatic and asymptomatic individuals. J. Clin. Microbiol. 28:16-9.

  233. #233 franklin
    September 23, 2007

    After the numbers she copied-and-pasted from Duesberg were shown to be fudged, Lisa claims:

    The mortality rate was still much higher on the drugs and much, much higher on early monotherapy in the US than in the 3rd. World countries overwhelmingly making up the global statistics

    Do you have any evidence for this claim, Lisa?

    Or is that just what you told yourself as you buried your head in the sand, little ostrich.

  234. #234 Chris Noble
    September 24, 2007

    While we are on the subject of Duesberg’s deceptive 2003 paper look at this quote.

    Even HIV-AIDS researchers have inadvertently confirmed our prediction of no AIDS in drug-free HIV-positives. For example, David Ho, signatory of the Durban Declaration, points out that in a group of “long-term survivors” of HIV studied in his lab, “none had received antiretroviral therapy” (Cao et al 1995). In a parallel publication, Pantaleo et al studying a group of long-term “non-progressors” of HIV have made the same observation (Pantaleo et al 1995).

    Duesberg implies that HIV researchers studied LTNPs and found that they all had not taken ARTs. If you actually read the papers the truth is different from the picture Duesberg tries to paint. The selection criteria in these studies includes not having taken ARTs so it is hardly surprising that these people had not taken ARTs.

    Cao Y, Quin L, Zhang L, Safrit J and Ho D D 1995 Virologic and Immunologic Characterization of Long-Term Survivors of Human Immunodeficiency Virus Type 1 Infection; N. Engl. J. Med. 332 201­208
    “Ten HIV-1-seropositive subjects from the New York metropolitan area were referred to us because they met our working definition of long-term survivors of HIV-1 infection: they had no symptoms, normal and stable CD4+ lymphocyte counts, no prolonged use of antiretroviral agents, and at least 12 years of infection.”

    Pantaleo G, Menzo S, Vaccarezza M, Graziosi C, Cohen O J, Demarest J F, Montefiori D, Orenstein J M, Fox C, Schrager L K, Margolick J B, Buchbinder S, Giorgi J V and Fauci A S 1995 Studies in subjects with long-term nonprogressive human immunodeficiency virus infection; N. Engl. J. Med. 332 209­216
    “The criteria used to define nonprogression included documented HIV infection for more than seven years, stable CD4+ T-cell counts greater than 600 per cubic millimeter, the absence of symptoms, and no antiretroviral therapy.”

    It is not possible to conclude, as Duesberg would have his audience do, that they had not progressed to AIDS because they had not taken ARTs.

    If Duesberg really has a case then why does he so blatantly misrepresent the literature? He obviously isn’t trying to convince people that are familiar with the literature. Who is he trying to convince?

  235. #235 Braganza
    September 24, 2007

    Brad,

    The errors that you reported from Duesberg paper are minor errors, because correcting them would not change the main conclusions of the paper.

    And therefore are you writing your post on these errors because you dont have anything to say about the major points that would be suggested by the authors, two of them being a) that standard ARV’s treatment accelerate AIDS, b) there is another way to treat AIDS patients, ?

    I believe that these were the questions to answer if you wanted to discredit the authors.

  236. #236 Epidemiology-LISA
    September 24, 2007

    Elkie and the rest of you guys who poopoo’ed in your pants at the thought of the efficacy of your favorite drugs being questioned, I’ll give you the good part of Duesberg’s so called “misrepresentation”

    “The largest and most influential of these surveys was
    conducted by Palella et al (1998) who investigated in
    1998 1255 anti-HIV drug-treated “patients, each of which
    had at least one CD4+ count below 100″ from nine clinics
    in the US.”

    Doesn’t look to me like he was trying to anything there eh Elkie and “Brad”?

    Duesberg then goes on to say all patients were “non-hospitalized”, AIDS free”. The illustrious ghostwriter of the AIDStruth smearjob you’re citing says that’s not true. Unfortunately he doesn’t tell us how far from the truth it is in numbers, hence I cannot do much more than point to the enormous US mortality rates, especially on the early monotherapy, compared to the global stats.

    And Frankie the reference for the global stats was the Durban Declaration and the WHO. It’s right there in the piece I cut and pasted. HOW could you have missed it. Are you feeling quite well there buddy? Perhaps you need an Atripla or something to clear your head?

  237. #237 jspreen
    September 24, 2007

    These endless discussions over the question whether or not the equation HIV=Aids=Take_The_Toxic_Drugs is accurate or not really are far out and one day our children… no, too optimistic… our grand-grand-grand-grand-children, will be truly amazed reading them.

    - Hey, look at this! It’s insane! Grand-grand-grand-grand-dad really believed that poison would help a starving person get back onto his feet! And he was not alone with his believe. Almost everybody did believe such nonsense. And to top it all, they insulted people who said “Give’em eat instead of drugs” and tried to curse them into jail!!!

  238. #238 Chris Noble
    September 24, 2007

    The errors that you reported from Duesberg paper are minor errors, because correcting them would not change the main conclusions of the paper.

    Huhh? Misrepresenting the literature is a minor error? Calling it an error is charitable. I call it deliberate deception. If Duesberg has real evidence to support his claims why does he resort to blatant lies?

    And therefore are you writing your post on these errors because you dont have anything to say about the major points that would be suggested by the authors, two of them being a) that standard ARV’s treatment accelerate AIDS, b) there is another way to treat AIDS patients, ?

    The “evidence” that Duesberg uses in his attempt to demonstrate that ARVs accelerate/cause AIDS consists entirely of misrepresenting “orthodox” studies. The very studies that Duesberg cites actually contradict his assertions.

    People are put on ARVs because they either have opportunistic infections or low CD4 counts. It is entirely fallacious to reason as Duesberg does that the ARVs cause the immune suppression. The immune suppression occurs before the ARVs. Unless the drugs have effects that travel back in time they cannot cause the immune suppression.

    If you used Duesberg’s ‘logic’ you could argue that insulin injections cause diabetes.

  239. #239 Epidemiology-LISA
    September 24, 2007

    Dr. Noble, If you’d care to read Duesberg’s paper he is so unscientific as to consider every AIDS case in the global stats an AIDS death whether the patient died or not. That is he geenrously counts all no-test clinical diagnoses of AIDS, all cases of CD counts below 200, and whatever elso goes into the WHO’s numbers, as an AIDS death. Certainly that’s going to artificially inflate the number of AIDS deaths globally, so how come you or the ghost smearer who critiqued the paper didn’t mention that?

    Dr. Noble, I don’t kno why Duesberg’s paper was rejected by two high ranking journals, though I might have a suspicion. Why haven’t any of your own effusions appeared anywhere outside obscure blogs?

  240. #240 DT
    September 24, 2007

    Noreen, you cite the following as reasons you are a rethinker:

    HIV has not been islolated in pure form

    What do you mean by pure? If like other “rethinkers” you keep moving the isolation goalposts whenever someone cites an HIV isolation study, then no-one will ever find HIV in its “pure” form. You could easily do the same for other viruses like hepatitis, or influenza, or herpes. Do these not exist either?
    If you think the countless EMs of HIV are not “pure” enough because there may be cellular contaminants in the samples, what is the next logical step? Answer – cloning of the virus. So this is done via bacterial plasmids, rendering the virus entirely free of cellular contaminants. This new HIV clone can productively infect new cells, undergoing further replication cycles producing new virions which under EM have identical ultrastructures to the original virus. The resultant viruses are neutralised by anti-HIV antibodies. Duesberg stated that this production of an infectious molecular clone of HIV was “the most rigorous isolation science has to offer for retroviruses”. This is a statement from the world’s foremost retroviral expert, remember? Still not pure enough for you? Then perhaps you would like to specify what you regard as “pure”, and I will make a prediction – whatever criteria you lay down for “pure” HIV, most other viruses will be rendered non-existent as well if the same standards are applied.

    There hasn’t been one study that proves HIV causes AIDS

    Many people here have shown you studies where infection directly results in immunodeficiency and AIDS-defining illnesses, more than sufficient to infer causality. These have been prospective clinical studies of exposed individuals (eg transfusion, needle stick), elegant animal studies showing profound immune changes in primates and SCID knockout mice, and laboratory studies showing the progressive immunological changes.
    The HIV test is for antibodies and not an actual virus How profound – all serological tests are for antibodies, and not the organism. Your point?

    Grade four events are real for HIV-Positives and so is liver disease, heart attacks, abnormal blood, anemia, buffalo humps, neuropathy, and diarrhea.

    No-one has tried to deny the sometimes severe side effects of medications (but rethinkers exaggerate these, and often lie about their incidence, causation and severity). Yes, severe side effects can occur. The fact that they do occur says nothing however about the existence of HIV or AIDS, in the same way as chemotherapy side effects do not prove leukemia is a lie, or that insulin hypoglycemia indicates diabetes does not exist. Straw man.

    Viral loads are only 6 to 8% accurate

    Not sure what this one means – do you have a reference? If you mean false positive PCRs occur, sure, this afflicts all PCR-based technology. But it is a lab “error”, and simply repeating the assay, or using a different recombinant technology like bDNA will eliminate the problem. It does not occur, as you imply, 92%-98% of the time. More like 1%. If you want an analogy – try pregnancy tests. These have a false positive/negative rate. Finding someone is false positive does not mean pregnancy does not exist. Tests are always repeated and false results are rapidly eliminated from the system.

    CD4′s are not the best yardstick for health

    I agree, but there is a clear correlation between declining CD4 levels and ill health. Even rethinkers think having low CD4s/white blood cells are bad for health. If they didn’t, why would they make such an issue of the fact that some of the ART drugs such as AZT can cause this, thereby “causing” AIDS. Here the Perth Group and Duesberg are in complete agreement Do you disagree with them? CD4s are a surrogate marker for cellular immune deficiency. They are not a perfect or ideal marker, but are a simply measured index. Functional T cell studies would be a better index, but who can afford $300 a pop for these?

    Gallo only found 40% of patients with HIV

    I am sure Chris Noble has addressed this before, refuting the figures you cite. Recall that lab technology has moved on a bit since 1983. Anyway, virus can be found in all AIDS patients using current techniques.
    http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=269529&blobtype=pdf

    Gallo was investigated for scientific misconduct

    Is this a variation of your “presidential pardon” fallacy? And was Gallo found guilty? Was it something that was meant to have any direct bearing on the existence of HIV? Was this bit about where he was meant to have “stolen” the virus from Montagnier? If so then you must accept that (a) HIV exists, and (b) HIV was isolated by Montagnier. How do you hold these 2 totally contradictory views in your head at the same time?

    Nancy Padian could not find one couple who the negative partner converted to HIV-Positive and the majority of AIDS cases are still predominately in the male population.

    Oh no, not again! Padian found no seroconversions over about a 9 month average in a group of serodiscordant couples who had already demonstrated their inability to transmit the virus to their partner in the preceeding years (in other words they were already pre-selected as poor “transmitters” of HIV by sexual contact. They were counselled about safe sex and had a high rate of condom use. Do you recall this virus is not highly infectious usually (as it is in a newly acquired seroconverter) and it only transmits itself on average 1 time in 500? Padian herself has rejected the rethinkers’ misinterpretation of her study. Why would you choose to believe what an unqualified rethinker concludes about a scientific study rather than what the scientific researcher herself says about her work. Is it because you want to disbelieve?
    So most AIDS patients are males (at least in the Western World). Is that really so surprising when we know that gay men are a prime risk group? What do you say about other sexually-transmitted infections that predominate in males (syphilis, hepatitis B)? Are they non-existent too? Are you so entrenched in your preconceptions about this matter that you cannot ask yourself for a moment what you would expect to find with infections of this nature?

    You say our math does not add up, but every time we patiently show the rethinkers that 2+2=4, you simply alter the question.

  241. #241 Epidemiology-LISA
    September 24, 2007

    Dr. Noble if Duesberg’s LTNPs irk you so, you are welcome to provide your own large cohorts of LTNPs consistently on early monotherapy to counter Duesberg’s (almost) drug free examples.

    You can start with your friend Mundt here, who came off so convincingly, but then unfortunately clammed up and disappeared just as he was about to become a scientific celebrity.
    http://medicine.plosjournals.org/perlserv/?request=read-response&doi=10.1371/journal.pmed.0040256#r1777

  242. #242 Chris Noble
    September 24, 2007

    Doesn’t look to me like he was trying to anything there eh Elkie and “Brad”?

    Do you think that comparing mortality in a cohort of people infected with HIV and CD4 counts less than 100 (50% less than 50) and estimates of people at all stages of HIV infection is valid?

    Duesberg blathers on about matched cohorts. Are the cohorts in this comparison matched? The patients in the Pallela study all had severe immune suppression. Duesberg compares this subgroup with all people worldwide with different lengths of HIV infection and different degrees of immune suppression. Honest comparison? Hardly.

    The Weekly Epidemiological Report that Duesberg cites actually gives 3 million for the estimate of mortality caused by HIV. Duesberg just can’t be honest about anything.

  243. #243 Chris Noble
    September 24, 2007

    Dr. Noble if Duesberg’s LTNPs irk you so, you are welcome to provide your own large cohorts of LTNPs consistently on early monotherapy to counter Duesberg’s (almost) drug free examples.

    What irk’s me is Duesberg’s deceptive presentation of the literature.

    LTNPs are not given antiretrovirals because they do not progress. Their CD4 counts do not fall to levels that are consistent with the recommendations for initiating ART. This is the direction of causality.

    a) lack of progression -> not given ART

    Duesberg abuses logic by arguing the reverse.

    b) not given ART -> lack of progession

    The same perverted logic could argue that insulin causes diabetes and ambulances cause road accidents.

  244. #244 Epidemiology-LISA
    September 24, 2007

    Dr. Noble Duesberg doesn’t claim there’s symmetry between the two “groups”, or that the comparisonis supposed to be taken as scietific proof. In fact he clearly states:

    But, in the absence of untreated control groups, the effects of the new anti-HIV drugs on the morbidity and mortality of HIV-positive recipients can not be determined
    scientifically from the results of these surveys.

    If you claim that Duesberg’s reference. . .

    However, the average annual AIDS mortality of all HIVpositives on this planet [including the minority that is on anti-HIV drugs (The Durban Declaration 2000)] can be
    estimated for 2000, the year that falls in between the two
    surveys, based on data provided by the WHO and the
    Durban Declaration: The WHO and the Declaration report
    in 2000 34×3 million “living with HIV”, and the WHO
    reports 471,451 AIDS cases for 2000 (World Health
    Organization 2001b) (obtained by subtracting the WHO’s
    cumulative total of 1999 from that of 2000is not correct

    …you have to come up with a quote and a reference of your own, didn’t you know? Perhaps it’s time you take your Atripla as well and get out of the house, do some gardening, Dr. Noble, because you are getting foggier by the minute.

  245. #245 Epidemiology-LISA
    September 24, 2007

    Ah I see so what you’re saying, Dr. Noble is, forst of all that you camn’t find LTNPs consistently on monotherapy, secondly that none of the drug free LTNPs hav had CD4 counts below the recommended ARV starting point? That’s a bold claim, Dr. Noble, especially since even the first of the two studies you reference imply that some of the subjects indeed had been on ARVs:

    “Cao Y, Quin L, Zhang L, Safrit J and Ho D D 1995 Virologic and Immunologic Characterization of Long-Term Survivors of Human Immunodeficiency Virus Type 1 Infection; N. Engl. J. Med. 332 201­208

    “Ten HIV-1-seropositive subjects from the New York metropolitan area were referred to us because they met our working definition of long-term survivors of HIV-1 infection: they had no symptoms, normal and stable CD4+ lymphocyte counts, no prolonged use of antiretroviral agents, and at least 12 years of infection

  246. #246 Chris Noble
    September 24, 2007

    Dr. Noble Duesberg doesn’t claim there’s symmetry between the two “groups”, or that the comparisonis supposed to be taken as scietific proof. In fact he clearly states:

    Why do you continue to come up with this bullshit? Duesberg argues that this comparison proves that antiretrovirals increase mortality.

    Contrary to these claims, the controlled trials and uncontrolled surveys listed above prove that anti-HIV drugs (possibly in conjunction with recreational drugs) increase the mortality of HIV positives 4- to 6fold. It would appear that anti-HIV drugs are prescriptions for, rather than treatments of AIDS.

    What does Duesberg mean by prove?

    ..you have to come up with a quote and a reference of your own, didn’t you know?

    (World Health Organization 2001b) “The HIV/AIDS epidemic continues to claim a large number of lives, with an estimated 3 million deaths during 2001.”

  247. #247 apy
    September 24, 2007

    How do you explain your high HIV viral load and low CD4 count prior to HAART, reduction of HIV viral load to 0 and increase in CD4 to 240 while on HAART, then after quitting your medications your HIV viral load shot straight back up to 100,000 and CD4s have been dropping continuously to about 80 (I think you said).

    Oh so simple Roy. During HAART she was taking frequent trips to the hospital. Remember, loneliness causes AIDS? At the hospital gets plenty of human-on-human interaction. Now she’s off HAART, doing her own thing, less interaction, the loneliness is killing her!

    IF YOU ALREADY ASSUME SOMETHING TO BE TRUE YOU CAN NOT CONFIRM ANYTHING, FOR YOU NEVER QUESTIONED THE PREMISE, and assumed it to be true from the get go, and were only looking for evidence to support your hypothesis

    Umm…Did you not attend middle school science class? You state hypothesis TO TEST them. That is the whole point.

    noreen:

    … the facts speak for themselves …

    You bet they do! Like these facts:
    noreen: I read this on Alive & Well
    Me: Noreen, do you get all of your info from denialist websites or do you actually verify what they say?
    You: I don’t goto denialist websites.
    Me: But you just said you do, and if I google what you wrote it comes up on Alive & Well and Virusmyth.
    You: I don’t go there, I come to all my conclusions on my own.
    Me: Then where did you get reference X? It only shows up on denialist websites.
    You:
    Me: Well?
    You:
    Me: 3rd time the charm?
    You:
    Me: Asking again….
    You: HIV doesn’t cause AIDS!

  248. #248 Epidemiology-LISA
    September 24, 2007

    Why do you continue to come up with this bullshit? Duesberg argues that this comparison proves that antiretrovirals increase mortality.

    Dr. Noble, didn’t I tell you to get some fresh air? Duesberg does not say THIS specific comparison proves his point. He says, “the controlled trials AND uncontrolled surveys listed above prove. . .” In other words the totality of examples examined, proves, by people like Franklin and Tara’s own conversion calculus for correlation and causation, that the drugs do more harm than good.

    “The HIV/AIDS epidemic continues to claim a large number of lives, with an estimated 3 million deaths during 2001.”

    It’s possible WHO estimates 3 million deaths during 2001, but Duesberg is talking about the actual numbers for 2000
    WHO reports 471,451 AIDS cases for 2000 (World Health Organization 2001b)(obtained by subtracting the WHO’s
    cumulative total of 1999 from that of 2000

    The blue Murchian skies are beckoning Dr. Noble so hurry up, don’t waste any more of your time in front of all those little jitterbugging letters and numbers on the screen.

  249. #249 noreen
    September 24, 2007

    Apy, you just don’t get it. I had many SYMPTOMS, that it the key to this not some unvalidated Antibody Test nor meaningless viral load test either. These tests are the problems with AIDS. If these test were no longer used then many of the AIDS cases would go away but we can’t have that now can we? We must keep them along with adding more diseases to the pot and let’s just add the statistics cumulatively too to make it look worse. Doesn’t it strike all of the supporters of AIDS that persons with high viral loads and low CD4′s are healthy? It would be obvious to a fifth-grader that this is faulty. The reason that many of us are healthy is because both of the above tests are not indicators of health and because we have good, health habits therefore no symptoms. If one cleans up their act, then AIDS will go away as many are proving this to be true in reality.

  250. #250 apy
    September 24, 2007

    Well, the nice part about the logic you have given is it makes you completely correct. Unfortunately I’m going to have to respond with the oh-so-witty retort: No noreen, you don’t get it.

    I have never argued your medical history, purely your complete lack of rational though and ignoring questions you don’t seem to be able to answer. Every time I post about how you completely contradict yourself and fail to explain your contradictions you only seem able to retort “I was an AIDS patient and I am healthy, therefore given my statistically significant self AIDS does not exist!” or some such equally stupid argument. Maybe instead of looking at who posted a comment, checking to see if is from jspreen, carter, cooler, or Michael and if not just giving the same tired routine you could actually read what people say and respond to that.

  251. #251 noreen
    September 24, 2007

    Apy, I am not goint to get into a pissing contest with you. It’s sounds like you just want to argue every point against the rethinkers. Some points may be valid on both sides of the fence but the bottom line should be who is surviving better, those on the antiretrovirals, those off of them and those on LDN? The proof in all of this is in the health of the patient. Do you wish to argue this too?

  252. #252 apy
    September 24, 2007

    Some points may be valid on both sides of the fence but the bottom line should be who is surviving better, those on the antiretrovirals, those off of them and those on LDN? The proof in all of this is in the health of the patient. Do you wish to argue this too?

    It depends on what your peer-reviewed studies say. Do you have links showing who is surviving better, those on ARV’s or those on LDN?

    It’s sounds like you just want to argue every point against the rethinkers.

    Yes, asking you to explain a question you refuse to answer about how you come to your conclusions is so very argumentative.

  253. #253 noreen
    September 24, 2007

    As of now, there is only one study currently being done and some earlier studies have been done by Dr. Bihari if you care to check out lowdosenaltrexone.org. One thing is for sure though, grade four events and other side effects do not occur with LDN and to me it is a no-brainer!

  254. #254 apy
    September 24, 2007

    As of now, there is only one study currently being done and some earlier studies have been done by Dr. Bihari if you care to check out lowdosenaltrexone.org.

    So what ‘facts’ are you referring to? So far I see one fact: you take LDN. You have no statistical evidence that it is keeping you healthy. Even if it is keeping you healthy you have no idea if it was due to combination with the ARV’s you had taken or if it is specific to a strain of HIV or when in the timeline of an AIDS/HIV sufferer to take it.

    My end point here is:
    Even on the best case that LDN is an AIDS wunderdrug, or even slightly better than what we currently have, you have no evidence that it does anything or when is the best time to take it or how to effectively use it.

    One thing is for sure though, grade four events and other side effects do not occur with LDN and to me it is a no-brainer!

    Do you get grade four events on Claritin? You might want to start taking that too. But seriously, that information is only beneficial if you can prove my questions above.

  255. #255 noreen
    September 24, 2007

    Apy, I am alive and breathing, if that isn’t evidence then what is? I was only on the antiretrovirals two months with LDN. For twenty months now, I have only been on LDN. I doubt very seriously that the antiretrovirals are having any effect on my health now. And LDN only has one, minor side effect, when first started it may cause sleeplessness in some. I did not experience this. How can you compare this drug to grade four events. It is one of the all-time safest drugs with a long-proven track record.

  256. #256 Adele
    September 24, 2007

    elisa says
    Duesberg is talking about the actual numbers for 2000

    ha ha! or like spreen says hi hi hi.
    Duesberg gets nothing right!!

    Not new AIDS cases in 2000
    Not actual number of new AIDS cases
    Not even the right number!!

    What Duesberg says, 2003, p. 400
    the WHO reports 471,451 AIDS cases for 2000

    No they don’t. This numbers the difference in cum. reported cases in 2000 and cum. reported in 1999. You can’t get total new cases for 2000 unless you know how many in reported cases died.

    Second thing is, this number is NOT all new aids cases 2000. IT’s just REPORTED cases of AIDS. If you think every single case of AIDS around world got reported in 2000 or 2001 or 2006 or whenever your very gullable!!

    There’s AIDS cases, ok, only
    SOME of them get diagnosed, ok, and only
    SOME of the diagnosed AIDS cases get reported. In some places maybe over 90%, in some countries its like 10%.

    OK, third things is, Duesberg didn’t even get the number right! He’s even worse than Noreen and Carter they can cut and paste even if they can’t admit where they got it!

    Duesberg says,
    471,451 AIDS cases
    but the WHO says
    an increase of 471 457
    (RELEVE EPIDEMIOLOGIQUE HEBDOMADAIRE, No 49, 7 DÉCEMBRE 2001)

    Who cares right I mean its not a big difference but it kinda lets you know how good Duesberg is at what he does. He can’t even copy a six digit number right sheesh!

  257. #257 apy
    September 24, 2007

    Noreen, I am alive and breathing too and I take LDO (low dose oatmeal) every morning. Am I to argue LDO is what is keeping me healthy? No! Just because LDN has a scientificy name doesn’t mean it is actually doing anything. You have no actual evidence that your situation is the direct result of the LDN. You have no control and you have no statistical evidence. I’m not sure why this is so difficult to get across but: something happening for you DOES NOT imply any statistical significants, at all. Again, I did not tell you to stop taking it, I did not say that it DOES NOT work, I stated that you have no evidence that it DOES work. There is a difference.

    Read what I posted again, I did NOT say that the ARV’s were still having an effect on your health, I stated that you have no proof that the overlap between them did not cause something else to happen that is helping you and you have no evidence that LDN alone is the cause of your health. The very point is that you are giving LDN all this praise but you don’t know if that is what is helping you. You complain and complain that HIV = AIDS is unscientific and pure dogma and has no proof nor a paper proving HIV causes AIDS but you are a complete hypocrite when you tell everyone the wonders of LDN when you don’t have any actual proof that it is doing anything. You don’t believe HIV causes AIDS? You think that because you are healthy on LDN that is the litmus test for its benefits? So what do you say to all those people that say “I am HIV+ and I have AIDS, therefore HIV causes AIDS”. Is your solitary opinion all the more meaningful than theirs?

    How can you compare this drug to grade four events. It is one of the all-time safest drugs with a long-proven track record.

    Read what I said again, I did not compare this drug to grade four events. I said that LDN not causing grade four events is completely useless bit of news unless LDN is actually proven to be helpful to an AIDS patient.

  258. #258 Braganza
    September 24, 2007

    Dear Apy,

    Naltrexone inhibit NF-kappaB, which is know to enhance virus expression. Others drugs systems have been proposed to treat AIDS using this pathway (see for example US Patent 6514955).

    It looks that are far lower secondary effects on LDNaltrexone than to any ARV’s.

    I understand that Noreen wants to say that she can control the likeliness to progress to AIDS by inhibiting NF- kappaB, this sounds logic and there is no need to make fun of her.

    Bt the way the US patent 6514955 has been writen by a professor of pharmacology, who wrote the chapter on antiretrovirals in a standard pharmacology university textbook, so you could have a look to the patent to understand the argument better.

  259. #259 apy
    September 24, 2007

    I am not making fun of her. There is a world of difference between “likeliness” of working and “actually” working in a real world biological system. Even if it theoretically should work like a charm, that in no way proves that something in any way is going to actually work. But that is not what noreen is doing. She is saying LDN works, even with no proof that it actually works besides that she feels healthy.

  260. #260 Mr. Natural
    September 24, 2007

    Aids questioner “cooler” is a “Ron Paul boy”??!!!

    Is it your job to spot out the political contradictions of denialism luv?

    Keep up the good work, Adele, I’m beginning to understand now.

    If a libertarian and a liberal question Aids, they are both obliged to get their differing political positions aligned before they post here.

  261. #261 Epidemiology-Lisa
    September 24, 2007

    Ah I see Adele, So if there were a cumulative 34 million AIDS cases last year, but 34 million die we’re left with million cumulative AIDS cases, right? So how many cumulative AIDS cases are there in the US stats today?

  262. #262 Epidemiology-LISA
    September 24, 2007

    Oops one more time:

    So if there were a cumulative 34 million AIDS cases last year, but 34 million die we’re left with ZERO cumulative AIDS cases, right?

  263. #263 Mr. Natural
    September 24, 2007

    “I am glad that Mark Wainberg raised the issue about whether the Constitution should be changed to stop medical endangerment.”

    Wow, someone here’s been finally honest enough to just come out and say it.

    That’s all it takes for you, hysterical Elkie, the mystical term _medical endangerment_ which of course is a term that has a precise and rigorous definition, right, mister let’s-just-turn-our decisions-about-our-bodies-over-to-the-authorities because, surely as they’re now showing us every day they know best …

  264. #264 jspreen
    September 24, 2007

    noreen: I read this on Alive & Well
    apy: Noreen, do you get all of your info from denialist websites or do you actually verify what they say?
    noreen: I don’t goto denialist websites.

    Now what kind of bullshit is that, apy ? Where do you get your information from? And then, once you’ve got your information, do you verify that it’s all true?
    Yes? OK, then how in the world can you verify that something is definitely true? Do you go to the end of questioning? You do? But there is no end to questioning. Always, long before you can get somewhere near the end of questioning, you stop questioning, because you think you’ve got all the answers. And why do you think that? Because the three billion questions you don’t ask, they don’t occur to you because they are answered by what you already firmly believe in before you started to question.

    Really, it’s a mystery to me why you folks try so hard to make Noreen doubt and are so eager to steer her back into the hell of the fear of HIV and Aids. Really, I don’t get it man.

  265. #265 Adele
    September 24, 2007

    DR. Mark “Natural” says

    If a libertarian and a liberal question Aids, they are both obliged to get their differing political positions aligned before they post here.

    of course not “luv”!! Just see these nutso militia black helicopter ron paul guys got their own reasons for questioning AIDS that’re alot different from say a gay man in New York whose got HIV who questions AIDS bc he’s dealing with his health issues a really common way by denying them.

    See theres lots of people around the ron pauls and other freaks who don’t like gay men and don’t want them to be healthy and don’t want their precioussss tax $$ used on anything that might include gay people not dying and that’s why they question AIDS.

    But I bet you like carters new lord and savior to. Henry Buaer the man who said we should take away free speech for gay people so they don’t spread look it up on aids truth.

    I think it’s very difficult to draw a line between free speech about civil rights for gays and the tendency for the life-style to be presented as something that it would be perfectly all right for anyone to choose.

    You’re a rethinker for your health? OK, I respect it, like Noreen. You don’t know what your talking about but that’s your choice. So why do you get all luvy with Duesberg and Bauer after all the stuff they’ve said? Would you take a word of that crap from a HIV scientisT?

  266. #266 Mr. Natural
    September 24, 2007

    “‘Rethinkers’ make money from the vulnerable people they exploit; their propaganda could be, but often is not, restricted under commercial speech regulations.’

    So now your sounding like a quackbuster eh, Elkie. I’m sure you must be quite proud that natural healers that have cured cancer but violated the “standard medical practice laws” get hard time in prison.

    You’re blathering on about this medical endangerment but what about the 100,000 plus every year who die from iatrogenic medicine?

  267. #267 noreen
    September 24, 2007

    Apy, so what do you attribute my good fortunate too, luck? I don’t believe so. Common sense would dictate that all the good, positive influences in my life would be the answer, including LDN. Do you not believe Dr. Bahari’s success with treating AIDS patients with LDN or is your mind so closed that you will not accept anything but antiretrovirals?

    So my viral load of >100,000, the limit of where mine is tested it could be much higher, has spontaneously mutated to a harmless variety of HIV. Which is it Apy, harmless HIV or other factors are keeping it at bay?

  268. #268 apy
    September 24, 2007

    jspreen,
    I really cannot follow what you are attempting to say here. If someone states that a paper makes a certain claim, are you suggesting that is no way to verify that the paper actually makes the statement? It may take more work to verify that what the paper claims actually happens repeatably, but reading a paper is not some metaphysical intangible action requires a deep spiritual connection in order to experience. Note, my statement to noreen did not ask if she knew the content of the paper is true, but asked if she verified what the website states it claimed.

  269. #269 Mr. Natural
    September 24, 2007

    “No, Carter, AZT’s side effects are not indistinguishable from AIDS. That’s just another Duesberg distortion.”

    Elkie darling, perhaps you can clear this up for us on the biochemical level. How Duesberg has distorted the biochemical argument in Inventing the AIDS Virus, and of course, you’re stinging rebuttal.

    And Adele, who’s an expert on polymerase enzymes, can explain the technical terms for us.

  270. #270 Adele
    September 24, 2007

    thanks tony-lisa, man I deserved it!!

    Cumulative is cumulative doesn’t change with death, dumb me.

    So Duesberg number was diff in cum. reported 2000 minus cum. reported 1999 and that should be total reported 2000.

    It’s still not right this is the “Actual number” of AIDS in 2000 or “Actual number” of new AIDS cases in 2000 its just the ones that got reported a minority.

    AND Duesberg still didn’t copy the number right.

    Deniosaurs I’ll admit it when I make a mistake and I hope you tell me when I do. Why doesn’t Duesberg?

  271. #271 jspreen
    September 24, 2007

    AIDS denialism–in many cases, in my opinion should be. “Rethinkers” make money from the vulnerable people they exploit; their propaganda could be, but often is not, restricted under commercial speech regulations.

    What are you talking about, ElkMountainMan? …Vulnerable people they exploit…
    But it’s the other way around, yo dummy. The vulnerable people are those who swallow main stream propaganda hook, line and sinker with their dusty brain on zero activity. Anyone listening to a rethinker, can only do so if he found the use of his own brain again, after having cleaned up the dust.

    The I_saw_it_on_TV_so_it’s_true hillbillies, there are your vulnerable people. Don’t worry about rethinkers me boy, they don’t need speech regulations at all, they can sort out the information quite well for themselves.

  272. #272 jspreen
    September 24, 2007

    Note, my statement to noreen did not ask if she knew the content of the paper is true, but asked if she verified what the website states it claimed.

    Ok, I got you wrong. But do you really want to stop that close from the beginning?

  273. #273 apy
    September 24, 2007

    so what do you attribute my good fortunate too, luck?

    I’m not foolish enough to contribute your good fortune to anything, I’m clearly stating that we don’t know what it is and it’s important to find out so we can reproduce it.

    Do you not believe Dr. Bahari’s success with treating AIDS patients with LDN or is your mind so closed that you will not accept anything but antiretrovirals?

    What successes? You said we don’t have any studies completed and you only know of one study in the works. Does Bahari have a control group? Has he submitted his paper to any journals? Gotten it peer reviewed? Gotten any form of review on it? Have you given his work the thorough due-diligence that you give Alive & Well’s claims about Amy Justice? What do you want me to say here noreen? You have proven yourself completely incapable of verifying any fact you report to us. Short memory? Let’s not forget your “Clinton pardoned Gallo” miss and your complete miss on Amy Justice. What am I supposed to think here? Oh noreen made a few minor mistakes in the past but I’ll take her word this time? Not a chance.

    So my viral load of >100,000, the limit of where mine is tested it could be much higher, has spontaneously mutated to a harmless variety of HIV. Which is it Apy, harmless HIV or other factors are keeping it at bay?

    Again, I don’t know! That is why I’m suggesting some work be done to determine it. But sitting around telling everyone here that questions what you say that HIV doesn’t cause AIDS because there is no paper that proves it and then telling them that LDN helps AIDS patients when there are absolutely no studies on it in regards to AIDS is not consistent or rational.

  274. #274 apy
    September 24, 2007

    jspreen

    Ok, I got you wrong. But do you really want to stop that close from the beginning?

    What is your point? If noreen can’t even verify a fact one degree of separation away how do you expect her to verify an entire story?

  275. #275 Adele
    September 24, 2007

    apy and noreen,

    i just made a mistake too. I didn’t read something right and tony-lisa caught me. He was right on that one but I was right and Duesberg was wrong on the other two. I admitted my mistake.

    Noreen admitted she mistook the thing about the Clinton pardon. She read it somewhere on the net didn’t confirm it.

    I don’t remember did Noreen say anything ever about Amy Justice? Maybe because she doesn’t know enough about amy justice work to say one way or the other. So she just copies virusmyth or someone what they say about Amy Justice. But you can’t admit your wrong on that one, noreen because its so important to your beliefs. Amy Justice was the one proved protease inhibitors kill most AIDS patients right? WEll she never said that and her work dosen’t support it its just what you WANT to believe. But the good thing about only reading virusmyth is you don’t have to admit your wrong. ever!! As far as you know maybe Amy Justice did say those things!

  276. #276 Adele
    September 24, 2007

    sorry I meant did noreen ever admit she was wrong about Amy Justice?

  277. #277 noreen
    September 24, 2007

    I believe that the info on Justice was from a university site. Dr. Bahari has results posted on the LDN site if you will go to it. I would suggest that you contact Dr. Zagon, listed on the site, he is the brillant researcher, who discovered the use of LDN for immune-compromised individuals. Currently, Dr. Gluck is the moderator for the site and you can contact him or Dr. Bahari’s assistant as the good doctor Bahari is retired due to an injury. If you really want to learn about LDN, you can go to the conference next month and get some info straight from the horse’s mouth so to speak.

  278. #278 apy
    September 24, 2007

    I believe that the info on Justice was from a university site.

    Could you find that site again please?

  279. #279 apy
    September 24, 2007

    I checked the archive. noreen originally gives:

    http://www.whatisaids.com/wwwboard/messages/109.html

    as her source of info on Amy Justice. After Adele shows what Dr Justice’s papers really say she retorts with “It was on a university website too, Alive & Well is just the first one I came across”. This response has several holes in it. One being, how do you know it’s on a university site but can’t provide the link, just a vague reference to it? How do you know it’s on a university website but use the Alive & Well one anyways, since many people here obviously take A&W with a grain of salt? And finally, why does it not show up on any university websites when you google it?

  280. #280 Epidemiology-LISA
    September 24, 2007

    Adele, Of course I can accept you misread or got confused and leave it at that without questioning your general ability to read and understand. It happens to everybody here all the time (yes even to Chris Noble). The sad thing is precisely that in this atmosphere one has to be afraid of admitting it.
    http://scienceblogs.com/aetiology/2007/09/loneliness_causes_aids_claims.php#comment-577733

    Nobody jumped on you for it and nobody will compare that with the barrage fom different(?) people like Brad, ElkMountainMan, Shalini, Noble who all wanted to join in the massacre when they thought they’d caught me/Duesberg above. . . And by the way, Duesberg clearly DID get the Canadian study wrong taking the mortality at 28 months as if it were 12. I have no problems admitting that.

  281. #281 Chris Noble
    September 24, 2007

    Dr. Noble, didn’t I tell you to get some fresh air? Duesberg does not say THIS specific comparison proves his point. He says, “the controlled trials AND uncontrolled surveys listed above prove. . .” In other words the totality of examples examined, proves, by people like Franklin and Tara’s own conversion calculus for correlation and causation, that the drugs do more harm than good.

    Stop playing silly wordgames. No matter how much you twist and turn it is not possible to honestly draw the conclusions that Duesberg makes from the data he presents. No matter how you reinterpret the scriptures Duesberg does make the comparison between the mortality of patients with low CD4 counts on HAART and those with higher CD4 counts.

    The studies by Margaret Fischl do not support his conclusion. In fact they reefute it. The Concorde trial also demonstrates that AZT does not cause AIDS. The delayed group still progressed to AIDS despite not taking AZT. That leaves the studies by Palella et al and Hogg et al and Duesberg’s fanciful calculation from global estimates.

    Nothing in the data that Duesberg presents allows him to draw the conclusion that ARVs cause AIDS.

  282. #282 noreen Martin - the rock
    September 24, 2007

    The body.com has several article about Amy Justice, which was probably one of the sources where I saw it. I do not frequent most rethinkers sites because if you check them, you will find that there is not much new information on them. I prefer university sites, normal AIDS sites and AIDS support groups, which tend to have a wealth of info.

  283. #283 ElkMountainMan
    September 24, 2007

    Epidemiology-Lisa,

    Despite your accusing me and others of a figurative massacre, I do appreciate your comment. On a science blog, everyone will make a mistake some time, as you have correctly observed. We should all be able to admit our own mistakes.

    Duesberg doesn’t make mistakes on blogs, he makes mistakes in the scientific literature. But Duesberg’s “mistakes” are sometimes more than mistakes. The one Brad “barraged” you about is one of them.

    I’m not sure you fully understand the blatant way Duesberg lied in this example. Going back to the Journal of Biosci 2003 paper, Duesberg wrote this:

    The largest and most influential of these surveys was
    conducted by Palella et al (1998) who investigated in
    1998 1255 anti-HIV drug-treated “patients, each of which
    had at least one CD4+ count below 100″ from nine clinics
    in the US. However, all of these “patients” were
    “nonhospitalized”, AIDS-free subjects. “Patients with a
    diagnosis of cytomegalovirus retinitis or M. aviarum
    complex disease before study entry or during the first 30
    days of follow-up and patients with active P. carinii
    pneumonia at the beginning of follow-up were excluded.”

    Duesberg’s crystal clear point: the patients weren’t “patients” until they were exposed to ARVs.

    Brad showed us via AIDS Truth that this is a lie. Epidemiology-Lisa, please read the Palella, FJ, et al article in the NEJM, 1998. The title is “Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV Outpatient Study Investigators.” When you read the paper, you’ll notice a few things about the 1255 people with AIDS:

    They are not all “anti-HIV drug-treated” (Duesberg says they are)
    They are not all healthy (Duesberg says they are)
    No one was excluded from the study because of having an OI (Duesberg says they are)
    And to say every sick person was excluded at the start of the study Duesberg has to doctor the methods section. He alters a sentence from the paper in the time-honored tradition of:

    A: “I like to think that Nazis will never get power again.”
    B: ‘A’ has shown a clear preference for far-right politics, commenting, “I like…Nazis.”

    Epidemiology-Lisa, do you deny Duesberg’s manipulation? Do you think there is any way to explain it other than deception?

    Of course, I can understand Duesberg’s urge to vandalize the article. Palella et al was very, very bad news for Duesberg’s drugs=AIDS theory:
    The highest mortality rate is for patients who don’t take any ARVs. The next-highest is in monotherapy patients. The more drugs in the combination, the better the patients’ rates. That’s true for morbidity, too. Patients on combinations had lowest OIs.

    There’s so much more that’s wrong with Duesberg’s analysis, but I’ll leave some for someone else. E-Lisa, can you recognize what Duesberg did?

  284. #284 Michael
    September 24, 2007

    Wall Street Journal
    AIDS Effort Suffers Big Blow
    As Merck Vaccine Fails
    By MARILYN CHASE and MARK SCHOOFS
    September 22, 2007; Page A2

    In a major setback, one of the leading experimental AIDS vaccines not only failed to prevent test subjects from becoming infected with HIV, but it didn’t offer any indication it might delay the onset of full-blown AIDS,
    which had been a key hope.

    The collapse of the trial leaves Merck & Co., which had spent a decade developing the vaccine, with no remaining prospects in the global hunt for an AIDS immunization. The vaccine was tested in a network funded by the National Institutes of Health.

    “We’ve been kicked in the teeth,” said Bruce Walker,….

    (well you didn’t listen when we dissidents kicked you in the ass, maybe a kick in the teeth will help you pay closer attention)

    ….a veteran AIDS researcher at Harvard University who wasn’t involved in the study. Lawrence Corey, a leader of the NIH-funded HIV Vaccine Trials Network, said he was “mourning.”

    (So am I, mourning all of the people you morons already scared and poisoned to death)

    The results are particularly disappointing because it is widely agreed that only a vaccine could end the epidemic (of scaring and poisoning people to death. Last year, more than four million people world-wide contracted (no, dummy, they were falsely diagnosed as having contracted) HIV, the virus that (only fools still believe in this slogan) causes AIDS, and nearly three million died, according to United Nations estimates. Almost 40 million people are currently living with (a faulty diagnosis of) HIV.

    But researchers cautioned against overreacting. Merck’s vaccine is one of many in or heading into clinical trials, (oh Gawd, here we go again) and different types of vaccines are known to stimulate different kinds of immunity. For example, an experimental immunization now in human trials that was developed by the HIV Vaccine Research Center of the NIH had shown more-promising results in monkey trials than did the Merck vaccine.

    “It isn’t the end of the line,” said Mitchell Warren, (as long as taxpayers keep throwing money at these morons) executive director of the AIDS Vaccine Advocacy Coalition, a New York group advocating prevention. Merck’s data “aren’t the answers we wanted, but they will help
    improve our other vaccine candidates.”

    Tuesday, the trial was stopped early by independent overseers known as the Data & Safety Monitoring Board. Comparing two groups — those who received the vaccine and those who received a placebo — the overseers determined
    there was virtually no statistical difference in infection rates between them, indicating the vaccine wasn’t working. Also, the amount of HIV (mistakenly believed to be) in the blood of those who did get infected, a (false) predictor of how fast a person will get full-blown AIDS, was virtually the same in each group.

    The ultimate fear among researchers is that the whole theory underlying the Merck vaccine might be flawed, which, if true, could doom an entire class of experimental vaccines.

    (No duhhh! Of course the ENTIRE theory underlying HIV and HIV vaccines is flawed. But these fools will need a few more lifetimes to figure that out. Maybe if they had an actual virus that was doing something to Tcells, they might be able to create a real vaccine.)

    Most classical vaccines, such as those against smallpox or polio, stimulate the body to produce antibodies that ward off infection. (but of course, that requires there to be a real virus to begin with, instead of just finding biomarkers that are believed to have something to do with the imaginary virus) But stimulating antibodies that neutralize a broad range of HIV strains has been notoriously difficult (because there is no actual virus, just biomarkers), so researchers focused on the other arm of the immune system: killer T-cells, which attack and kill cells that HIV has already infected. Such vaccines have been considered less likely to prevent someone from getting infected; instead, it was hoped they would enable an infected person to suppress the virus and so delay, perhaps for many years, the onset of disease.

    “Given that this study was the leading edge” of research on T-cell based HIV vaccines, said Mark Feinberg, vice president for medical affairs and health policy in Merck’s vaccine division, “there was great disappointment.”

    “There is nothing on the horizon” at Merck, he said. “We don’t have any other vaccine candidates we’ve identified as promising enough to advance into clinical studies.” Dr. Feinberg added that Merck is “committed to finding ways to share information accumulated over two decades to
    facilitate the broader effort” to develop an AIDS vaccine.

    The Merck vaccine did stimulate the immune system’s T-cells — a notable development — but not in a way that helped infected test subjects control the virus. Now, researchers will try to figure out why.

    (more evidence HIV has nothing AT ALL to do with t cells)

    Merck’s shares, reflecting downplayed hopes that such an early vaccine would work, were up 44 cents to $51.82 at 4 p.m. Friday in New York Stock
    Exchange composite trading.

  285. #285 Epidemiology-LISA
    September 24, 2007

    Noble and Elkman

    Duesberg’s contention is not that ARVs cause AIDS, but that Drugs, ARVs being among them, cause AIDS.

    Duesberg didn’t need the Palella study of thenew les toxic drugs; he could simply have sstuck with the ca. 30% mortality given for monotherapy. Even dr. Noble’s new improved 3 million AIDS deaths a year wouldn’t bring us near that figure.

    “RETROVIR (ZIDOVUDINE) MAY BE ASSOCIATED WITH SEVERE HEMATOLOGIC TOXICITY INCLUDING GRANULOCYTOPENIA AND SEVERE ANEMIA PARTICULARLY IN PATIENTS WITH ADVANCED HIV DISEASE (SEE WARNINGS). PROLONGED USE OF RETROVIR HAS ALSO BEEN ASSOCIATED WITH SYMPTOMATIC MYOPATHY SIMILAR TO THAT PRODUCED BY HUMAN IMMUNODEFICIENCY VIRUS.” (Glaxo Wellcome)

  286. #286 Dan
    September 25, 2007

    Michael,

    the “vaccine” folks are pretty desperate at this point it seems.

    Think about it. First, they’re dealing with something utterly illogical. They’re trying to get an immune system to produce…what…? ANTIBODIES! Antibodies to….what…? HIV!!

    How do we find out if somebody’s (so-called) “HIV positive”? We find…(drum roll, please)…”HIV ANTIBODIES”!

    So, the purpose of a vaccine is to help produce…um…oh, yeah…HIV ANTIBODIES. Which, oddly enough, those who’ve been proclaimed “HIV positive” supposedly possess!

    Here’s where their desperation kicks in. The AIDS goons (your various and sundry “researchers”), having already set aside the illogic and futility of their undertaking, have gone the extra step in the HIV/AIDS folklore to include the incredible (literally) mutating power of “HIV” into their vaccine equation. It’s a way to sidestep the original illogical premise. Good thing these guys get paid, regardless of what idiots they are.

  287. #287 Chris Noble
    September 25, 2007

    Duesberg didn’t need the Palella study of thenew les toxic drugs; he could simply have sstuck with the ca. 30% mortality given for monotherapy. Even dr. Noble’s new improved 3 million AIDS deaths a year wouldn’t bring us near that figure.

    Are you trying to claim that people were not dying before AZT?

    The Fischl studies showed that AZT monotherapy had a pronounced short term benefit. The placebo arm had much higher mortality than anything that Duesberg can come up with. This is what was expected for people once their CD4 counts had fallen below 100 and had gotten opportunistic infections.

    “RETROVIR (ZIDOVUDINE) MAY BE ASSOCIATED WITH SEVERE HEMATOLOGIC TOXICITY INCLUDING GRANULOCYTOPENIA AND SEVERE ANEMIA PARTICULARLY IN PATIENTS WITH ADVANCED HIV DISEASE (SEE WARNINGS). PROLONGED USE OF RETROVIR HAS ALSO BEEN ASSOCIATED WITH SYMPTOMATIC MYOPATHY SIMILAR TO THAT PRODUCED BY HUMAN IMMUNODEFICIENCY VIRUS.” (Glaxo Wellcome)

    Which no matter how you spin it does not say that AZT causes AIDS.

    Look at the data from the Concorde study. If AZT is as toxic as Duesberg would have us believe then you would expect much higher incidence of AIDS and mortality in the immediate arm that received much more AZT than the delayed arm. In reality there was no statistically significant difference between the immediate arm and the delayed arm.

    Duesberg has nothing but spin. He has no evidence to support his claims. He is so desperate that he distorts, misrepresents and lies.

  288. #288 ElkMountainMan
    September 25, 2007

    Epidemiology-Lisa, I want to thank you for responding to the Duesberg criticism. You are the only person here who has done that. I think you’re wrong, but you get some praise from me for trying. You wrote that,

    Duesberg’s contention is not that ARVs cause AIDS, but that Drugs, ARVs being among them, cause AIDS.

    No, Duesberg’s contention IS that ARVs cause AIDS, AND that other drugs can also cause AIDS, AND that malnutrition can cause AIDS. For Duesberg AIDS is caused by one or more of the three factors in the title of his 2003 “review”: “The Chemical Bases of the Various AIDS Epidemics: recreational drugs, antiviral chemotherapy and malnutrition”

    In that review, Duesberg has some general comments about toxicity of antiretroviral drugs and a few quotes from Jay Levy, de Harven, and the Durban Declaration, but his entire literature-based argument against anti-HIV combination therapy (not AZT monotherapy) is his comments on Palella and Hogg:
    “the evidence for ‘declining morbidity and mortality’ is only based on uncontrolled survey studies that investigated how long HIV-positive, clinically healthy subjects, but mostly from AIDS risk groups, survived on various anti-HIV drugs. The largest and most influential of these surveys was conducted by Palella et al (1998).” From page 399 of the 2003 review.

    Epidemiology-Lisa, Duesberg says that all study participants in the Palella study were healthy before taking antiviral therapy and that they were selected for their health; by changing a quote from the paper, Duesberg says that study participants with OIs before the start of the study or within 30 days of follow-up “were excluded.”

    In other words, Epidemiology, Duesberg takes your concern into account. If AIDS-related health issues were caused by recreational drugs in these patients, they “were excluded” from the study. Duesberg emphasizes this so he can claim that ARVs increase mortality far above what he says is the rate in untreated populations.

    His rate in untreated populations is an absurd hypothetical. He gives the impression of being generous by assuming all new AIDS cases for 2000 result in immediate death. But all new AIDS cases for Duesberg are actually all reported newly-diagnosed AIDS cases, a small fraction of total new AIDS cases. Chris didn’t just make up that 3 million figure, Epidemiology-Lisa, it’s all over the WHO report Duesberg uses. Duesberg had to dig through that report to find a much smaller figure to misrepresent, ignoring 3 million the whole time.

    The lies (or whatever you like to call them) needed to support Duesberg’s claim:
    1)all participants in Palella et al were on anti-HIV drugs (they weren’t, and the highest mortality was in the no-drug population, many times the rate for ARVs per 100 person-years)
    2)Palella et al excluded anyone with OIs (they didn’t, they included everyone in the mortality figures)
    3)a total mortality rate from Hogg et al was represented as a per hundred person-year rate
    4)Duesberg suppressed the WHO estimate of 2000 mortality in favor of using a reported AIDS case figure and a strange hypothetical of his own

    Palella et al find mortality of no-ARV patients usually between 40 and 50 per 100 person years. Compare that with your 30% figure for AZT monotherapy. And Epidemiology, please tell me you are not doing math with Chris Noble’s “new and improved” 3 million and the total HIV estimates for 2000. To compare the Palella et al finding (that includes deaths from patients not taking ARVs) with worldwide rates, you would have to consider the group of world wide HIV-positive people alive at the beginning of 2000 who had CD4+ T-cell counts below 100 and find out how many of them died in 2000. Without some good estimates of these numbers, there’s no comparison to make.

    Best to stick with what the Palella paper found: a no-ARV mortality 7 or 8 times higher than mortality with combination therapy, and higher than AZT monotherapy.

  289. #289 Epidemiology-LISA
    September 25, 2007

    a no-ARV mortality 7 or 8 times higher than mortality with combination therapy, and higher than AZT monotherapy

    Elk,

    The whole point of comparing with the global figures was that there are no controlled studies of the efficacy of the drugs. Now you tell me Palella is such a controlled study with an AZT group, a combination therapy group and a no-drug group. I must admit that’s some cheek if Duesberg says there are no controlled studies, then in the next sentence introduces one pretending it’s not controlled. Perhaps you can elaborate?

    The patients were “clinically healthy”, but most were from “AIDS risk groups”. What I meant by saying drugs, ARVs being among those, cause AIDS is you cannot just pretend that you have squeaky clean, matched group(s) who are then given drugs. They have all had different histories up to then, often involving other drug use, legal and presciption, which places them in the AIDS risk groups.

    Which no matter how you spin it does not say that AZT causes AIDS

    Dr. Noble, no matter how you spin it, if a patient is HIV positive and starts wasting (myopathy) or develops granulocytopenia, I think you’ll find chances are the good doc is going to call it “AIDS”.

  290. #290 noreen
    September 25, 2007

    John Edwards just promised 50 million to go towards HIV/AIDS worldwide. His plans would include health care, housing, medicare benefits, which is a good idea if elected. Certainly, all other candidates will follow suit and be politically correct. Nevertheless, how much will be handed over to the NIH to go waste on another failed attempt for a vaccine. I would love to be a fly on the wall years from now and listen to all the criticisms of our current, scientific community who won’t challenge the HIV hypothesis. In regards to Duesberg, no one is 100% right all of the time but he is on the right track, which is more important.

  291. #291 Chris Noble
    September 25, 2007

    Dr. Noble, no matter how you spin it, if a patient is HIV positive and starts wasting (myopathy) or develops granulocytopenia, I think you’ll find chances are the good doc is going to call it “AIDS”.

    Try again. Spin harder. It doesn’t cause AIDS.

    The drug companies are obliged to include all side effects that occur during treatment whether they are caused by the drug or not. Note the word “associated”.

    If you read the actual insert you would find that 1.6% of people on placebo reported granulocytopenia compared to 1.8% on AZT.

  292. #292 Chris Noble
    September 25, 2007

    I must admit that’s some cheek if Duesberg says there are no controlled studies, then in the next sentence introduces one pretending it’s not controlled. Perhaps you can elaborate?

    Have you read the study yet?

    You are showing a high degree of devotion to Duesberg if you are so keen to defend him when you haven’t even read the papers.

  293. #293 Chris Noble
    September 25, 2007

    Duesberg does some very dodgy statistics to come up with his figure of 1.4% mortality in HIV infected people worldwide.

    In reality there are many studies that have looked at the natural history of HIV infection.

    An HIV-1 natural history cohort and survival times in rural Uganda.

    The figure from this study is 159 per 1000 py or about ten times Duesberg’s “estimate”.

    You are welcome to search the literature for other studies like this one. Tell us what you find.

  294. #294 noreen
    September 25, 2007

    Some ridicule Michael’s comments on stress etc. leading to AIDS. How about this article title from The Daily Telegraph, “Ancient Snakebit Treatment Has HIV Hopes.” Apparently, a chinese herb used for treating snakebites is showing promising results for AIDS. This research also involved collaboration with the National Cancer Institute and the Division of Pharmacology at Uppsala University in Sweden. Now, if a rethinker had stated this, it would be a front page story here and the rethinker would be attacked.

  295. #295 Epidemiology-LISA
    September 25, 2007

    Summary. It was the objective of this study to document and evaluate AZT-induced short-term toxicity in healthy individuals. The study was designed as a longitudinal monocentric side-effect monitoring study with prospective data collection. It was carried out at the Cologne University Hospital. The study population comprised health care workers who were taking AZT prophylaxis after accidental exposure to HIV-infected blood. Fourteen individuals were included into the study; seven of them discontinued treatment prematurely, five due to severe subjective symptoms. In case of one worker AZT had to be stopped due to severe neutropenia (800 cells /l) with signs of upper respiratory tract infection. Four of 11 individuals taking AZT for at least 4 weeks developed neutropenia (2 WHO I, 1 WHO II, 1 WHO III). All other laboratory parameters stayed within normal range. In particular, no anemia was observed. In conclusion: Compared with other studies more neutropenias are observed. Due to side effects 50% of the workers discontinued AZT administration prematurely. The data presented herein show that AZT causes considerable side effects which must be weighed against the potential protective antiviral effect.

    http://www.springerlink.com/content/w0621602w1114747/

  296. #296 apy
    September 25, 2007

    Now, if a rethinker had stated this, it would be a front page story here and the rethinker would be attacked.

    Perhaps you haven’t been paying attention for the last half decade at least? The pharma companies have been prospecting everything from animals to plants to ocean life for new sources of drugs. This is nothing novel. Your statement misses the problem with your ‘rethinker’ attitude. Your quote states “treatment for snakebite shows promise”. But when you talk about LDN you don’t say it shows promise, you say it works and you are the proof, even though you lack any significant evidence. Notice the difference? Make use of it in the future.

  297. #297 noreen
    September 25, 2007

    Actually, Dr. Bahari has had success with LDN or haven’t you bothered to research this. Or have you checked into patent number 518873 from the U.S. Patent office, where Dr. Kaali and Dr. Lyman used electrical current to suppress HIV for the believers.

  298. #298 noreen
    September 25, 2007

    Here is an interesting link if anyone is interested in learning about bioelectric medicine.

    mehttp://educate-mehttp://educate- yourself.org/cn/LymanKaalibiocompatibleHIV1996report18nov06shtmldicine

  299. #299 Epidemiology-LISA
    September 25, 2007

    Perhaps you haven’t been paying attention for the last half decade at least? The pharma companies have been prospecting everything from animals to plants to ocean life for new sources of drugs

    They are prospecting for profit, that’s why it’s repeatedly being hammered home there is no “natural” herbal or nutritional cure for AIDS, and why they would have to make a headline and a witch hunt of it every time something “alternative” turns up. Here is the essence of the idea taken from the Chinese Viola:

    “it may be that we can use the lessons of nature to create synthetic drug designs [wich requires the resources of big pharma and is 100% patentable] to help people with the virus.”

  300. #300 Adele
    September 25, 2007

    chris said
    The figure from this study is 159 per 1000 py or about ten times Duesberg’s “estimate”.

    Yeah and that’s all HIV+. What do you think it’d be if it was just AIDS patients CD4 lower than a hundred??

  301. #301 apy
    September 25, 2007

    Actually, Dr. Bahari has had success with LDN or haven’t you bothered to research this.

    Then it “shows promise”, it is not a treatment. Which is why I said in the previous posts you apparently didn’t read: studies should be done on it so if it is truly useful, and if so, how to use it best should be done. Again, notice the difference and make use of it in the future.

    Or have you checked into patent number 518873 from the U.S. Patent office, where Dr. Kaali and Dr. Lyman used electrical current to suppress HIV for the believers.

    So what is your point here? The patent office only patents valid medical treatments? If a patent is the best you can come up with then you are on shaky ground. Could you please show me the study, with placebo control? Or any evidence that what you are talking about is valid? I know you have a pretty high standards when it comes to verifying things but for some reason I just feel safer checking myself.

    mehttp://educate-mehttp://educate- yourself.org/cn/LymanKaalibiocompatibleHIV1996report18nov06shtmldicine

    Could you please paste the actual URL?

  302. #302 noreen
    September 25, 2007

    So two doctors are going to patent some non-traditional approach to treating viruses without doing any research on the matter. They would look like idiots if they did so. Why don’t you open your mind and do some reading about Bob Beck and bioelectric medicine or the MWO but again if it has not been studied and published in standard journals you will pooh-pooh it. How do you think that Indians, and our ancestors treated illnesses, by waiting for it to be published? No, by trail and error. Even today, many progressive doctors,like Dr. Zagon, think outside of the box and use a drug off-label, which works instead of the old I don’t care to learn new tricks attitude and I have treated diseases a certain way for eons and will continue to do so.

  303. #303 noreen
    September 25, 2007

    http://educate-yourself.org/fc/#blood

    This site has a wealth of alternative medicine for those who enjoy a different approach and viewpoint to medicine.

  304. #304 DT
    September 25, 2007

    E-LISA, Ok, so AZT can cause granulocytopenia (and then only in 0.2% more patients than it does in those on placebo).

    You do know what granulocytes are, don’t you? They are one of several types of white blood cell. Can you tell us the difference between granulocytes and lymphocytes? Do you know that scientists have discovered there are even several different types of lymphocytes? Fancy that! One of these subtypes is called the “Helper” T lymphocyte. They are usually known as CD4+ lymphocytes. Please, please tell us you have heard of these.

    In HIV-induced immunodeficency they can drop down to profoundly low levels, but, wouldn’t you know it, the rest of the white blood cells are hardly affected.

    Can you now give us a citation where it states AZT causes isolated CD4+ lymphopenia? The wonderful Professor Duesberg’s literature must be bursting at the seams with references to this phenomenon, since he states categorically that the hematological appearance of AIDS/HIV is the result of treatment with AZT.

    As he is not here, perhaps you could do the honours and point us to just one of his references, so we can all bow our heads in shame at our ignorance and go home?

  305. #305 Adele
    September 25, 2007

    Wow noreen your all up in Gallo’s face for “science by press conference” but his four papers already got peer reviewed before his press conference.

    Lyman and Kaali weren’t they the ones who did the press conferences before they gave data at a science conference? Also before they published anything? Did they ever have a peer review paper?

    Now theres this guy Beck on it look at
    medgadget.com/archives/2006/08/pseudoscience_f_5.html

  306. #306 Adele
    September 25, 2007

    for those who enjoy a different approach and viewpoint to medicine.

    Or those who need a good laugh??! I like the one where Dr. Beck is he really a doctor? Where he says 51% of pharmaceutical companies are in “the mob”

    Thanks noreen!

  307. #307 apy
    September 25, 2007

    So two doctors are going to patent some non-traditional approach to treating viruses without doing any research on the matter. They would look like idiots if they did so.

    Cunning argument noreen. Apparently all of big pharma is willing to loot and plunder the entire world to make a few bucks, but people that you agree with would never tell a little lie?

    Even today, many progressive doctors,like Dr. Zagon, think outside of the box and use a drug off-label, which works instead of the old I don’t care to learn new tricks attitude and I have treated diseases a certain way for eons and will continue to do so.

    And how do you think those drugs that they use off-label even came to exist for ‘on-label’ usage? Humans have known about them since the dawn of time?

  308. #308 noreen
    September 25, 2007

    Beck was an engineer who took old technology and improved on it. Gallo situation was different and you know it. It was stated, “probable” cause of AIDS, This was treated as though it was 100% accurate. Surprisingly, he rushed out to patent his new antibody test for a “probable” causation factor.

  309. #309 noreen
    September 25, 2007

    If Gallo is so right, then please tell me why the discover of supposedly worse plaque of our time was not nominated for a Nobel Prize? Surely, he must qualify! I guess that it looks bad to nominate a person who was convicted of scientific misconduct.

  310. #310 Braganza
    September 25, 2007

    Dear all,

    Just to let you know that I had a quick look at PUBMED and the guys from the US patent number 518873, Dr. Kaali and Dr. Lyman have published a paper referent to their experiments, but I dont have access to the paper- it is not in my library- so I can not comment.

    Lyman WD, Merkatz IR, Kaali SG.
    Biocompatible electric current attenuates HIV infectivity.
    Surg Technol Int. 1996;5:75-9. No abstract available.
    PMID: 15858720 [PubMed]

    Noreen, from my experience, (I work in research) any patent can have unreproducible experiments and nobody would really care.

  311. #311 noreen
    September 25, 2007

    Apy, you are missing the point. If Dr. Zagon had not done research into other uses of this wonder drug, it would not be used to treat numerous diseases that it is currently being used for, not just AIDS. Studies have been done for Chron’s Disease, MS and AIDS are underway. But in the interim, many doctors do prescribe it off label because it works, with or without studies!

  312. #312 apy
    September 25, 2007

    The point, noreen, is that these usages come from studies, not from some internet person saying “It works for me and I have no evidence that it is the direct result of it!” People thought that there might be something to it and they did studies and some of them come out very positive which is great. But I should hope none of those scientists saw one person taking LDN and saw they were in good health and came to the conclusion “It works!”, which is exactly what you are doing. I’m not saying progressive doctors are bad, I’m saying claiming something without empirical evidence is.

  313. #313 Adele
    September 25, 2007

    Lyman and Kaali told newspapers about their experiment first. Then they talked about it in a conference in 1990. Then they published six years later.

    They might be right maybe getting zapped is good for you just your real hypocritacle saying Gallo screwed up but these guys you wanna believe.

  314. #314 noreen
    September 25, 2007

    Dr. Bahari had more than one AIDS patient doing this and now many more now are also doing so, whether you care to believe it works or not. Like the above commentor stated, just being published isn’t proof. Maybe Gallo’s antibody test does work for 40% of the population.

  315. #315 Adele
    September 25, 2007

    Maybe Gallo’s antibody test does work for 40% of the population.

    Nope noreen it works for close to 100% so good as other antibody tests.

  316. #316 noreen
    September 25, 2007

    So Adele, you admit that it is an antibody test. Could you please show me the study that proves antibodies equate to an active infection and that having antibodies to a virus is a death sentence.

  317. #317 Adele
    September 25, 2007

    Noreen what? Yes an antibody-based test is called a antibody test i’m not admitting anything there! The HIV antibody test uses HIV proteins to see if theres antibodies to HIV in the blood. About 100% of the time the antibodies are specific for HIV. That means there’s an infection. What’s an “active infection” noreen what do you mean by that?

    Having antibodies to virus is a death sentence?? Who says that noreen? Just deniosaurs who got their brains caught in the past and can’t get out!

  318. #318 noreen
    September 25, 2007

    Adele, your logic puzzles me. I have numerous antibodies to numerous viruses but do not have an active case at the present. According to your thinking, then I should be on numerous medications for all sorts of viruses. And if a person have antibodies to HIV well, they are told that thet have an incurable disease and must stay on medicines, pretty much for the rest of their life.

  319. #319 Adele
    September 25, 2007

    Noreen its not logic puzzles you its facts. You’ve got a deficiency of them. That’s coming from getting all your info from alive and well and electro herbal psychic magnetic websites. Like what you say about Amy Justice or Robert GAllo. There’s no “university website” says all those stuff about Justice and what she does. You have to read her papers. Have you ever read a paper from Amy Justice? HAve you ever read Gallo’s papers even?

    Noreen you won’t understand the virus you have in your body unless you learn about it. NOT read what somebody said somebody else said about it. HIV is one virus but there’s lots of them can stick around your whole life. Antibodies don’t always say there’s no infection anymore. Hear about varicella? I have antibodies to varicella but I’m still infected. So are you probably. Your like Duesberg saying well my dog is friendly so all dogs are friendly. My retrovirus doesn’t kill anyone so no retrovirus can kill anyone. I have antibodies to polio and I’m not sick, so antibodies to HIV are good not bad! Not the smartest guy noreen but you fell for it.

  320. #320 noreen
    September 25, 2007

    Yes, having antibodies to HIV is in fact a good thing. Besides, it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!

  321. #321 apy
    September 25, 2007

    Adele, I believe what noreen is saying, and correct me if I’m wrong noreen, is that if an antibody test counts the number of antibodies you have to HIV, then the higher it is the more resistant you should be to it. Antibodies == immunity, thus lots of antibodies == lots of immunity, not more virus.

    Wouldn’t a consistent high number of antibodies suggest that the antibodies are not working though? The viral load should decrease over time and the number of antibodies with it.

    Also, there are quite a few viruses out there that cause serious complications after a long time even with antibodies. Subacute sclerosing panenciphalitis comes to mind immediately.

  322. #322 Adele
    September 25, 2007

    Antibodies to HIV, bad, mean youre infected.
    Antibodies to HIV, also good! They help neutralize the virus. Some better then others.
    No antibodies to HIV on one test, maybe good. You could still have infection just not seroconverted yet.
    No antibodies on several tests, best. You aren’t infected.

    it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!

    My god noreen now I believe you maybe you don’t read aliveandwell anymore. Not oven the aliveandwell liars say stuff that funny. Are you trying to out deny the big deniers? Viral load measures antibodies? More virus, better health? You got a source or are you in standup improv now?

  323. #323 jspreen
    September 25, 2007

    so antibodies to HIV are good not bad!

    Adele, if you weren’t so agressive all the time I wouldn’t write it, but because you are I tell you: you’re a very stupid human being.

    What do you believe you check with the fu*$#ng HIV test? Antibodies to HIV. What do you tell a person who’s got antibodies to HIV and thus is HIV+? That the antibodies are good? No, you say that you got very bad news for him/her and that he/she infected with HIV. Thereafter, what can one see in the eyes of the person you just talked to? Happiness? No, total distress, the man/woman is lost in an abyss of despair.

    And here, what do you dare to write?
    HIV antibodies are good!!
    Why don’t you stick to your belief all the way, you c*$t. You can’t get away with it, can you? Of course, normally, in main stream medicine thinking antibodies are a good thing, it’s what is said to be produced by vaccination. With HIV you must make people think the other way around. And believe in the nonsense yourself. That- defend two opposite approaches to explain one and the same thing, depending on which theory is needed where to make the house of cards keep standing up – one can only hope to achieve by being stupid or dishonest.

  324. #324 DT
    September 25, 2007

    Noreen, you said:

    I have numerous antibodies to numerous viruses but do not have an active case at the present. According to your thinking, then I should be on numerous medications for all sorts of viruses. And if a person have antibodies to HIV well, they are told that thet have an incurable disease and must stay on medicines, pretty much for the rest of their life.

    Noreen, we all have several viruses in our bodies – some are relatively latent/dormant, some a bit more active. You see, with certain persisting viral infections we know that infection is essentially lifelong and that antibodies are a marker that the individual has been exposed to the virus (and is therefore infected).

    Some examples:
    EBV (glandular fever) This can re-emerge to cause things like lymphomas later in life
    CMV – can re-emerge if immunosuppression exists such as transplants/HIV
    Herpes simplex – antibodies mean exposure, which = infection. This never goes away, but re-emerges from time to time as cold sores/herpes lesions.
    VaricellaZoster. Yup, once you’ve had the chickenpox, you have persisting antibody. Again, it’s not protective, and the virus can re-emerge whenever it feels like it.

    You don’t need to take treatment constantly for these, but may need to if they relapse.

    HIV is not really so different. Duesberg could never grasp the concept that for some infections, having antibody can be a sign of dormant or active infection. He relied on his kindergarden grade medicine to dismiss this, thinking antibody = recovery from infection, and therefore “cure”.

    He has had this point corrected countless times, but it is a sign of his deceitfulness that he has never acknnowleged that he was wrong. You can be brave, and say you are wrong. It’s the right thing to do.

    HIV infection is not always treated with ART. There is a period of clinical latency when treatment would do no good, so people do not attempt to treat until there have been clinical sequelae or a steady decline in lab markers such as CD4. Many people remain treatment free for many years. Why do you lie by saying we advocate treatment for everyone with the virus?

  325. #325 Tara C. Smith
    September 25, 2007

    Why don’t you stick to your belief all the way, [edited]. You can’t get away with it, can you? Of course, normally, in main stream medicine thinking antibodies are a good thing, it’s what is said to be produced by vaccination. With HIV you must make people think the other way around.

    jspreen, antibodies aren’t always “good” or “bad.” Yes, many times they protect us from reinfection, or initial infection (in the case of vaccines). But they can also result in autoimmune disease–for example, rheumatic heart disease, where antibodies to Streptococcus pyogenes cross-react with tissue in our heart, acting as “friendly fire” and damaging tissue. Additionally, sometimes the antibodies generated aren’t enough to protect us from the pathogens that remain in our bodies, as DT noted above. (You may note that’s also why they tried a different tactic in the HIV vaccine case noted above). Like most things in life, it’s not black and white.

  326. #326 Roy Hinkley
    September 25, 2007

    Adele,

    Actually I don’t find this funny at all:

    it has been proven that the higher the viral load the better the patient fares because it IS ANTIBODIES, NOT THE REAL MCCOY VIRUS!

    (I know you really don’t either.) in fact it’s one of the saddest things about HIV denial for me.

    Noreen, despite all her time spent on internet HIV research, has been saying that viral load tests only measure antibodies to HIV for over a year that I know of.

    If she can not, or will not, learn what a viral load test is measuring, or what an antibody is, what kind of educated treatment decisions can she be making?

    As a side note it’s frankly disgusting that a more scientifically literate denier like Bialy, or someone, won’t explain the matter to her. I suppose any increase in her actual understanding could jeopardize her committment to denying that HIV is a threat to her health.

  327. #327 cooler
    September 25, 2007

    What do viral loads measure? According to nobel prize winning inventor of the PCR, kary mullis, they were never meant to quantify anything, its a multiplication technique.

    if you make a 1000 copies of a 1 dollar bill how much money do you have?, thats the trick with the pcr lol, tricking people they are teeming with virus particles when theyre not

    see hiv fact or fraud google it

    read project day lily to find out about the mycoplasma biowarfare program, most amazing book ever

  328. #328 Chris Noble
    September 25, 2007

    What do viral loads measure? According to nobel prize winning inventor of the PCR, kary mullis, they were never meant to quantify anything, its a multiplication technique.

    Mullis’ book on PCR has a whole chapter on quantitative PCR. The technique is used in thousands of fields. It clearly works for everything else. For some reason known only to himself Mullis seems to think that it doesn’t work for HIV. If you can find out what Mullis’ reasons are then tell me. Ask him about glowing raccoons while you’re at it.

  329. #329 cooler
    September 25, 2007

    Say someone had a viral load of 100,000…………are there any electron microscopic pictures of this massive amount of virus in the patients plasma?

    just wondering,
    ask AIDS inc about black men in Africa eating/having sex with chimps as the trigger for the AIDS pandemic, thats what I was told in high school by the AIDS establishment

  330. #330 Roy Hinkley
    September 25, 2007

    Hey cooler, if I take all my dollar bills and make 30 copies of them, and I end up with 31 dollars, how many dollars did I start with?

    If I make 30 copies and I end up with 310 dollars how many dollars did I have to start with?

    If I make 30 copies and I end up with 31,000 dollars how many dollars did I have to start with?

    If I make 30 copies and I end up with 310,000 dollars how many dollard did I have to start with?

    Cooler, would you be so kind as to explain to Noreen that no PCR based technique measures any antibodies of any kind and then go on to tell her what sort of nucleic acids would be amplified in a viral load assay?

  331. #331 cooler
    September 26, 2007

    Still waiting for a picture of a patients plasma teeming with virus, not some convoluted mathemtical process that can be easily manipulated by any one with an agenda.

    say you have 10 hiv rna per ml, copy it 1000, now you have 10,000 rna per ml to keep the virus hunters happy, even though theyre just copies.

    As for the techincal stuff, I would love to see a debate between you and duesberg, mullis etc, dont try and bully me with your techical BS, debate people who understand exactly how the PCR works, I never claimed to be an expert in it, although I would think if people were teeming with 10000000 copies of virus their would be electron microspoic pictures of this from patiets plasma…………call me crazy

    What we are really are talking about kochs postulates that can be understood by a 5th grader, this is what charlatans do, take a simple subject, make it overly complex and then denegrate those who dont know the “nucleic acids”

    Did koch ever talk like this when he tried to help humanity by discovering new microbes?, no, bc he knew finding out how to discover new microbes was not rocket science, and those that turn the simple into the complex are doing so because their theories fail the simple scientific tests, so make things convoluted and complex to confuse the subject, prolonging their failed hypothesis’s as long as they can.

    I ask you this, as a tax paying american with a piddly bachelors degree…………….

    In 1983 only a few idiotic scientists thought hiv was caused by a retrovirus (Gallo, levy,essex) coming off their failed retrovirus cancer program (how dumb can these people be cancer isnt contagious?)

    in 1985 everybody thought hiv was the cause of AIDS. Please reference the scientific paper printed in between these years that created this ubiquiotus consensus, or was this consensus causes by politics and press conferences and not science?

  332. #332 cooler
    September 26, 2007

    lots of spelling errors…………im half asleep

  333. #333 Chris Noble
    September 26, 2007

    ask AIDS inc about black men in Africa eating/having sex with chimps as the trigger for the AIDS pandemic, thats what I was told in high school by the AIDS establishment

    Your high school teacher was a member of the AIDS establishment? They’re everywhere now. They’ve even infiltrated the high schools.

    The only people I know of that talk about blacks having sex with chimpanzees are HIV denialists. I had never heard of the idea until I heard it from HIV denialists.

  334. #334 Roy Hinkley
    September 26, 2007

    dont try and bully me with your techical BS”

    Sorry Cooler, I should have realized that division and subtraction were beyond your capabilities.

    My sincere apologies.

    Really though, anyone with bachelor’s degree in biology ought to be able to explain PCR Cooler. Are you telling me you don’t even have a BA in biology?

    Yet you come here and argue with, and insult, a professor of epidemiology, among others?

    I’d like to believe this explains your inability to separate a fiction novel from actual scientific research but I’m afraid even an English major would have no trouble distinguishing the two.

    So, … what was your major Cooler?

    Underwater Basket-weaving?

  335. #335 Chris Noble
    September 26, 2007

    Cooler if you believe that PCR is really that unreliable then how do you reconcile this with your support of Garth Nicolson who bases all of his fanciful claims about mycoplasmas (weaponised with HIV-1 env) solely on PCR detection?

  336. #336 noreen
    September 26, 2007

    Why don’t you mainstream thinkers concede that many HIV-Positives, who don’t believe in HIV, are surviving quite nicely without antiretrovirals. In fact, I would be so bold to state that AIDS can certainly be cured by the use of drugs temporarily, by taking supplements, herbs and by cleaning up one’s health habits. Now, all of you can have a field day with that comment but it is true. This is precisely how I have managed to do so.

  337. #337 noreen
    September 26, 2007

    How can the viral load and HIV antibody tests be defended when both come with the following disclaimers: “At present there is no recognized standard for establishing the presence or the absence of antibodies to HIV-1 and HIV-2 in human blood” and “The Amplicor HIV-1 Monitor test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection”

  338. #338 apy
    September 26, 2007

    Why don’t you mainstream thinkers concede that many HIV-Positives, who don’t believe in HIV, are surviving quite nicely without antiretrovirals.

    So…I only have to believe in something for it to be a problem? I didn’t realize wish-full thinking was so powerful.

    And I’m not sure why you keep on coming back to this noreen. As stated above, by me, and quite a few other people, the elite controller group is recognized. Unfortunately in your warped mind the presence of an elite controller group seems to mean everyone is an elite controller and AIDS doesn’t really exist or something like that.

    Considering you accuse everyone who disagrees with you of having a closed mind, perhaps you could show us how open minded you are by telling us where you studied biology and/or medicine? Even if you disagree with it you could atleast put forth the effort of understanding the mainstream claims since your arguments seem to be based on a complete ignorance of it. Do you know how PCR works? Have you ever done a PCR? If you don’t then why are you so critical of a procedure you do not know?

  339. #339 ElkMountainMan
    September 26, 2007

    My respect for noreen and her right to make her own health decisions is complete. I do not question her assertion that she is currently healthy. What I take exception with are the thought processes that allow her to extend her personal experience to the situations of other HIV-infected persons.

    Imagine having a conversation on smoking and cancer with someone who does not know what sort of organ the lung is, how it connects with the mouth, or what breathing entails. This person has not heard the word “carcinogen,” thinks “Bruce Ames” is what happens when actor Willis points his Glock, and is blissfully unaware of the last century of cancer research. She has never read an article on the risks of smoking established by any number of epidemiological studies. In conversation, she argues that smoking is good for one’s health. The proof? Her great-uncle smoked several packs each day and lived to the age of 96.

    Arguing with this person is pointless until she is willing to learn the most basic facts about the human body and the substances we put into it.

    Noreen, it seems you don’t know the difference between an antibody and a nucleic acid. That’s nothing to be ashamed of. Most people know little about them. If you wish to understand your own health, though, you absolutely need a basic version of this information. You need to understand the antibody test and what it does, the viral load assay and what it involves.

    You should consult with a physician for how these matters affect your own health. And some of us would be happy to direct you to basic information. We can’t and won’t force-feed it to you, though, and I’m now seeing there is no reason to “debate” you or respond to your points until you know what you are talking about. Most “rethinkers” do not think about the biology of HIV at all, let alone “rethink” their own notions. You can be like them or follow your own path, and I can’t make the decision for you.

    Please understand, though, that “I eat fast food three times a day but my friends say I’m slim” is no argument against the health consequences of a high-fat diet, especially when you don’t know how fats differ from carbohydrates or proteins, or what a ‘calorie’ is.

    Noreen, your health is too important to base your opinions on the curious notions of non-experts at alive and well and other dissident websites. With respect, I urge you to rethink your position.

  340. #340 Braganza
    September 26, 2007

    Why influenza vaccination, as spontaneous influenza, can increase viral load in HIV+ patients?

  341. #341 jspreen
    September 26, 2007

    So…I only have to believe in something for it to be a problem? I didn’t realize wish-full thinking was so powerful.

    Maybe you don’t realize things simply because you stop thinking before you even started.
    I’ll put it otherwise:
    A thing can only be a problem as long as you believe in it.
    Now, think and don’t stop before you’ve seen the light. (Hint: think of evil witches, dragons, ghosts etc. Do you believe in them? Yes? Then they’re a problem for you. No? Then you laugh about them).

  342. #342 cooler
    September 26, 2007

    hhaahahahahahahahah hinkley, youre a professor and you cant give me the reference for the first scienific paper that proves hiv causes aids, you cant give me a electron microscopic picture from a patients blood showing these 1,000000000 viral load counts.

    Where did you do your graduate work, coco birds online university for dummies?

    No wonder youll never debate mullis or duesberg, youll get embarrased.

    Noble, nicolson and lo never used the PCR to quantify, they used it to detect microbes. shyh ching lo never used the PCR to quantify, he used the electron microscope and took pictures of animals/people teeming with infectious bacteria(mycoplasma incognitus)to quantify.

    Hinkley, you bozo, maybe you should learn from your scientific elder, Dr. LO md phd armed forces of pathology cheif to find out how to really quantify a microbe, with the electron microscope, not the PCR.

    Project day lily is not fiction, he had to slightly fictionlize it to stay out of court, but the events are true. rave reviews from several scientists, including a nobel laurete.

    Remember, hinkley, do your homework and learn from lo how to really quantify/see a host being damaged with high titers of virus, its with the electron microscope, im sorry you didnt know that, maybe you can ask for a refund for your tuition.

    read project day lily google it

    see hiv fact or fraud google it

  343. #343 Adele
    September 26, 2007

    Why influenza vaccination, as spontaneous influenza, can increase viral load in HIV+ patients? Braganza

    Heres the conclusion from
    “Immunologic and virologic evaluation after influenza vaccination of HIV-1-infected patients” Fowke KR AIDS July 11 1997.

    These results indicate that immune stimulation resulting from influenza vaccination did not significantly change the levels of plasma virus, CD4 cell counts, or activation-induced apoptosis in HIV-infected individuals

    Where did you see that Braganza if you can give me a reference ill check it out.

  344. #344 Adele
    September 26, 2007

    Sorry Braganza there’s alot more on this. Some people say it does some people say it doesn’t.

    So if you vaccinate someone your changing their immune system. So its possible a vaccine activates some cells and gives a virus better places or more places to make copies. If a influenza vax does that in HIV+ then there might be more viral load for awhile. There’s alot of influenze vaccines so maybe some do and some don’t. I’m adding a list I found on cdc.

    http://www.cdc.gov/mmwR/preview/mmwrhtml/00047346.htm

    Vaccination of Persons Infected with HIV Chapman L, Hartley M, Khan A, et al. Changes in plasma HIV RNA after immune activation by vaccinations and acute illnessess {Abstract}. In: Program and abstracts of the 2nd national conference: human retroviruses and related infections. Washington, DC: American Society for Microbiology, 1995. Glesby MJ, Hoover DR, Farzadegan H, Margolick JB, Saah AJ. The effect of influenza vaccination on human immunodeficiency virus type 1 load: a randomized, double-blinded, placebo-controlled study. J Infect Dis 1996;174:1332-6. Huang KL, Ruben FL, Rinaldo CR Jr, Kingsley L, Lyter DW, Ho M. Antibody responses after influenza and pneumococcal immunization in HIV-infected homosexual men. JAMA 1987; 257:2047-50. Jackson CR, Vavro CL, Penningron KN, et al. Effect of influenza immunization on immunologic and virologic parameters in HIV+ pediatric patients {Abstract}. In: Program and abstracts of the 2nd national conference: human retroviruses and related infections. Washington, DC: American Society for Microbiology, 1995. Miotti PG, Nelson KE, Dallabetta GA, Farzadegan H, Margolick J, Clements ML. The influence of HIV infection on antibody responses to a two-dose regimen of influenza vaccine. JAMA 1989;262:779-83. Nelson KE, Clements ML, Miotti P, Cohn S, Polk BF. The influence of human immunodeficiency virus (HIV) infection on antibody responses to influenza vaccines. Ann Intern Med 1988; 109:383-8. O’Brien WA, Grovit-Ferbas K, Namazi A, et al. Human immuodeficiency virus-type 1 replication can be increased in peripheral blood of seropositive patients after influenza vaccination. Blood 1995;86:1082-9. Safrin S, Rush JD, Mills J. Influenza in patients with human immunodeficiency virus infection. Chest 1990;98:33-7. Staprans SI, Hamilton BL, Follansbee SE, et al. Activation of virus replication after vaccination of HIV-1-infected individuals. J Exper Med 1995;182:1727-37. Steigbigel RT, Craddock BC, Cate TR. Antibody responses to influenza vaccination in HIV-infected people and effect of HIV load {Abstract}. In: Program and abstracts of the 33rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Washington, DC: American Society for Microbiology, 1993. Thurn JR, Henry K. Influenza A pneumonitis in a patient infected with the human immunodeficiency virus (HIV). Chest 1989;95:807-10. Yerly S, Wunderli W, Wyler CA, et al. Influenza immunization of HIV-1-infected individuals does not increase HIV-1 viral load. AIDS 1994; 8:1503-4. Vaccination of Foreign Travelers CDC. Update: influenza activity — worldwide and recommendations for influenza vaccine composition for the 1990-91 influenza season. MMWR 1990;39:293-6. CDC. Acute respiratory illness among cruise-ship passengers — Asia. MMWR 1988; 37:63-6.

  345. #345 apy
    September 26, 2007

    Maybe you don’t realize things simply because you stop thinking before you even started.
    I’ll put it otherwise:
    A thing can only be a problem as long as you believe in it.
    Now, think and don’t stop before you’ve seen the light.

    jspreen, it sounds like you are suggesting that if I don’t believe in a bullet then I have nothing to fear from one being fired at me. Is this correct?

  346. #346 noreen
    September 26, 2007

    So ElkMountainMan, you think that I should go back on antiretrovirals even though I haven’t any AIDS symptoms? Why would I do this when both tests have not been approved to detect the HIV virus? Besides, now for a change, my blood work is normal including my liver enzymes. I was constantly anemic while on the meds. I am not anti-meds, only against them when they are not necessary.

  347. #347 Adele
    September 26, 2007

    noreen do you read anyone’s comments? No one’s telling you go back on meds. You have to decide with your doctor. We’re not giving medical advice to you.

    Alls elk said was, when you don’t know about antibodies and pcr how can we talk to you about antibodies and pcr.

    You go to some website and paste something from a “disclaimer” but which test is it from. What year’s it from? You don’t know. Thats your problem, getting stuff secondhand not reading a real disclaimer or a real paper. Try it some time you might like it.

  348. #348 noreen
    September 26, 2007

    Actually, it is not from rethinkers site. Show me Adele where these test have been validated. If I listened to you folks you know good and well that AIDS doctors would immediately place me on the meds even though I am not sick and dying. Nice try but peddle your gloom and doom elsewhere.

  349. #349 Adele
    September 26, 2007

    So wheres it from Noreen? Give us a link. You know address on the internet book whatever.

  350. #350 apy
    September 26, 2007

    Nice try but peddle your gloom and doom elsewhere.

    Nobody said you had to go on them, you have the worst selective reading. Most of the criticism against you here, and indeed all of mine as far as i know has not been about your decision not to take ARV’s but your peddling of untested treatments, your complete logical contradictions, your apparent inability to verify anything you read, apparent inability to read and comprehend other posts directed at you, as well as your apparent lack of understanding of the concepts that you so easily badmouth.

  351. #351 Adele
    September 26, 2007

    Noreen you got those quotes from somewhere or did you memorize them? While I’m waiting here’s the study you asked for. It validated the Amplicor HIV-1 Monitor test. Theres alot more than this but this works.

    “Evaluation of the Ultrasensitive Roche Amplicor HIV-1 Monitor Assay for Quantitation of Human Immunodeficiency Virus Type 1 RNA” by Erali and Hillyard Journal of Clinical Microbiology March 1999.

    Also here is the new story about FDA approval

    http://www.pslgroup.com/dg/934a.htm

    BRANCHBURG, N.J., June 3, 1996 — The U.S. Food and Drug Administration (FDA) today approved for marketing Roche Molecular Systems’ (RMS) AMPLICOR HIV-1 MONITOR(TM) Test, the first test to accurately and precisely measure quantities of HIV-1 RNA in the blood (viral “load”).

    The tests work. They were validated. Independent labs test them all the time. The FDA approved them.

  352. #352 noreen
    September 26, 2007

    You post that the FDA approved them for measuring antibodies in the blood, which by the way is no surprise. However, I asked where has the FDA approved them or any other test for measuring the ACTUAL VIRUS? We are waiting!

  353. #353 Adele
    September 26, 2007

    Noreen

    viral load measure copies of RNA

    antibody tests measure presence of antibody to HIV proteins

    The articles I just gave you are about viral load not antibodies. Did you read them in two minutes? IF not how can you comment about them.

    Now where did you get those disclaimers or are you quoting from memory? I want to read them myself. Or are you the only one allowed to ask qustions?

  354. #354 apy
    September 26, 2007

    I don’t see any mention of antibodies in Adele’s post, it specifically says ‘viral load’. This is the selective reading thing I alluded to before.

  355. #355 Adele
    September 26, 2007

    Noreen you asked

    Show me Adele where these test have been validated

    so I showed you a paper and a news article theres actually alot more. But you didn’t read them. So you mis-rememberd what you asked, you said

    However, I asked where has the FDA approved them or any other test for measuring the ACTUAL VIRUS?

    Not the only time! Before that I said

    You go to some website and paste something from a “disclaimer” but which test is it from.

    I didn’t say you got it from a rethinker site but you said

    Actually, it is not from rethinkers site.

    Noreen do you know what its called when you say one thing and then you give us a different version of it? And when I say something but you say I said something else. Do you know the word for that? I do and so do you! I’m sorry I have to say that because I like you and I think you are smarter then your letting yourself be.

  356. #356 Adele
    September 26, 2007

    Noreen I’m not asking you anything hard! You just wrote it 7:49 AM this morning so you must know where you got it from.

    I just want to know where you got these quotes so I can read them myself. I’ll remind you what you said

    How can the viral load and HIV antibody tests be defended when both come with the following disclaimers: “At present there is no recognized standard for establishing the presence or the absence of antibodies to HIV-1 and HIV-2 in human blood” and “The Amplicor HIV-1 Monitor test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection”

  357. #357 DT
    September 26, 2007

    Amplicor:
    http://www.fda.gov/cber/PMAltr/P9500053L.htm

    “The AMPLICOR HIV-1 MONITOR Test is an in vitro nucleic acid amplification test for the quantitation of Human Immunodeficiency Virus Type 1 (HIV-1) RNA in human plasma. The test is intended for use in conjunction with clinical presentation and other laboratory markers of disease progress for the clinical management of HIV-1 infected patients. The test can be used to assess patient prognosis by measuring the baseline HIV-1 RNA level or to monitor the effect of antiviral therapy by serial measurement of plasma HIV-1 RNA levels during the course of antiviral treatment. Monitoring the effects of antiviral therapy by serial measurement of plasma HIV-1 RNA has been validated for patient swith baseline viral loads ≥25,000 copies/mL.

    The AMPLICOR HIV-1 MONITOR Test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection.”

    I believe this was all covered in the denial thread somewhere.

    Noreen, you keep on switching tack every time someone asks you a question. Why? Have no answers?

  358. #358 jspreen
    September 26, 2007

    jspreen, it sounds like you are suggesting that if I don’t believe in a bullet then I have nothing to fear from one being fired at me. Is this correct?

    You shouldn’t write down the first thing that pops up into your brain within half a second of reflexion. In my previous message I told you to not stop thinking before you saw the light, remember? Anyway, you may try to not believe in a bullet or to not fear an agressive crook with a gun, but I figure you won’t get far. Which doesn’t totally exclude the eventuality that somewhere on the globe a person exists who mastered that trick and who has no bullet to fear. But a guy who just started a judo course shouldn’t immediately try to floor a black ribbon so let’s do some steps backwards and try to figure out an easier example.

    A kid who climbs trees without ever even thinking he might fall, won’t fall. A kid who climbs trees with the fear to fall, will certainly fall out of a tree one day.

    Now, one step higher. HIV. The HIV=Aids equation is absolutely nonsense and only dangerous for people who believe in it. How do I know that? Simply because before the eighties HIV was never a problem and only the simplests of minds can believe that HIV popped up in nature, not one million years ago, not in 3425 BC, not in 1546 AC, no, it came to earth exactly when some virologists were badly looking for it. And what came with it? Fear. FEAR. And people who fear do the stupidest things and believe the stupidest stories. For instance, they believe guys who tell the toxic chemicals they make money with is good for one’s health. Or, for instance, they listen to a theory which only approximately sticks together with super glue and is kept standing up by people who’s monthly paycheck depend on that theory.

    You want a world without AIDS? Close your eyes, stop listening to bullshitters and you have it. Which doesn’t mean the world would be without people suffering from what is called today immunity deficiency. But the problem wouldn’t be the same anymore. At all. For instance, a phrase like Hey there’s a guy with AIDS, he needs ARV’s! might become something like Hey, there’s a guy who’s starving, he needs bananas!

  359. #359 Adele
    September 26, 2007

    Some New Germanic person’s been watching to many kung fu movies!!

  360. #360 apy
    September 26, 2007

    You shouldn’t write down the first thing that pops up into your brain within half a second of reflexion. In my previous message I told you to not stop thinking before you saw the light, remember?

    What light is there to see? You said that if you don’t believe in something then it cannot harm you so I gave a simple example and asked if that is what you meant. Is your ‘advice’ selective? It only works for bacteria and not for bullets? I don’t want vagueness I want you to be specific and state your meaning not some fortune cookie saying and tell me there is some nonexistent light to seen because you have a warped concept of reality. If your brilliant idea can’t withstand a question as direct as what a 4 year old would ask maybe it’s not that good.

  361. #361 Adele
    September 26, 2007

    apy,

    I wonder if the great New Teutonic yogi can give us some advice does it work both ways?

    I mean I see the light now. If I don’t fear a car crash I will never crash my car. If I don’t fear a bullet I am invincible. That’s easy.

    What about if I believe I can fly? OK so there I am in a airplane, it blows up and I’m free falling. Duh, if I don’t fear gravity I won’t die everyone knows that. But can I actually fly? If I believe I can fly can I do it?

    Then what about if Noreen believes she can tell us where she got those quotes? Does it make her able to tell us?

  362. #362 jspreen
    September 26, 2007

    What light is there to see?

    May I suggest you read my previous message to the end before you start hammering on your keyboard?

  363. #363 apy
    September 26, 2007

    Adele,
    I spent the first dozen years of my life believing people really can’t be that dumb. And well….I’m not convinced jspreen’s advice works to say the least.

  364. #364 apy
    September 26, 2007

    May I suggest you read my previous message to the end before you start hammering on your keyboard?

    Your argument falls apart in the first sentence so what is the point? You realize that in order for your high level argument to work it’s foundation needs to work too right?

  365. #365 noreen
    September 26, 2007

    Adele, it makes no difference where I got the information from, either the tests have been validated or they have not. What’s the problem here, you can’t respond to a simple question that is very significant to HIV causing AIDS? You folks can trust you life on an unproven virus and meaningless tests if you want too but many of us will not!

  366. #366 apy
    September 26, 2007

    Umm..didn’t she answer your question already? The one that showed the FDA had passed a viral load test, which is the exact thing you asked for?

  367. #367 Adele
    September 26, 2007

    Noreen I don’t care where you got your information I just want to read it for myself. I would like to read these quotes for myself, thats it! You just copied them this morning what was your source?

    Where did you get them? Its a siomple question, yes.

    I answered your question and I gave you a paper and a news account about how viral load assays are confirmed. Why cant you answer my question?

  368. #368 apy
    September 26, 2007

    For those too lazy to search wikipedia:

    http://en.wikipedia.org/wiki/Viral_load_test

    Several different HIV viral load tests have been developed, and three are currently approved for use in the US:

    * Amplicor HIV-1 Monitor test (Hoffman-La Roche), better known as the PCR test
    * NucliSens HIV-1 QT, or NASBA (bioMerieux)
    * Versant/Quantiplex HIV-1 RNA, or bDNA (Chiron/Bayer)

    These tests have been approved by the Food and Drug Administration in the United States for use in monitoring the health of people with HIV, in conjunction with other markers.

  369. #369 Roy Hinkley
    September 26, 2007

    I’m not a professor Cooler. Tara is.

  370. #370 Epidemiology-LISA
    September 26, 2007

    You guys are pathetic beyond belief. You know very well what Noreen means. The PCR tests have been validated for counting small pieces of RNA, but none of them has yet been validated for verisfying on its own that the RNA pieces it counts means you are infected with “HIV” – like so:

    The AMPLICOR HIV-1 MONITOR Test is not intended to be used as a screening test for HIV or as a diagnostic test to confirm the presence of HIV infection

    Courtesy of DT.

    I repeat, you are pathetic beyond belief!

  371. #372 noreen
    September 26, 2007

    Have they verified this test against those who test HIV-Negative? Did you catch that it is to be used when the person has HIV-Positive Antibodies? This to me is red flag. Let’s run this test on HIV-Negative persons and then I would consider it to be a valid test.

  372. #373 Chris Noble
    September 26, 2007

    Have they verified this test against those who test HIV-Negative? Did you catch that it is to be used when the person has HIV-Positive Antibodies? This to me is red flag. Let’s run this test on HIV-Negative persons and then I would consider it to be a valid test.

    The experiments used to determine the specificity and sensitivity are described in the label. The manufacturers had to demonstrate that the test worked. The test has been run on HIV antibody negative persons. The specificity was extremely high.

    The test can be used to diagnose acute HIV infection. In acute infection people still test negative on antibody tests. Thus, this test can be used by iteself for diagnosis. In addition it can be used to confirm a positive reading on antibody tests.

  373. #374 carter
    September 26, 2007

    Noble, DT, Adele, Apy, Framklin.

    Why are you here? Isn’t this getting a little “old Hat” for you by now?

    Carter

  374. #375 apy
    September 26, 2007

    Am I allowed to ask you that?

  375. #376 ElkMountainMan
    September 26, 2007

    You know very well what Noreen means. The PCR tests have been validated for counting small pieces of RNA

    Epidemiology-Lisa, when you are standing at a bookshelf in the library and a hand appears at the end of the row, apparently suspended about four feet from the ground and pressing buttons on a cell phone, do you assume the hand is disembodied, somehow floating about amongst the collection of books and using a cell phone of its own accord?

    Unless you recently partook of some very serious drugs, I should sincerely hope not! Yet this is exactly what you assume of what the various HIV nucleic acid amplification tests (NAATs) detect. They amplify a nucleic acid sequence that is far too large and complex to appear on its own, by chance mutation of a human sequence (like the hand and its cell phone). They identify a sequence that is unique, not confused with any “relatives” (just as you could tell that the hand you saw was a human hand, not the paw of a dog or even the hand of a chimp). This sequence is unambiguously an integral part of the genome of a virus called HIV.

    You are not a scientist, Epidemiology-LISA, but several rethinkers do apparently have scientific credentials. Unlike you and Noreen, carter and cooler, they (should) know what DNA is, what RNA is, how PCR works, and all the rest. They have had many years now to demonstrate the existence of a single nucleic acid sequence present in the human genome or in the genome of a bacterium, fungus, or virus that could be found in a human and would have enough identity with HIV to possibly cause a false positive on these validated NAATs. Today, courtesy of Japan, the EU and the US government, nucleic acid sequence information is available to everyone with internet access. No NIH grants are needed, no well-equipped laboratories; just a computer and an internet port. The silence you hear is the sound of the Big Deniers doing nothing to find that sequence…or reporting the sequences they have found: none.

    Chris linked to the PI for the APTIMA test, but I suspect that few rethinkers will read it for fear of having to rethink.

    Samples from three low-risk groups (blood or plasma donors) were tested.
    First group: 6 out of 2508 tested positive. They were not re-tested, so we can’t conclude whether they were initial false, repeated false, or true positives in the acute phase of infection.
    Second group: 0 out of 1007 tested positive.
    Third group: 2 out of 1701 tested positive, but on re-testing were negative.

    A specificity of 99.9% is remarkable.

    For over 1000 known positive samples, sensitivity was 100%.

    To sum this up: APTIMA is a diagnostic tool, FDA-approved with a sensitivity of 100% and a specificity of almost 100%.

  376. #377 Tara C. Smith
    September 27, 2007

    Michael–knock it off with comments from “Tony Fauci.” I’m not amused. And I don’t know what you’re talking about re: holding your comments; the “Fauci” ones are the only ones from your IP that I have in my junk comment box.

  377. #378 Epidemiology-LISA
    September 27, 2007

    Unlike the viral load tests, the APTIMA test has been approved for the diagnosis of primary HIV-1 infection, as well as for confirming HIV-1 infection when tests for antibodies to HIV-1 are positive.

    Even this test requires back-up when possible. Fact is the have for along tinme used unapproved PCR tests as proof of primary infection. It was ony a matter of time before they were forced to approve one of them. And Dr. Noble get some reading glasses will ya, Noreen was talking about the viral load tests.

    Mr. Elk science lecturer. The reason why I assume the hand is not disembodied is because I daily see many instances of real hands attached to real bodies in vivo.

    Or to put it differently, how do you know the “known positive” samples are positive in the real world?

  378. #379 noreen
    September 27, 2007

    Some may be curious to know that there is a flaw with the FDA’s approval system of drugs. Per CNN, 2% of drugs, which equates to 65 million drugs do not have FDA approval and are being sold to the consumer. Surprisingly, most doctors do not know this too. The FDA apparently gives these drugs a ten-digit NDC number to track them without approval and they are legally being sold by the pharmacists. Representative Edward Markey wants the FDA to come clean with the non-approved drugs. The FDA does not have one list of these drugs and won’t say how many have been killed or injured by them. The best, at the present, that the consumer can do is to go to FDA.gov and check to see if any drug that one is taking is approved, however, not all approved drugs are may be found here. The report recommended for one to check with their doctor if a particular drug was not on the list.

  379. #380 Chris Noble
    September 27, 2007

    Even this test requires back-up when possible. Fact is the have for along tinme used unapproved PCR tests as proof of primary infection. It was ony a matter of time before they were forced to approve one of them. And Dr. Noble get some reading glasses will ya, Noreen was talking about the viral load tests.

    Noreen was talking about a test that measures actual virus rather than antibodies. All nucleic acid tests detect actual virus. Some are designed primarily for quantitation and some are designed like the Aptima test for diagnosis of HIV infection.

    Noreen wrote:

    However, I asked where has the FDA approved them or any other test for measuring the ACTUAL VIRUS? We are waiting!

    I am overwhelmed by the silence when I gave her such a test. Apparently all the denialist websites haven’t been updated since 2006.

    In reality the viral load tests, although unapproved for diagnostic purposes, had high sensitivity and high specificity when good quality control procedures were used. Many labs scored 100% specificity and 100% sensistivity using these tests compared to antibody testing.

    I can imagine what would happen if a Denialist fell off a cruise ship. The Denialist can’t swim and starts to drown. Somebody throws him/her an inflatable pool toy that was on the deck. The Denialist manages to reach the inflatable toy. Then they read the label on the toy: “Warning this toy is not intended for use as a flotation device”. The Denialist throws the toy away in disgust. The Denialist drowns.

  380. #381 noreen
    September 27, 2007

    Dr. Noble, if these tests are so accurate, as you claim, then please tell us how HIV-Negative persons have had high viral loads and why the CDC does not want this test run on HIV-Negative persons?

  381. #382 jspreen
    September 27, 2007

    In reality the viral load tests, although unapproved for diagnostic purposes, had high sensitivity and high specificity when good quality control procedures were used.

    Yeah! They’re highly sensitive and specific but that’s kept secret because the manufacturor doesn’t really want people to use hem.
    How full of shit are you, Noble? I remember, already back in december 1999 one couldn’t send a HIV=Aids questioning message to an Internet discussion forum without having a named Chris Noble on one’s back within an hour. How do you earn your living, Chris, if all you do is hangin’ around on the Internet to answer a denier post wherever and whenever it pops up? Are you payed per message? If yes, I’m quite jealous of you.
    I’ve done some nudge-nudge wink-winking to where the big money is, a year or so ago, but no reaction at all. You can read my latest attempt here. Can you check it out for me and tell me where I missed the boat? Let’s say fifty-fifty, OK?

  382. #383 Braganza
    September 27, 2007

    Dear Chris,

    I was thinking that Mullis main critic to the PCR use was that the technique amplify sequences of the virus and cannot therefore be used to quantify existing/ active viruses.

    Without quantification the use of values as viral load look hazardous. (Wrong real viral loads may explain the Rodriguez paper for example).

    The patent submitted by GENE-PROBE (the company that manufacture the APTIMA product) show that they also are detecting series of oligonucleotides that they found to be characteristic to HIV-1 and HIV-2,(see US20050153282). There is no major change over pre-existent technology, and therefore no reason for Mullis to change his comment.

    I hope that this comment could be useful, as I appreciate that you are very accurate, and well read in your comments.

  383. #384 ElkMountainMan
    September 27, 2007

    please tell us how HIV-Negative persons have had high viral loads and why the CDC does not want this test run on HIV-Negative persons?

    “HIV-Negative persons” do not have high viral loads. This is a myth from virusmyth or another rethinker group. The very few cases in which seronegative people test positive by PCR are almost certainly due to laboratory error (which should be rectified by repeat testing) or to actual acute-phase HIV-infection prior to seroconversion.

    From the APTIMA literature:
    5,200 people presumed negative by donor screening
    8 tested positive by APTIMA
    2 of the 8 were negative on re-test
    the other 6 were not retested

    I repeat: the APTIMA HIV-1 RNA test was used to test more than 5,200 people in low-risk donor populations. A total of eight (8) tested positive on the initial test. Two of these were re-tested and were negative. The remaining six were not retested. They could be false-positives due to error, they could be cases of early HIV infection, or they could be true false positives. In any case, this test has an extremely low false-positive rate. For a single test in the groups above, the rate is between 0.1 and 0.2%. Using a repeat testing protocol on the cohorts mentioned above, it would likely be somewhere between 0 and 0.1%.

    Noreen’s difficulties with giving her sources make it hard to refute her claims. Where, for example, does the CDC say that the APTIMA test should not be used for HIV-negative persons? (For that matter, why should a known HIV-negative person take the APTIMA test, anyway? I thought that rethinkers oppose testing in general, and especially in low-risk populations.)

    In terms of “high” viral loads in HIV-negative people, Noreen has clearly not read the few papers on this subject referenced by denial doctor Matt Irwin and Alive and Well. One of these papers describes one individual who had a single positive viral load test, a test that was subsequently negative. Other labs tested the original sample and found it to be negative. This indicates lab error in the original measurement, not a viral load in a HIV- person.

    Performing quantitative PCR assays is not trivial. A typical assay will require the use of several positive controls (purified HIV RNA and inactivated virus from positive serum) and negative controls (known negative serum, zero template copies). Because positive controls are present, contamination is always a possibility. It is a good practice to re-test an initial positive sample.

    The reasons for a NAAT initial positive in a low-risk, EIA-negative population, in order of decreasing likelihood, are:

    Error (equipment problems, human error including contamination)
    Actual infection in the acute phase (very low probability)
    True false-positive (may not occur at all in well-validated tests like APTIMA)

  384. #385 Braganza
    September 27, 2007

    Noreen,

    You asked:

    “Dr. Noble, if these tests are so accurate, as you claim, then please tell us how HIV-Negative persons have had high viral loads and why the CDC does not want this test run on HIV-Negative persons?”

    I may be wrong, but if the PCR assay for example is calibrated to detect HIV-1 Rev protein, it may also detect a sequence of an endogenous retrovirus, that an HIV negative person may carry.

    See details at :

    http://www.pnas.org/cgi/content/abstract/96/23/13404

    “(..)The human endogenous retrovirus K (HERV-K) family of endogenous retroviruses consists of 50 proviral copies per haploid human genome. Herein, the HERV-Ks are shown to encode a sequence-specific nuclear RNA export factor, termed K-Rev, that is functionally analogous to the HIV-1 Rev protein.(…)”

    So I think everything depends on how SPECIFIC would be the PCR. As far as I understand there is no universal standard.
    So some PCR’s assays may detect only HIV characteristic nucleic acids and others no. Only when everything would be sequenced we would have the truth.

    Your high viral load may not be a real high viral load of HIV, it all depend of the sequence been measured.

  385. #386 Adele
    September 27, 2007

    Braganza and Noreen you are both confused about what PCR is. Wikipedia tells you about PCR just look up PCR and you will find out how it works.

    HIV pcr does not measure endogenous retroviruses. This is another crap story from the deniosaurs. I do PCR alot and I some times sequence it and people I work with sequence their products they get from PCR. They never get an endogenous sequence from a exogenous retrovirus PCR. I don’t get endogenous sequences either. If their good PCR tests are totally specific. Like APTIMA, APTIMA rocks! APTIMA uses at two sequences in HIV not just one. There’s no way it measures endogenous stuff. No way in hell!

    You might think why is that? But I can’t even explain it if you don’t know what PCR is. If that’s you go take a molbio class at a college and read a little bit, you probably will understand and if you don’t ask me then I’ll tell you.

  386. #387 Adele
    September 27, 2007

    Baraganza says
    As far as I understand there is no universal standard.
    So some PCR’s assays may detect only HIV characteristic nucleic acids and others no. Only when everything would be sequenced we would have the truth.

    Well Brag the universal standard is the HIV sequence. I should say sequences. You can look them up at Los Alamos and NCBI and other places. There’s HIV-1 and HIV-2 and theres all kinds of groupings, clades under them.

    Deniosaurs are all like, but dudez it mutates so much no way you can measure it! Yes there is some parts of the genome are totally conserved or close to it. Those are the parts they use for PCR! They pick them because they’re the same in different clades AND listen up deniosaurs they’re not in other stuff! Like the human genome! Or other retroviruses we know about! HIV PCR doesn’t meausre endogenous retroviruses.

    Brag people did think about this stuff when they made the PCRs. And they did sequences their pcr products.

  387. #388 Adele
    September 27, 2007

    cooler or should I say BillyBipBip is back in action with the 9-11 Twoofers, comment from Sept 25 2007

    http://www.911blogger.com/node/11604

    Who can deny this is our very own cooler except cooler himself??

  388. #389 Epidemiology-LISA
    September 27, 2007

    The PCR test uses the antibody test as reference, the antibody test uses another antibody test or the PCR test as for reference. Some of us arenot nearly as impresse dwith this amazing feat that they can make the different tests correlate well with each other. They’ve had 20 years of bilions of dollars to work on it.

    In the commercial break Dr. Noble linked for us above – you know the “APTIMA rokcs!” message – you can find this not nearly as cut and dried statement:

    This test has important implications for medical diagnostic use because it could be a potential alternative to the traditional Western blot test now used for confirmation of HIV-1 infection when screening tests for HIV-1 antibodies are positive. In addition, the Western blot can, in some instances, be difficult to interpret and may not always provide a conclusive result.

    The Aptima’s specificity was measured against Western Blot, I presume. However there are difficulties with “interpreting” the Western Blot which might make Aptima more specific than its own gold standard reference. . . Same thing with the sequenced “HIV genome”.
    PCR picks up what it’s been primed to pick up. if it’s been primed to pick up sequences in advance decided upon as HIV specific, it’s not that amazing when it succeeds in doing that.

    A good faith question for Adele: If PCR picks up preserved sequences of the HIV genome, how come the same test kit couldn’t pick up all strains from the beginning, but had to be compared with other test kits, refined, compared yet again, refined yet again and so on?

  389. #390 Braganza
    September 27, 2007

    Adele,

    You should know more than me about PCR because you are working with it, and I am not even a biologist. My knowledge of PCR is limited to a small number of papers/patents/web pages that I have been looking at, and mainly to the info from this blog.

    If I understand you well, PCR of HIV would just pick up sequences that would be specific to the virus.

    But how can we be sure that there is no another virus which would have an evolutionary link with HIV?

    The paper that I picked up is from 1999. I assume that the info there published was unknown until 1999.

    I assume that in 2007 many others viruses are not yet known, and still many more are not fully sequenced.

    So, as not everything on viruses is known, how the persons who develop PCR’s would know =?

    My answer would be (I may be wrong) guesswork and using assays such as the one that ElkMountainMan reported in his post. If the particular set of people, participating in the assay, don’t have a particular group of retroviruses that may have an evolutionary link with HIV, and may exist in another specific set of people, the indicated assay may still led to false positive. At this stage, could you exclude this hypothesis ?

  390. #391 Braganza
    September 27, 2007

    Adele,

    I forget. Thanks for Wikipedia connection.

  391. #392 Adele
    September 27, 2007

    Tony-Lisa,

    Positive control for APTIMA HIV-1 test is purified reference standard. It’s the virus sequence itself you know the one from virions we isolated in the sucrose gradients. You know the sequence you don’t find in human’s genome. You know the one whose closest relative is HIV-2 and then SIV and other mamal’s lentiviruses. You know the one thats as much like a endogenous retrovirus as a bus and an airplane.

    You like word games I know it’s so fun to say everything is circular logic and “gold standard” and stuff like that you get from the little denial manuals but in the end you’re just ignoring the facts and talking about very simple things you don’t let yourselve understand. Your like me trying to teach literature grad students about Leda and the sawn well except I would like to learn more about Leda and swans.

  392. #393 apy
    September 27, 2007

    Per CNN, 2% of drugs, which equates to 65 million drugs do not have FDA approval and are being sold to the consumer.

    Noreen, you need to work on your reading comprehension. Or you need to get better sources. Per the CNN article, that equates to 65 million prescriptions, not drugs. That is a huge difference.

    I’m also unsure of what your point here is. Are you trying to say since the FDA’s approval system is a hole in it that you cannot trust any prescription? Are you saying this applies to viral load tests too some how?

    You also don’t paint the full picture do you. On the FDA side is:

    “It’s not that simple to just sweep all these drugs off the market,” said Deborah Autor, director of compliance at the FDA. “Some of these products — not the majority — but some of these products are medically necessary.”

    On top of that, a number of the drugs people have issue with is it being used for off-label treatment. Oh yes, off-label, what was the quote you had on that?

    Even today, many progressive doctors,like Dr. Zagon, think outside of the box and use a drug off-label, which works instead of the old I don’t care to learn new tricks attitude and I have treated diseases a certain way for eons and will continue to do so.

    Here is the quote from the article:

    Last year, for example, the FDA ordered firms to stop marketing unapproved medicines containing quinine. While approved for use against malaria, a life-threatening illness, quinine was never approved for its other common usage — treatment of leg cramps. The drug has been linked to 665 reports of “adverse events,” including 93 deaths, according to the FDA.

    Trying to give the original article that noreen failed to provide gives me a 403 Forbidden on giving the comment so i tinyurl’d it.
    http://tinyurl.com/3dc63s

  393. #394 Adele
    September 27, 2007

    Braganza good questions, there’s always possible there’s other viruses out there we didn’t see yet.

    We can say HIV-1 PCR doesn’t measure endogenous retroviruses. That’s because we know all the endogenous retroviruses and even the stuff related to them in humans. Plus before the genome got published there was data about how HIV probes can stick to stuff in the human genome and they looked at what itt was. It was published in Horwitz MS et al in the Journal of Virology 1992. And they found just two sequences and they were very small and they weren’t apart of any working endo virus any way. They wouldn’t affect the HIV-1 PCR.

    So then what the exogenous retroviruses? There’s probably lots we don’t know yet that’s true. It’d be strange if there was one that’s close enough to HIV in all the parts we use in PCR testing that it gets recognized. But still different in the other parts so you could call it a different virus. It’s possible though, I guess. It would have tobe real close to HIV by evolution and that would be very interesting to study and maybe could help against HIV infection. That’s all still hypathetical but it is possible I admit that. And other people know that to, that’s why doctors want to get confirmation of antibody test with Western blot and viral load, more confirmation says definitely this is HIV not a HIV related virus we don’t know yet.

  394. #395 noreen
    September 27, 2007

    Yes, it was 65 million prescriptions and it wasn’t in an article but on the news this morning. The point is that the FDA is not always on top of their game in regards to many drugs including HIV drugs. Most of you can believe in HIV, viral load tests, CD4′s and antibody tests if you like but many of us who defile what is considered normal do not. Currently, I have no reason to trust them. Obviously, they are usee as a tool but not a good one for many of us or otherwise we should be extremely sick.

  395. #396 apy
    September 27, 2007

    Most of you can believe in HIV, viral load tests, CD4′s and antibody tests if you like but many of us who defile what is considered normal do not.

    Maybe because you don’t know a thing about any of those and prove it over and over again but for some reason, perhaps you have seen too much of The View, you think an uneducated opinion is some how better than an educated one.

  396. #397 DT
    September 27, 2007

    Noreen,
    Can you post references to some studies where “HIV-negatives have high viral loads” please?

  397. #398 cooler
    September 27, 2007

    Adele, im sorry, kathy bates from the movie misery,
    Are you so pathetic you have nothing to do but troll the internet like the loser that you are? oh sorry forgot you are that pathetic. Ive posted my 9/11 beleifs all over these blogs its no secret you idiot, 9/11 seems to have been a false flag operation, Id rather beleive that, then be a miserable loser like you are.

    Millions of people are coming to this belifs, including 150 architects from the bay area, who should I trust you, a loser with no job who trolls the internet all day, or them?

  398. #399 cooler
    September 27, 2007

    http://www.ae911truth.org/

    architects for truth

    millions of people think 9/11 needs to be reinvestigated see loose change, most watched movie ever online google it

    as for going off topic, Misery women (Adele) brought up 9/11 not me.

  399. #400 Epidemiology-LISA
    September 27, 2007

    Positive control for APTIMA HIV-1 test is purified reference standard. It’s the virus sequence itself you know the one from virions we isolated in the sucrose gradients. You know the sequence you don’t find in human’s genome. You know the one whose closest relative is HIV-2 and then SIV and other mamal’s lentiviruses. You know the one thats as much like a endogenous retrovirus as a bus and an airplane.

    No Adele I didn’t know all that. So what you are saying is in determining the specificity of APTIMA you simply check if it picks up what it is primed to pick up?

    Based on “isolated virions” as depicted here?

    http://healtoronto.com/hiviso.html

    Which must be a deadly pathogen because the genetic sequence is not found in the human genome?

    That’s all very interesting; I thank you for volunteering that information. However my specific question for you was this – frankly I don’t know how you could miss it – if the “purified reference standard” for the PCR tests are highly preserved sequences of the “HIV genome”, how come one and the same test kit couldn’t pick up all strains from the very beginning? I might now add, how was it determined that there was such a thing as a problem of false-negatives?

  400. #401 Adele
    September 27, 2007

    BillyBipBip,

    I wasn’t looking for you I was looking up Dr. Lo and HIV on google. I wanted to learn more about Dr. Lo bc your talking about this all the time. One of the hits was you BillyBipBip! Thats the TWOOF.

    Remember you told us “I’m not Billy but I know Billy” but there’s BillyBipBip saying teh same stuff as you! HaHa! Why did you lie to us?

    “False flag” Billy? Let me tell you about false flag. If there was a secret conspiracy for HIV and AIDS they would hire people who pretend they were deniosaurs and say crazy stuff and discredit the deniosaurs. They would say stuff like viral load measures antibodies and they would sign off cooler or jan spreen and carter and noreen. Thing is, there’s no conspiracy so what the heck you’re really serious aren’t you? Wow amazing.

    BTW stay out of buildings those “architects” design! Do they shield them with tin foil fromn the zionist mind control rays? Ha.

    Noreen, did you ever find those quotes about Amplicor and Abbott? You still can’t find them I guess.

  401. #402 cooler
    September 27, 2007

    thanks misery women,
    youre insight is very compelling. LOL

  402. #403 Adele
    September 27, 2007

    Tony-Lisa,

    Please don’t give me a healtoronto site tell me what the original is.

    in determining the specificity of APTIMA you simply check if it picks up what it is primed to pick up?

    Umm, tony check out “specificity” and “sensitivity” and rephrase that question. Well who cares, you confused them that’s ok. We all make mistakes.

  403. #404 Adele
    September 27, 2007

    Tony,

    How should I measure rainfall? How do I know if a telescope works? I give a rain gage water and I give a telescope light. Thats what their designed to measure. That’s what you use for benchmarks.

    APTIMA too. Its designed to measure HIV. You test it using a HIV you purified. What do you think they should use a bicycle tire?

  404. #405 Epidemiology-LISA
    September 27, 2007

    lol! In other words Ms. I-do-PCR-tests-myself on the stuff
    I keep in my -80 degree freezer next to the macaque poopoo, you can’t answer even the simplest questions, or are you just buying time waiting for the AIDStruth cavalry to come and bail you out? lol again!

    Seriously, Adele, you didn’t really think you could get away with prancing around endlessly berating everybody for their lack of understanding of PCR without ever getting caught with a little of that bluffer’s DNA on your hands did you?

    Or do you imagine Noreen, Cooler and the rest haven’t noticed you’re falling apart? But hey, at least Braganza is impressed with your obvious PCR expertise. The word was specificity, as in “HIV specific”. “Sensitivity”, or lack thereof, comes under the false-negative question. If that’s already too diffcult for you to grasp, it just goes to show you do have to know the common ABC before you can get to PCR.

  405. #406 Chris Noble
    September 27, 2007

    Noreen, from your own accounts you are taking an unapproved drug.

    Low dose naltrexone has not been approved by the FDA. It has not been approved for the treatment of HIV infection (or AIDS if you deny that HIV exists or causes AIDS).

  406. #407 Chris Noble
    September 27, 2007

    Or do you imagine Noreen, Cooler and the rest haven’t noticed you’re falling apart? But hey, at least Braganza is impressed with your obvious PCR expertise. The word was specificity, as in “HIV specific”. “Sensitivity”, or lack thereof, comes under the false-negative question. If that’s already too diffcult for you to grasp, it just goes to show you do have to know the common ABC before you can get to PCR.

    The one falling apart is you. You don’t measure specificity by seeing whether it picks up HIV sequences when it should. That is sensitivity. You measure specificity by making sure that it doesn’t pick up HIV sequences when it shouldn’t ie. in non infected people.

    If you are going to pretend to lecture somebody then at least make sure that you understand what is being said.

    Several people here put in a large amount of effort to answer your questions no matter how rhetorical and silly they are. Every time one of your questions is answered you change the subject or go off in another denialist tangent.

    I answered Noreen’s demand for an FDA approved test that detected actual virus. In a fair world I would expect something like:

    “Yes, you are right. I was wrong. There are nucleic acid tests that are approved for the diagnosis of HIV infection by the FDA. I shouldn’t believe everything I read on Denialist websites. I will reevaluate my position based on this new information”

    Instead we’re back at the HIV has never been isolated “debate”.

  407. #408 noreen
    September 27, 2007

    Dr. Noble, you are right the high priest of the FDA has blessed this test but that doesn’t prove HIV causes AIDS nor does it prove that any tests have been validated. You guys are the ones on a sinking ship and need a life-line!

    And the FDA has approved LDN many years ago, which is not in the same category as the unapproved drugs. LDN is being used off label, which many drugs are used for by the way.

  408. #409 Chris Noble
    September 27, 2007

    Dr. Noble, you are right the high priest of the FDA has blessed this test but that doesn’t prove HIV causes AIDS nor does it prove that any tests have been validated. You guys are the ones on a sinking ship and need a life-line!

    Noreen, all this does is demonstrate that no matter how many times you are shown that the “information” you regurgitate from Denialist websites is inaccurate you won’t alter your beliefs one iota.

    And the FDA has approved LDN many years ago, which is not in the same category as the unapproved drugs. LDN is being used off label, which many drugs are used for by the way.

    The article that you mentioned describes exactly this problem of a drug approved for one purpose but prescribed for another.

    Last year, for example, the FDA ordered firms to stop marketing unapproved medicines containing quinine. While approved for use against malaria, a life-threatening illness, quinine was never approved for its other common usage — treatment of leg cramps. The drug has been linked to 665 reports of “adverse events,” including 93 deaths, according to the FDA.

  409. #410 Epdemiology-LISA
    September 27, 2007

    Ah just as I thought, the cavalry has arrived. Listen Dr. putting-a-lot-of-paid-effort-into-your-answers-Noble,

    You don’t measure specificity by seeing whether it picks up HIV sequences when it should. That is sensitivity. You measure specificity by making sure that it doesn’t pick up HIV sequences when it shouldn’t ie. in non infected people,

    According to Adele, there is no question of “picking up when it should”. The test is confirmation unto itself that it only picks up “when it should”, because it is by virtue of its primers 100% a priori HIV SPECIFIC.That’s what THAT was about.

    As you might have noticed I was speaking of sensitivity in exactly the context you deem appropriate.These were the words:

    “Sensitivity”, or lack thereof, comes under the false-negative question., False-negative = “to do with whether it picks up HIV when it should”. Get it now? Fer cripe sake, don’t they pay you enough to buy a new pair of reading glasses, Dr, Noble. Then again looking at your abysmal performance these days it’s a wonder they don’t just retire you.

    Howbeit, my actual question, General Custer, didn’t contain either of the words “specificity” or “sensitivity” and, although you’re sligthly better at the divert-and-obfuscate game than poor Adele, we’ve all noticed that yo uhaven’t answered it either, although I’m sure a lot of effort went into your bowel movements in producing above non-answer.

    So I suggest he 7th cavalry ups its game or calls in Petraeus, cuz Crazy Horse isn’t even breaking a sweat so far.

  410. #411 franklin
    September 27, 2007

    Braganza,

    You seem to confused about how PCR assays work when you say:

    I may be wrong, but if the PCR assay for example is calibrated to detect HIV-1 Rev protein, it may also detect a sequence of an endogenous retrovirus, that an HIV negative person may carry.

    See details at :
    http://www.pnas.org/cgi/content/abstract/96/23/13404

    “(..)The human endogenous retrovirus K (HERV-K) family of endogenous retroviruses consists of 50 proviral copies per haploid human genome. Herein, the HERV-Ks are shown to encode a sequence-specific nuclear RNA export factor, termed K-Rev, that is functionally analogous to the HIV-1 Rev protein.(…)”
    So I think everything depends on how SPECIFIC would be the PCR. As far as I understand there is no universal standard.
So some PCR’s assays may detect only HIV characteristic nucleic acids and others no. Only when everything would be sequenced we would have the truth.

    PCR assays do not detect proteins–they detect nucleic acids. The specificity of the detection of a nucleic acid by a PCR assay is not affected by whether or not the protein encoded by that nucleic acid is functionally analogous to another protein. The specificity is determined by the nucleotide sequence of the nucleic acid and of the primers designed based upon that nucleotide sequence.

    As noted in the paper that you cited, the Human Endogenous Retrovirus K (HERV-K) family shows no sequence homology to HIV Rev. This means that primers specific for the HIV rev gene will not detect HERV-K sequences, even though HERV-K encodes a protein that is functionally analogous to HIV Rev.

    This may come as news to you, but the complete genome sequences of HIV-1 and HIV-2 have been published.

  411. #412 Chris Noble
    September 27, 2007

    Elisa your question did contain the word “specificity” and the way you used it indicated that you didn’t understand its meaning.

    No Adele I didn’t know all that. So what you are saying is in determining the specificity of APTIMA you simply check if it picks up what it is primed to pick up?

    The allegation made by Noreen was that there aren’t any tests approved by the FDA for detecting actual virus as distinct from antibodies.

    This was easily shown to be false.

    Now instead of admitting that Noreen (and the denilaist websites she copied from) were wrong you launch into another fruitless denial of reality.

    The evidence that the Aptima test works as described is given in the document I linked to.

    Now in a surreal twist we’ve moved back to HIV has never been isolated crap. This is the default crank position to falll back to whenever evidence gets in the way of denial. Its a step in the rejection of science. The next step is to reject the “germ theory of disease”.

  412. #413 Chuck
    September 27, 2007

    From 1998 through 2005, approximately 81,000 HIV tests were given to men and women in the adult film industry (aka, porn stars) in the greater Los Angeles area, according to Gloria Leonard.

    Those 18-25 year olds surely engage in more condomless, recreational sex than any other occupational category.

    Yet a grand total of 11 or one in over 7,000 actually tested positive for HIV antibodies. Mon dieu!!!

    I know there is a good, sound, evidence-based explanation for this development and I am equally certain that there are logical, scientifically-inclined folks here who can provide it.

    I will be all ears and eyes.

    Ready, set, go!

  413. #414 franklin
    September 27, 2007

    Hey Chuck,

    Do you have a reference for this factoid?

  414. #415 Epidemiology-LISA
    September 27, 2007

    My dearest general Noble Custer, how can you expect to discuss the specificity of NATs without getting into the question of isolation and “identification” of socalled “HIV”?

    The document didn’t tell me what was used as gold standard for determining that “the Aptima test works as described”. Adele told me it was the sequenced HIV that was used as reference. That led to 2 questions

    1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

    2. PCR is HIV specific because it targets unique preserved parts of the HIV genome, courtesy of Adele, so why can’t the same kit pick up on all strains?

    I have now asked 4 times, all I get is whining. Could you not at least whistle Garryowen or something?

  415. #416 Epidemiology-LISA
    September 27, 2007

    My dearest general Noble Custer, how can you expect to discuss the specificity of NATs without getting into the question of isolation and “identification” of socalled “HIV”?

    The document didn’t tell me what was used as gold standard for determining that “the Aptima test works as described”. Adele told me it was the sequenced HIV that was used as reference. That led to 2 questions

    1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

    2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can’t the same kit pick up on all strains.

    I have now asked 4 times, all I get is whining. Could you not at least whistle Garryowen?

  416. #417 Tara C. Smith
    September 27, 2007

    Chuck,

    Certainly you realize porn stars aren’t exactly a representative cross-section of society, right? And that they can’t work if they’re found to be HIV+?

    As has been mentioned any number of times here, it’s not the simple act of having sex that causes one to come into contact with HIV–it’s having sex with an HIV-infected partner. Porn stars are screened much more frequently for HIV and other STDs than the general population, and if they test positive, they’re out of a job–and hence, out of the pool of partners in films. Therefore it’s not surprising that only a small number of them would test positive for the virus.

    However, these stats, if true (I’d like a reference also), do show that the HIV antibody test doesn’t produce nearly as many false-positives as deniers claim it does…

  417. #418 Michael
    September 27, 2007

    Tara said:

    “However, these stats, if true (I’d like a reference also), do show that the HIV antibody test doesn’t produce nearly as many false-positives as deniers claim it does…

    Tara, how is it that YOU PERSONALLY know that the eleven out of 7000 are actually positive, and not also false positive?

    Do tell how you have verified this. After all, the manufacturers claim only 99% accuracy. Surely 11 out of 7000 falls right in with their 1% false results.

  418. #419 franklin
    September 27, 2007

    Hey Michael,

    Do you have a reference for this factoid?

  419. #420 Michael
    September 27, 2007

    Hey Franklin. You like references to factoids?

    How’s this from the Sept. 1 edition of The Journal of Immunology?

    A quote from the researcher: “”But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS”

    Source: http://www.sciencedaily.com/releases/2007/09/070906145322.htm

    Franklin, as well as Chris, Elk, DT, et al:

    Care to explain why HIV positives are being given your much touted HIV drugs according to their CD4 count when obviously CD4 counts have NOTHING TO DO WITH PROGRESSION TO AIDS?

    By the way, You guys have been telling us for 20 years that HIV depletes CD4 cells which results in AIDS. Seems you have again been mistaken.

    We dissidents are patiently waiting for your explanation and apologies.

  420. #421 Michael
    September 27, 2007

    And Franklin, Chris, Tara, Adele, Elkmountain and the rest of TEAM VIRUS, after you finish explaining to us all why CD4 cell counts have nothing to do with progression to AIDS after telling us for 20 years that it does, then please explain this one:

    BMJ-British Medical Journal / September 10, 2007

    http://www.sciencedaily.com/releases/2007/09/070906145322.htm

    Science Daily — Virological evidence cannot prove transmission in HIV criminal cases, warn experts in the British Medical Journal.

    But yet, it was through fraudulent virological evidence that TEAM VIRUS had framed Andre Parenzee and Dr. Acer, Kim Bergalis’s dentist in Florida, and many others who have been found guilty of spreading your favorite fantasy microbe.

    Again, we dissidents are waiting for your full explanation and apologies.

  421. #422 franklin
    September 27, 2007

    Michael,

    Based upon the reference you provided, I conclude that you accept SIV as a valid animal model for AIDS.

    Congratulations, that is a big first step for you.

  422. #423 Tara C. Smith
    September 27, 2007

    Michael, I don’t–hence the request for a reference. But even if they’re all false-positive, that’s still only 11 out of 81,000–.01%, Michael–certainly a far cry from the figures I often see cited on denialist postings.

  423. #424 Michael
    September 27, 2007

    Franklin, your non answer says it all. It says HIV and you yourself are total frauds.

    Keep trying, Frankie. And after you explain the last two, then explain the latest from BMJ Specialty Journals
    Date: September 14, 2007

    Science Daily — Differences in sexual behaviours do not fully explain why the US HIV epidemic affects gay men so much more than straight men and women, claims research published ahead of print in the journal Sexually Transmitted Infections.

    But I thought TEAM VIRUS claimed that HIV was sexually transmitted. Here is another study that shows the theory to be total nonsense.

    Hurry Franklin, your favorite fantasy is falling apart. Explain these three current research pieces fully, since YOU are telling us the virus kills cd4 cells to cause AIDS, and you are the one telling us how wonderful gene sequencing is at determining hiv infection and who infected who, and you are the one telling us how sexually transmissable the invisible virus that you yourself have never seen.

    Franklin. Your big ship HIV lollipop is slowly sinking. Enjoy the trip.

  424. #425 ElkMountainMan
    September 27, 2007

    This is exchange with intelli-snob E-LISA is unfortunately not particularly profitable.

    In all of Epidemiology-LISA’s semantic wriggling, he has chiefly underscored his own ignorance of the basic terminology of this debate. Knowledge of the difference between “specificity” and “sensitivity” is elementary, and using either of these terms improperly in a discussion of diagnostic or screening assays is inexcusable for one as confident and brash as Epi-LISA has been on this thread. That E-LISA continues to defend his poor writing and debate skills, after having his mistakes revealed by both Chris and Adele, signals that his denial does not restrict itself to HIV and AIDS.

    Credentials in a scientific discipline, or any discipline for that matter, are unnecessary for participation here. I think of Braganza, who has asked several apparently honest questions. Braganza has made several errors (as Adele and Franklin noted) but has also emphasized that he or she is not a scientist. Questions asked, answers given, conversation continued.

    E-LISA, though, imagines that he is more learned than any other on aetiology, dropping references to mythology and Umberto Eco. All the while, he revels in his own ignorance of science, an ignorance that he refuses to correct in any sense. And he takes refuge in his personal interpretation of the meaning of a particular word, ignoring its use in the wider world.

    Ignorance–with admission–is fine with me. Self-indulgent ignorance that pretends to knowledge and wisdom is abhorrent.

  425. #426 Michael
    September 27, 2007

    http://www.sciencedaily.com/releases/2007/09/070913132930.htm

    In 2005, over half of new HIV infections diagnosed in the US were among gay men, and up to one in five gay men living in cities is thought to be HIV positive.

    Yet two large population surveys showed that most gay men had similar numbers of unprotected sexual partners per year as straight men and women.

    US researchers applied a series of carefully calculated equations in different scenarios to study the rate at which HIV infection has spread among gay men and straight men and women.

    They used figures taken from two national surveys to estimate how many sex partners gay men and straight men and women have, and what proportion of gay men have insertive or receptive anal sex, or both.

    They then set these figures against accepted estimates of how easily HIV is transmitted by vaginal and anal sex to calculate the size of the HIV epidemic in gay men and straight men and women.

    The results showed that for the straight US population to experience an epidemic of HIV infection as great as that of gay men, they would need to average almost five unprotected sexual partners every year.

    This is a rate almost three times that of gay men.

  426. #427 Michael
    September 27, 2007

    Hey Elkie. So you think YOU are Mr. Science? Then please fill us in on the 3 recent cites I just posed to Frankie, cause it seems he ran off with his tail between his legs.

    Explain why this months journals say that CD4 count has nothing to do with progression to AIDS. After all, you too have told us it is all-important.

    Explain why virological evidence is USELESS at determining if someone spread HIV to anyone else. After all, you have claimed that a dentist gave it to his patient!

    Explain why the sexual transmission belief is now exposed as fraud! After all, you are claiming HIV is sexually transmitted.

    All the while, you revel in your own ignorance of science, an ignorance that you refuse to correct in any sense. And you take refuge in your personal interpretation of the meaning of a particular word, ignoring its use in the wider world.

    Ignorance–with admission–is fine with me.

  427. #428 E-Lisa
    September 27, 2007

    My dearest general Noble Custer, how can you expect to discuss the specificity of NATs without getting into the question of isolation and “identification” of socalled “HIV”?
    The document didn’t tell me what was used as gold standard for determining that “the Aptima test works as described”. Adele told me it was the sequenced HIV that was used as reference. That led to 2 questions

    1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

    2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can’t the same kit pick up on all strains.

    I have now asked 4 times, all I get is whining. Could you not at least whistle Garryowen?

  428. #429 Chris Noble
    September 27, 2007

    Michael do you read the articles that you link to?

    But to end the HIV epidemic, gay men would need to have rates of unprotected sex several times lower than those currently evident among the straight population. This is because transmission rates are higher for anal sex than they are for vaginal sex, say the authors.

  429. #430 franklin
    September 27, 2007

    Michael,

    Here is your first question:

    Hey Franklin. You like references to factoids?

    How’s this from the Sept. 1 edition of The Journal of Immunology?

    A quote from the researcher: “”But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS”

    Source: http://www.sciencedaily.com/releases/2007/09/070906145322.htm
    Franklin, as well as Chris, Elk, DT, et al:

    Care to explain why HIV positives are being given your much touted HIV drugs according to their CD4 count when obviously CD4 counts have NOTHING TO DO WITH PROGRESSION TO AIDS?

    By the way, You guys have been telling us for 20 years that HIV depletes CD4 cells which results in AIDS. Seems you have again been mistaken.

    Your criticism is based on results obtained studying SIV infection of monkeys. I was impressed that you accept that results using the SIV model are relevant to human AIDS, since this acceptance indicates that you beleive SIV infections of monkeys is a valid model of human AIDS.

    As usual, the answer to your question is present in the very paper to which you directed us:

    SIV Infection Of Natural Hosts Provides New Insights Into HIV Disease Complexity

    Science Daily — Three related papers published in the Sept. 1 edition of The Journal of Immunology provide key new insights into the complexity of HIV/AIDS.

    Don Sodora, Ph.D., a principal investigator in SBRI’s Viral Vaccines Program who recently joined SBRI from the University of Texas, Southwestern Medical Center, is senior author on one of three papers that collectively show CD4 T-cell depletion, a critical symptom of AIDS, is likely a part of a multifaceted scenario that triggers disease rather than the only cause.

    In an HIV-infected person, CD4 T-cells (white blood cells that play a central role in creating immunity) decline and, at a certain point, the person gets sick and dies. This rapid and dramatic loss of CD4 T-cells is considered to be a key determinant of AIDS disease. However, in natural hosts, like the sooty mangabey (an African monkey species), simian immunodeficiency virus (SIV) induced CD4 T-cell depletion can be comparable to that in humans, but the monkeys do not show clinical signs of AIDS. “Our assessment of these natural hosts like mangabeys offers insight into the disease and shows us that progression to AIDS likely results from the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction,” said Sodora.

    Sodora’s paper provides evidence, using the sooty mangabey SIV natural host, that virally induced CD4 T-cell depletion, by itself, is not sufficient to induce AIDS in a natural host. “When we first observed the dramatic CD4 depletion in all the tissues we examined in these monkeys, we were concerned that they might begin to exhibit clinical signs of AIDS,” said Jeffrey Milush, Ph.D., lead author on the paper. “But after more than six years, we are sure that CD4 depletion by itself does not necessarily result in progression to AIDS”.

    The conventional view that HIV is the cause of AIDS does not depend on the straw man argument that the pathogenesis of AIDS is entirely the result of CD4 T cell depletion. As the very paper you cite states, CD4 T-cell depletion is merely one of the key events in the pathogenesis of AIDS.

    According to the reference you cite, processes beleived to contribute to the pathogenesis of AIDS include: “the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction.”

    I hope that you find this information helpful, Michael. I know it is hard for you to read all of the words in an article while burying your head in the sand.

  430. #431 franklin
    September 27, 2007

    Lisa,

    Do you have a reference to the scientific literature to support your factoid that the PCR kit can’t pick up all strains.

    If you can provide such a reference, I’m certain that the answer to your question will be revealed.

  431. #432 Chris Noble
    September 27, 2007

    1. How could the test possibly not be declared 100% HIV specific, when primers already declared HIV specific are used?

    The primers that are chosen are believed to be specific to HIV. You can easily do a BLAST search to check the nucleotide databases for any other organisms with the same sequence. However, to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections.

    2. PCR is HIV specific, because it targets preserved parts of the HIV genome, courtesy of Adele, so why can’t the same kit pick up on all strains.

    The term is “conserved” not preserved. The primers that are chosen are from highly conserved regions of the HIV genome. These sequences remain relatively constant across different strains. There is still a possibility that a given primer will not pick up some HIV with mutations in this region. To ensure that the test detects most HIV strains they check the sensitivity against a panel of different HIV subtypes.

  432. #433 franklin
    September 27, 2007

    Michael,

    You have asked three questions based upon recent press releases.

    Anyone who actually reads the press releases to which you refer will see that the actual articles disagree with your conclusions.

    As usual, your interpretation of the articles is limited by the fact that your head is buried in the sand.

  433. #434 Chris Noble
    September 27, 2007

    Those 18-25 year olds surely engage in more condomless, recreational sex than any other occupational category.

    Yet a grand total of 11 or one in over 7,000 actually tested positive for HIV antibodies. Mon dieu!!!

    As Tara has already pointed out you do not become infected through unprotected sex, you become infected through unprotected sex with somebody that is infected with HIV.

    If the adult film workers are not infected with HIV then they can’t infect anyone no matter how much unprotected sex they have. Put one hundred HIV- people in a room and let them have as much unprotected sex they want and none of them will become infected with HIV.

    The adult film industry undergos the most rigorous HIV testing in the world. The actors are regularly tested and if found to be positive they are excluded.

    There is a small chance that somebody in the acute infection stage may not be picked up.

    This is exactly what happened in 2004.

    le
    Epidemiologic Investigation of a Cluster of Workplace HIV Infections in the Adult Film Industry: Los Angeles, California, 2004

  434. #435 Franklin
    September 27, 2007

    Chris,

    Thanks for that reference.

    It not only clears up Chuck’s question, but it illustrates the combined epidemiological/virological approach advocated by one of the press releases to which Michael referred us.

    And it illustrates heterosexual transmission of HIV during the “window phase” of primary infection.

  435. #436 carter
    September 28, 2007

    Looking back at these last posts by Team Virus; great examples of the Orwellian Doublethink spewed from the pulpit of the AIDS church. These high and mighty proponents havent got a clue that their sanctimoniously protected research is falling apart.

    They cannot answer anything without rose colored AIDS/HIV glasses, and/or repeating over and over and over “HIV causes AIDS”….

  436. #437 Epidemiology-LISA
    September 28, 2007

    Dr. Noble-Custer thank you for the revelation that the primers are believed to be HIV specific. I’m also mightily impressed with you referring to the BLAST searches. WE’ve also already beenover the “to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections” thank you

    The question was how do you know the samples you use to test your new PCR test kit are positive or negative? Adele says it’s measured against the sequenced HIV genome, what say you?

    There is still a possibility that a given primer will not pick up some HIV with mutations in this region

    THANK YOU FOR THAT DR. NOBLE. NOW WE’RE GETTING SOMEWHERE. Our do it yourself PCR expert, however, said this:

    Deniosaurs are all like, but dudez it mutates so much no way you can measure it! Yes there is some parts of the genome are totally conserved or close to it. Those are the parts they use for PCR! They pick them because they’re the same in different clades (Adele)

    Well apparently not always the same in the relevant sense, Adele. So you “refine” the tests with reference to each other, change the primers if they don’t work in the PCR case and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

  437. #438 cooler
    September 28, 2007

    The padian study showed that hiv is virtually non contagious 0 seroconversions when serodiscordant couples had unprotected sex………..one of the many strange things about hiv

    Strange how 99% animals injected doesnt get AIDS and die

    Strange how it it only infects 1/1000 blood t cells

    strange how most viruses wreak havok before antibodies, thats why we get vaccines not 10 yrs later

    strange how no one really knows after 20 years how it destroys the immune system over 10-20 yrs

    You might not totally agree that this is proof that hiv is harmless……………..but its a debatable issue, just bc the government says so it doesnt mean its true

    See hiv fact or fraud google it

    REad Project Day Lily……..dr shyh ching lo md phd injected, a brilliant army scientist this into every animal and they all died, found in CFS/many AIDS cases etc google project day lily, the most fascinating book ever/

    Read how the people in charge of the bioweapons program are laughing at doctors for blaming hiv when mycoplasma incognitus is the only microbe to worry about. go on pub med to see Lo’s work, here is some it

    http://www.aegis.com/pubs/atn/1990/ATN09501.html

  438. #439 E-Lisa
    September 28, 2007

    Dr. Noble-Custer thank you for the revelation that the primers are believed to be HIV specific. I’m also mightily impressed with you referring to the BLAST searches. But we’ve also already been over the “to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections” thank you.

    The question was how do you know the samples you use to test your new PCR test kit are positive or negative? Adele says it’s measured against the sequenced HIV genome, what say you?

    There is still a possibility that a given primer will not pick up some HIV with mutations in this region

    THANK YOU FOR THAT DR. NOBLE. NOW WE’RE GETTING SOMEWHERE. Our do it yourself PCR expert, however, said this:

    Deniosaurs are all like, but dudez it mutates so much no way you can measure it! Yes there is some parts of the genome are totally conserved or close to it. Those are the parts they use for PCR! They pick them because they’re the same in different clades (Adele)

    Well apparently not always the same in the relevant sense, Adele. So you “refine” the tests with reference to each other, change the primers if they don’t work in the PCR case, and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

  439. #440 cooler
    September 28, 2007

    THATS WHY YOUVE NEVER HEARD OF IT SON, PART OF THE BIOLOGICAL WEAPONS PROGRAM, MYCOPLASMA INCOGNITUS/PENETRANS, LEARN ABOUT KOCHS POSTULATES, EVERY ANIMAL PRIMATES/MICE/EMBRYOS LO’S INJECTED WITH THIS DIED, HE DID NOT FIND IT IN ANY HEALTHY CONTROLS

    DO YOU THINK ITS A COINCIDENCE THAT AN ARMY SCIENTIST IN CHARGE OF THE BIOWEAPONS PROGRAM JUST HAPPENED TO KNOW SO MUCH ABOUT THIS NOVEL STRAIN? HE WAS ALLOWED TO PUBLISH BC HE FOLLOWED ORDERS WELL AND THE HIGHER UPS REWARDED HIM BY LETTING HIM PUBLISH………..TO BAD EVEN THOUGH WORLD RENOUN SCIENTISTS LIKE TULLY AND MONTAGNIER KNEW IT WAS A THREAT TO HUMANITY FAUCI SABOTAGED IT AND CAUSED GENOCIDE.

    http://WWW.PROJECTDAYLILY.COM

    MOST SCARY STORY SLIGHTLY FICTIONILIZED TO STAY OUT OF COURT, BY GARTH AND NANCY NICOLSON PHD’S
    LEARN ABOUT SCIENCE, ANIMAL MODELS, THATS WHY THERE IS AN EPIDEMIC OF ILLNESSES NO ONES EVER SEEN BEFORE LIKE CFS, AND THIS IS WHAT IS REALLY KILLING MANY AIDS PATIENTS…………

    WAKE UP AND SMELL THE COFFEE, AND IF YOU THINK ITS WOO, CALL UP THE ARMED FORCES OF PATHOLOGY AND TAKE AN INJECTION

  440. #441 Jim
    September 28, 2007

    “Explain why this months journals say that CD4 count has nothing to do with progression to AIDS. After all, you too have told us it is all-important.”

    compare to:

    “Sodora’s paper provides evidence, using the sooty mangabey SIV natural host, that virally induced CD4 T-cell depletion, by itself, is not sufficient to induce AIDS in a natural host”

    and for your third point you conveniently left out the end of the article:
    “But to end the HIV epidemic, gay men would need to have rates of unprotected sex several times lower than those currently evident among the straight population. This is because transmission rates are higher for anal sex than they are for vaginal sex, say the authors.

    But “role versatility,” whereby people adopt both “insertive” and “receptive roles,” also plays a part, they add.

    A gay man can be easily infected through unprotected receptive sex, and then infect someone else through insertive sex.

    Gay men are therefore far more susceptible to the spread of the virus through the population, even with the same numbers of unprotected sexual partners.”

    So we have two possiblities to consider:
    1. Michael lacks reading comprehension skills and thus came to the wrong conclusions.
    or
    2. Michael purposefully misinterpreted the articles to fit his pre-formed conclusions.

    Neither one scores him any points and casts doubt on anything he says as he is either an idiot or blatently dishonest.

  441. #442 Crazy Horse
    September 28, 2007

    Dr. Noble-Custer thank you for the revelation that the primers are believed to be HIV specific. I’m also mightily impressed with you referring to the BLAST searches. But we’ve also already been over the “to prove that they really are specific you need to test it on HIV negative samples and from patients with potentially interfering conditions or infections” thank you.

    The question was how do you know the samples you use to test your new PCR test kit are positive or negative? Adele says it’s measured against the sequenced HIV genome, what say you?

    There is still a possibility that a given primer will not pick up some HIV with mutations in this region

    THANK YOU FOR THAT DR. NOBLE. NOW WE’RE GETTING SOMEWHERE. Our do it yourself PCR expert, however, said this:

    Deniosaurs are all like, but dudez it mutates so much no way you can measure it! Yes there is some parts of the genome are totally conserved or close to it. Those are the parts they use for PCR! They pick them because they’re the same in different clades (Adele)

    Well apparently not always the same in the relevant sense, Adele. So you “refine” the tests with reference to each other, change the primers if they don’t work in the PCR case, and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

  442. #443 Jim
    September 28, 2007

    Cooler,
    “Strange how 99% animals injected doesnt get AIDS and die”

    No, not strange. Alot of viruses show species specificity. For example, Norwalk virus. There’s no animal model and we can’t grow it in cell culture either, but ask any of the thousands of people who have been infected while on a cruise and they’ll tell you it’s real.

    “Strange how it it only infects 1/1000 blood t cells”

    Strange how you lump all T cells together. What percentage are CD4+ t cells and how many of those are infected? And you do realize that the majority of t cells are not in the blood stream right?
    http://jvi.asm.org/cgi/content/full/72/8/6646?view=long&pmid=9658111
    In the article the authors present data indicating that massive T cell infection and death occurs in the intestinal mucosal tissues and that this results in little change in the blood and lymphnode T cell populations.

    “strange how most viruses wreak havok before antibodies, thats why we get vaccines not 10 yrs later”

    You may be able to apply this general statement to RNA viruses, but not DNA or retroviruses. Ever hear of Herpesviruses? Papillomaviruses? Polyomaviruses? HTLV-1? All of these are viruses that are capable of causing symptoms years after one aquires them.

    “strange how no one really knows after 20 years how it destroys the immune system over 10-20 yrs”

    Sure we do. Read the article linked by your fellow denialist:
    “”Our assessment of these natural hosts like mangabeys offers insight into the disease and shows us that progression to AIDS likely results from the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction,” said Sodora.”

    There you have it. Four causes listed that have been observed in SIV infected animals.

    “See hiv fact or fraud google it”

    I’m ashamed to admit I watched it and had this strange mix of wanting to laugh my ass off and vomit at the same time.

  443. #444 franklin
    September 28, 2007

    Hey Lisa,

    Still waiting for the scientific reference about the PCR kits not detecting all strains.

  444. #445 cooler
    September 28, 2007

    there you go making exceptions into rules………………It might be possible for it to be a slow virus, it might be possible a diffuse immune response causes immune depletion according to “expert” joel gallant……….

    The tcell count is a blood test….thats where the tcells are being depleted,

    HIv does not cause disease in animals so its possible its species specific………..speculation

    all speculations, then you run off all these viruses that have failed kochs postulates, are found in millions of helathy people and do nothing……….

    I dont want speculations, since you claim the case for hiv is airtight I would like a reference for a study that confirmed Gallo’s claim

    it should read something like this

    “In 1984 gallo claimed hiv was the cause of AIDS, because of the lack of a reliable animal model and a extremely long ever extending window period we are going to follow hiv positive people with no other possible risk factors such as drug abuse, AZT, mycoplasma incognitus, severe mental illness/stress and compare them to matched controls to confirm or falsify Gallo’s hypothesis”

    Too bad the government would never allow a study that would dare question Gallo’s dubious hypothesis, and there is not one such study on all of pub med, they all assumed HIv was the cause, after all after the orwellian press conference no study like that could ever be tolerated!

  445. #446 Chris Noble
    September 28, 2007

    Well apparently not always the same in the relevant sense, Adele. So you “refine” the tests with reference to each other, change the primers if they don’t work in the PCR case, and BIG SURPRISE! after a couple of years you miraculously wind up with tests that correlate almost 100% with each other.

    I’m interested in what you mean by “refine”.

    To me it seems like a bit of a coincidence that nucleic acid tests that detect highly conserved regions of the HIV genome just happen to have a close to 100% correlation with antibody tests that detect antibodies with high affinity for the HIV proteins.

    Of course in denial land this is just because the tests have been “refined” in some nefarious sense to produce this correlation.

    This is just magical thinking in order to have some reason for ignoring the evidence that contradicts your irrational belief that HIV doesn’t exist.

    I’m also interested in your courageous defense of Duesberg’s misrepresentation of the Palella study when it appears you have not read the paper. The paper presents extremely compelling evidence that ARTs are effective in reducing mortality and morbidity in HIV infected people. That Duesberg somehow twists the study in a bizarre attempt to argue the opposite is close to incomprehensible. You have to wonder who Duesberg is trying to convince.

    Well I guess you can answer that question.

  446. #447 Chris Noble
    September 28, 2007

    Nine years for HIV man

    Some time ago Michael Geiger promised to give up his HIV Denial if the Parenzee appeal failed.

    The appeal failed and a second equally stupid appeal failed.

    The outcome was that Parenzee received a severe sentence precisely because the ridiculous appeals convinced the judge that Parenzee did not take his actions seriously.

    Arguing that HIV does not exist would have to have been the worst possible defense to take. The HIV denialists and Kevin Borick have ensured that Parenzee stays behind bars for at least five years. Go team Denial!

    I wonder if Michael will keep his promise.

  447. #448 jspreen
    September 28, 2007

    You test it using a HIV you purified.

    Hey Adele! Do you really work with purified HIV? Now, that’s the most interesting news I’ve read on this item in the last seven years. Spread the word! You must immediately go over to the Aids Myth Exposed forum and explain them how you purified. And, while you’re at it, also send an explaining mail to Robert Gallo and Luc Montaigner, they will go down on their knees to thank you for your gift. Do it today. End of HIV=Aids deniers tomorrow. Guaranteed. That will do them in. Well, all but myself, of course. You know my ideas and personnally I couldn’t care less whether you purified or not.

  448. #449 Braganza
    September 28, 2007

    Dear Adele & Franklin,

    If two living beings are related (have a common ancestor), would they share similar nucleic acids ?

    I apologize for my ignorance and would like to thank you in advance for answering me.

  449. #450 ElkMountainMan
    September 28, 2007

    I don’t know cooler’s source for “99% animals injected doesn’t get AIDS,” and it’s likely cooler doesn’t know it either. Numerous animal models of AIDS are in use. For example, renouned (if unstable) dissident Michael Geiger has just endorsed the SIV/monkey model of AIDS.

    The rethinker myth of no animal model of AIDS is addressed at an excellent website called aidsvideos dot org. The aidsvideos comment about animal models:

    “Myth: Primates Injected with HIV Show No Symptoms of AIDS

    “NIAID “Relationship Between HIV and AIDS”: “[A]n HIV variant that causes AIDS in humans–HIV-2–also causes a similar syndrome when injected into baboons.” [Barnett et al, "An AIDS-like condition induced in baboons by HIV-2," Science 1994;266:642-6.] The same is true of pigtailed macaques. [Morton et al, Infection of Macaca nemestrina by HIV-1/HIV-2 ...," Laboratory of Tumor Cell Biology Annual Meeting, Aug 22-28, 1993. AIDS Res Hum Retroviruses 1994;10(suppl 1):S1-125.]

    “NIAID “Evidence That HIV Causes AIDS: “Chimpanzees experimentally infected with HIV have developed severe immunosuppression and AIDS.” [O'Neil et al. J Infect Dis 2000;182:1051]”

    (http://aidsvideos.org/myths/index.shtml#HIVPrimatesNoAIDS)

    Many people who are not scientists may find the rethinker arguments compelling on the surface; I encourage these people to read the “myths” page on aidsvideos dot org and learn more about what the science and med literature really says.

  450. #451 Dale
    September 28, 2007

    Too bad the government would never allow a study that would dare question Gallo’s dubious hypothesis, and there is not one such study on all of pub med,

    Or perhaps, cooler, there WAS such a study but since its results were negative (i.e. they failed to support an alternative hypothesis), it was never published.

  451. #452 jspreen
    September 28, 2007

    Many people who are not scientists may find the rethinker arguments compelling on the surface; I encourage these people to read the “myths” page on aidsvideos dot org and learn more about what the science and med literature really says.

    Hmmm… interesting. What’s aidsvideos dot org ? Let’s have a look…

    all the world’s HIV/AIDS videos … in all the world’s languages … all online for free!

    They’re lying! Fact or fraud is nowhere in it ! Seems like just another page of typical propaganda.

    Now, instead of inviting people to dive into the dark trench of HIV=Aids misery, why don’t you come up to surface to admire the rethinker arguments? Seen in bright daylight they’re baffling, you know.

  452. #453 ElkMountainMan
    September 28, 2007

    Epidemiology-LISA finds that all HIV tests are invalid since tests rely on HIV itself as a standard. To him, since HIV itself must be monitored in some way, the tests are simply part of a circle of self-confirmation and are ultimately meaningless. “Circular logic” is indeed a favorite term of the self-styled rethinkers.

    E-LISA is a reality-denialist, not just a HIV/AIDS denier. On the previous thread, I once asked denier “Ben Gorman” if he was a solipsist. I could as well direct the question to E-LISA. The solipsist is the ultimate denialist, doubting or even denying that anything exists outside of his or her own mind. The title seems to fit E to a ‘T.’

    If I see a vase, I can touch the vase and confirm it is real. If I touch the vase, I confirm it is real by looking at it. I can ask my friend if she sees the vase, and she can ask me the same. We can throw it to the floor and dash it in pieces. We can place some flowers into it and confirm its utility.

    But to E-LISA, the vase is a hedgehog, or doesn’t exist. I “know” it’s a vase because I have been told it’s a vase by other humans, people who may be no more than figments of my imagination. I say it’s a vase because you say it’s a vase, and vice-versa. What we see is confirmed by touch, what we touch, by sight, and so on, circularly, ad nauseum. We are told the vase is meant to hold flowers, but we don’t even know what flowers truly are, or if they exist. In this strange (but intellectually lazy) way of thinking, any and every test for anything–HIV, HCV, TB, a genetic polymorphism, CML, or anything else–is invalid because it relies on “circular reasoning.”

    E-LISA’s version of “thought” is quite tiresome and of no use to, say, the practice of medicine. It is very useful to E-LISA, though, enabling him to wallow gleefully in his ignorance of the real world…and to emerge from every debate convinced of his triumph.

  453. #454 jspreen
    September 28, 2007

    But to E-LISA, the vase is a hedgehog, or doesn’t exist.

    Hi hi hi… You compare two things but in your comparison you leave out a vital element. The vase, we can all easily agree upon what it is, before we go smashing it on the floor or before we cry out to our neighbour: “Lo! A vase”. But although HIV has never ever been in sight anywhere you guys immediately start punching the air when a guy shouts “Hey, there’s a HI-virus we should crush”

  454. #455 franklin
    September 28, 2007

    Braganza,

    In order for PCR primers to be unable to distinguish sequences from two organisms, those organisms need to share very similar sequences that correspond to the PCR primers.

    Here is the nucleotide sequence of HERV-K orf-c, which encodes the protein functionally analogous to HIV REV to which you drew our attention:

    gi|311401|emb|X72790.1| Human endogenous retrovirus mRNA for hypothetical protein
    GAGATAGGGAAAAACCGCCTTAGGGCTGGAGGTGGGACCTGCGGGCAGCAATACTGCTTTGTAAAGCATT
    GAGATGTTTATGTGTATGCATATCCAAAAGCACAGCACTTAATCCTTTACATTGTCTATGATGCCAAGAC
    CTTTGTTCACGTGTTTGTCTGCTGACCCTCTCCCCACAATTGTCTTGTGACCCTGACACATCCCCCTCTT
    TGAGAAACACCCACAGATGATCAATAAATACTAAGGGAACTCAGAGGCTGGCGGGATCCTCCATATGCTG
    AACGCTGGTTCCCCGGGTCCCCTTCTTTCTTTCTCTATACTTTGTCTCTGTGTCTTTTTCTTTTCCAAAT
    CTCTCGTCCCACCTTACGAGAAACACCCACAGGTGTGTAGGGGCAACCCACCCCTACATCTGGTGCCCAA
    CGTGGAGGCTTTTCTCTAGGGTGAAGGTACGCTCGAGCGTGGTCATTGAGGACAAGTCGACGAGAGATCC
    CGAGTACATCTACAGTCAGCCTTACGACATTTGAAGTTCTACAATGAACCCATCAGAGATGCAAAGAAAA
    GCACCTCCGCGGAGACGGAGACATCGCAATCGAGCACCGTTGACTCACAAGATGAACAAAATGGTGACGT
    CAGAAGAACAGATGAAGTTGCCATCCACCAAGAAGGCAGAGCCGCCAACTTGGGCACAACTAAAGAAGCT
    GACGCAGTTAGCTACAAAATATCTAGAGAACACAAAGGTGAAACAAACCCCAGAGAGTATGCTGCTTGCA
    GCCTTGATGATTGTATCAATGGTGTCTGCAGGTGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGA
    ACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGAT
    CAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATAGGAGACTCCATTTTGTTATGTACTAAGAAAA
    ATTCTTCTGCCTTGAGATTCTGTTAATCTATGACCTTACCCCCAACCCCGTGCTCTCTGAAACATGTGCT
    GTGTCCACTCAGAGTTGAATGGATTAAGGGCGGTGCAGGATGTGCTTTGTTAAACAGATGCTTGAAGGCA
    GCATGCTCCTTAAGAGTCATCACCACTCCCTAATCTCAAGTACCCAGGGACACAAAAACTGCGGAAGGCC
    GCAGGGACCTCTGCCTAGGAAAGCCAGGTATTGTCCAACGTTTCTCCCCATGTGAAAGTCTGAAATATGG
    CCTCGTGGGAAGGGAAAGACCTGACCGTCCCCCAGCCCGACACCCGTAAAGGGTCTGTGCTGAGGAGGAT
    TAGTAAAAGAGGAAGGAATGCCTCTTGCAGTTGAGACAAGAGGAAGGCATCTGTCTCCTGCCTGTCCCTG
    GGCAATGGAATGTCTCGGTATAAAACCCGATTGTATGCTCCATCTACTGAGATAGGGAAAAACCGCCTTA
    GGGCTGGAGGTGGGACCTGCGGGCAGCAATACTGCTTTGTAAAGCATTGAGATGTTTATGTGTATGCATA
    TCCAAAAGCACAGCACTTAATCCTTTACATTGTCTATGATGCCAAGACCTTTGTTCACGTGTTTGTCTGC
    TGACCCTCTCCCCACAATTGTCTTGTGACCCTGACACATCCCCCTCTTTGAGAAACACCCACAGATGATC
    AATAAATACTAAGGGAACTCA

    Here is the nucleotide sequence of HIV-1 rev:

    gi|327751:226-301, 2632-2906) Human immunodeficiency virus type 1, isolate HXB3, env region
    ATGGCAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAAGGCAGTCAGACTCATCAAGTTTCTCTATC
    AAAGCAACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGA
    GAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCGGAGCCT
    GTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGA
    CGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAATATTGGAGTCAGGAGCTAAAGAATA
    G

    Please let us know how you propose PCR primers from HIV-1 diagnostic kits will be unable to distinguish these sequences.

  455. #456 Braganza
    September 28, 2007

    Franklin,

    I was not speaking of HERV-K but another hypothetical virus which could have the following sequence:

    AAAGCAACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGA GAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCGGAGCCT GTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGA – this is just an example.

    I hope that you could see that PCR primer of this hypothetical entity could overlap with the one from HIV.

    but this is a theoretical situation, which probability may be very small, and therefore may not have practical interest.

  456. #457 Franklin
    September 28, 2007

    Brganza,

    It sure seems like you were speaking of HERV-K.

    I may be wrong, but if the PCR assay for example is calibrated to detect HIV-1 Rev protein, it may also detect a sequence of an endogenous retrovirus, that an HIV negative person may carry.

    See details at :

    http://www.pnas.org/cgi/content/abstract/96/23/13404

    “(..)The human endogenous retrovirus K (HERV-K) family of endogenous retroviruses consists of 50 proviral copies per haploid human genome. Herein, the HERV-Ks are shown to encode a sequence-specific nuclear RNA export factor, termed K-Rev, that is functionally analogous to the HIV-1 Rev protein.(…)”

    So I think everything depends on how SPECIFIC would be the PCR. As far as I understand there is no universal standard.
    So some PCR’s assays may detect only HIV characteristic nucleic acids and others no. Only when everything would be sequenced we would have the truth.

    Does your recent post indicate that you now accept that there is no risk that the PCR kits for HIV-1 will mistakenly detect HERV-K sequences, even if HERV-K sequences encode a protein functionally analogous to HIV-1 Rev protein?

  457. #458 Adele
    September 28, 2007

    Hi Braganza you said

    If two living beings are related (have a common ancestor), would they share similar nucleic acids ?

    Yes they would actually they would be almost identical. You and me are about 100% identical in nucleic acid. Just men and women are just a little different bc men have a y chromosome.

    You said about PCR
    I hope that you could see that PCR primer of this hypothetical entity could overlap with the one from HIV.

    Yes a pcr primer is short enough the sequence might happen somewhere else just in coincidance. It needs to be exact or nearly exact overlapping won’t do it but it could happen. But look at the Wikipedia figure about PCR again. Your needing two primers not just one for pcr thats not happening by chance. So if your fals positive is amplyfying something real than it needs TWO sequence for HIV primers binding and the part in between is exact same size as the part in HIV. The only way that happens is, if the sequence is HIV or its more related with HIV then any virus that’s known.

    So that’s not it. Alot of the DNA and RNA tests have a probe to, that’s something in the middle between primers and its also attaching with a sequence and its longer than the primers. So its even less likely you find that by chance. So two primers a probe, the right size product, all this stuff you don’t get by chance. If your still doubting it you can sequence your whole product and find out if its really HIV.

  458. #459 Braganza
    September 28, 2007

    Franklin,

    I just believe you when you are explaining that no confusion is possible between HERV-K and HIV, as sequences are too different from one virus to the other.

    I wanted to know now if this could exclude all (known and unknown) others viruses.

  459. #460 Jim
    September 28, 2007

    “there you go making exceptions into rules………………It might be possible for it to be a slow virus, it might be possible a diffuse immune response causes immune depletion according to “expert” joel gallant……….”

    Exceptions to rules? Cooler, there are no broad rules that govern how a virus behaves. Every viral system behaves differently: infects different cell types (tropism), cause different symptoms/disease, different abilities to activate an immune response and to evade immune surveillance ect ect. Those viruses are not exceptions to rules because there are no rules that govern all viruses.

    “The tcell count is a blood test….thats where the tcells are being depleted,”

    Did you even look at the paper I linked? That’s not what the paper says and I trust a paper containing results that can be reproduced than some wild speculation you read on a denialist website. So read the paper and come back and tell me why the conclusions and science are wrong and that infection in the intestinal mucosal doesn’t result in massive T cell depletion.

    “HIv does not cause disease in animals so its possible its species specific………..speculation”

    No, not speculation. Observed fact. But since you’re ignorant enough to deny this, of course you will think the species specificity is “speculation.”

    “all speculations, then you run off all these viruses that have failed kochs postulates”

    Many of those viruses I listed have been studied extensively in animals and people, so I’d really like to hear how they don’t fulfill Koch’s postulates.

    “are found in millions of helathy people and do nothing”

    Do nothing? So symptoms/diseases from these virsus such as cold sores, genital warts, Burkitt’s lymphoma, cervical cancer, Kaposi’s sarcoma and many many more are actually caused by something else? You have this black and white version of how infectious diseases work, you think that all infections result in disease when that’s just not true for a lot of viruses, particularly viruses that have been in the human population as long as those listed.

    “I dont want speculations, since you claim the case for hiv is airtight I would like a reference for a study that confirmed Gallo’s claim

    it should read something like this”

    People have posted many studies that positively link HIV and AIDS, but because they don’t say exactly what you’re looking for you discount them (if you even bothered to read them). You’ll never accept any evidence and will be contnent with your ignorance of science and virology in particular.

  460. #461 Adele
    September 28, 2007

    Braganza says

    I wanted to know now if this could exclude all (known and unknown) others viruses.

    I can exclude all known viruses maybe not all unknown lentiviruses though. Just like when they take a culture from your throat and find out you have strep throat does it really mean that? Maybe its a new kind of strep no one ever found before. But probably not and any way its about the same thing right so you try treating it like you treat other strep.

    If HIV nucleic acid test finds a new virus you could tell when you sequenced it and it didn’t happen yet. If it does some day then you know its the virus is basically HIV just different enough maybe you can call it like HIV-4. OR, a different virus put a big chunk of HIV in its own genome and now it needs to keep it to survive so its conserved. Which would be, weird but its possible. Its hypathetical, hasn’t happened yet but its possible I guess.

  461. #462 Chuck
    September 28, 2007

    Earth to Tara…… your explanation for the absurdly low numbers of HIV positives in the porn industry is wonderful. Why not at least also consider the strong – very strong – likelihood that sexual activities have nothing to do with testing HIV positive.

    Whoops. Plum forgot. No counter-intuitive thoughts permitted in the Church of AIDS Orthodoxy. Sorry.

    Does your same just-so explanation also apply to the absurdly low numbers of college students, aged 18-26 (15-16 million of them, mostly middle class!) who ever test HIV positive and yet are having oodlesand oodles of recreational sex whereby no condoms are used because the smart heterosexual female cookies have enough common sense to take care of their own reproductive lives?

    Let’s face it……….there never has been and there never will be any heterosexual AIDS epidemic in the USA, something that Robert Michael, et. al. made perfectly clear 13 years ago in their meticulous study, “Sex in America: A Definite Study” (Little Brown, 1994).

    Looks like you missed the boat again Tara. Keep trying though.

  462. #463 Tara C. Smith
    September 28, 2007

    Chuck, let me speak in small words. Sex alone doesn’t make you HIV+. Even lots and lots of sex. One can have sex with hundreds or thousands of HIV- people and never become infected. The porn industry uses frequent screening to make sure their population stays HIV-. Therefore, their low numbers of HIV+ tests is absolutely unsurprising.

    As you say, “Why not at least also consider the strong – very strong – likelihood that sexual activities have nothing to do with testing HIV positive.”

    I’m absolutely in agreement with this, thank you. Sex ALONE has nothing to do with testing HIV+. Sex with HIV+ partners, however, does.

    Oh, and you find that reference yet?

  463. #464 franklin
    September 28, 2007

    Braganza,

    Thank you for conceding that HIV PCR tests do not react with HERV-K sequences.

    Your hypothetical sequence is so similar to the HIV-1 rev sequence that any real virus containing your hypothetical sequence would almost certainly represent an isolate of HIV-1.

    Whether or not a virus containing your hypothetical sequence would be detected by a PCR assay for HIV-1 would depend on the similarity between the sequence of the PCR primers used in the assay and the sequence of the hypothetical virus.

  464. #465 Chuck
    September 28, 2007

    Tara Tara Tara – I love it when you speak in small words because then you make complete, logical sense and support precisely what I’ve been saying all along. Mon dieu!

    Thank you ever so much for confirming that sexual activities have nothing to do with testing HIV positive. Alas, I just wish the ultra-zealous safe sex missionaries and condom evangelicals let loose of Africa would get your message too. But I digress…..

    Sex with HIV+ partners has something to do with testing positive? Hmmmm. Nice try. Better go re-read the work by Nancy Padian which comes to an opposite conclusion.

    Plenty of good sources – check out Diana Flannery, et. al. “Anal Intercourse and Sexual Risk Factors Among College Students, 1993-2000,” American Journal of Health Behavior (#3, 2003) and Lawrence Altman’s wonderfully ironic and suggestive piece, “New AIDS Mystery: Prostitutes Who Have Remained Immune,” NYTimes (Feb. 3, 2000) especially the last two paragraphs which are priceless, and also Robert Jablon, “HIV tester Called ‘Mother Teresa’ of Porn,” SF Chronicle (April 24, 2004).

    If you have some newer and verifiable statistics, send ‘em along pronto. We love hearing from you.

  465. #466 apy
    September 28, 2007

    Thank you ever so much for confirming that sexual activities have nothing to do with testing HIV positive.

    Your reading comprehension is about as good as noreens. Your claim is not supported by Tara’s post at all. She says having sex with HIV- people does not lead to a HIV+ test. This does not mean that HIV is not spread through sexual activity. There is a different, deal with it.

    The Padian study that denialists love quoting so much says that if you practice *safe sex* your chances of getting HIV from an HIV+ person are very low, but it clearly states that if you do not practice safe sex, such as wearing a condom, you can be as much as 20 times more likely to get HIV.

    Do you have any questions?

  466. #467 Adele
    September 28, 2007

    Chuck’s a deniosaur who doesn’t read his own “sources” He says college kids are having all kinds of sex and not getting AIDS and then he talkes about Robert Michael et al “Sex in America.”

    I guess he missed the part where they say

    Young single people with many partners and a very satisfying sex life are mostly a media creation.
    http://www.rwjf.org/reports/grr/018403.htm

  467. #468 Tara C. Smith
    September 28, 2007

    Charles,

    Tell me–does mere sexual activity with uninfected partners give you syphilis, or gonorrhea, or herpes, or chlamydia either? Of course not–it’s sexual activity only with partners infected with these microbes that does it. Same with HIV.

    And as you well know, I’ve discussed Nancy Padian’s transmission paper at length. But don’t believe me; read how Nancy Padian herself responds to her research being misrepresented by you and your fellow deniers:

    HIV is unquestionably transmitted through heterosexual intercourse….In short, the evidence for the sexual transmission of HIV is well documented, conclusive, and based on the standard, uncontroversial methods and practices of medical science.

  468. #469 cooler
    September 28, 2007

    they are animal models of aids, if you ignore the thousands of animals that have not gotten AIDS when inoculated and only focus the very few that have, like the 1 or 2 chimpa who developed immuno supression, when the other 149 didnt ( what do you expect if you live in a cage for 20 years) if thats gives you airtight evindence along with siv that does not occur in wild animals, is harmless in most monkeys, has no 10 year window period and the people who did the siv studies never had control animals , unlike dr. shyh ching lo did, to see if the oppressive lab conditions played a role………. there is no reliable animal model.

    The only way to really test a virus that is pretty much species specific, a microbe with such a long window period is a study like this, sad you guys claim to have so much evidence but dont have one properly designed study that doesnt already assume hiv is the cause of AIDS, which is the very question at issue.

    Is this to much to ask?, shouldnt a study like this have been done in 1985?, oh I forgot no study would be allowed bc the government wouldnt allow/fund it, sounds like the science from the old soviet bloc countries

    “In 1984 gallo claimed hiv was the cause of AIDS, because of the lack of a reliable animal model and a extremely long ever extending window period we are going to follow hiv positive people with no other possible risk factors such as drug abuse, AZT, mycoplasma incognitus, severe mental illness/stress and compare them to matched controls to confirm or falsify Gallo’s hypothesis”

    Is this to much to ask?

    see hiv fact or fraud
    read project day lily to find out about the mycoplasma incognitus biowarfare program, this microbe kills every animal injected unlike hiv

  469. #470 cooler
    September 28, 2007

    chimps

  470. #471 cooler
    September 28, 2007

    What do you expect Padian to say, “hiv might not be the cause of AIDS” and lose her career like Duesberg did.

    The Data in her study was clear ZERO seroconverions………..but she knows what she has to say to survive, and wouldnt dare challenge the governments propaganda, probably still beleives it even though her own data should have overcome her extensive brainwashing, too bad it didnt, she cant think for herself even though the results were clear.

    This is no suprise, many scientists in history have sucummbed to the propaganda of the state, in nazi germany, stalins russia, Orwells 1984…………..there could be study done tommorrow that showed hiv positive people with no risk factors dont get and die of AIDS…..that still wouldnt ends the AIDS lie, because its all about state sponsored propaganda and thought control, not science.

  471. #472 Chuck
    September 28, 2007

    Tara, Tara, Tara….. why not address the basic statistical data on AIDS cases in the USA. or to paraphrase John Maynard Keynes, “When the facts change, I change my mind. What do you do, maam?”

    Many orthodox AIDS researchers and your own fellow true believers cannot acknowledge any new realities – “novel facts” as William James called them – because their theories exclude them. Padian is a prime example.

    HIV/AIDS has become a crusading faith in itself with a high fervor quotient and no room for doubts or second thoughts, proving that to be a religious fanatic, you don’t need a religion per se.

    You consciously, but predictably, evaded the key points that I’ve made and changed subjects.

    Nancy Padian intones, “HIV is unquestionably transmitted through heterosexual intercourse….In short, the evidence for the sexual transmission of HIV is well documented, conclusive, and based on the standard, uncontroversial methods and practices of medical science.”

    If she ever doubted, questioned or merely reconsidered that mantra, then her funding and status would vanish. We all know that. It also prevents her from even grasping the counter-intuitive results of her own research.

    I once asked Padian herself, directly, in San Francisco/Feb. 2007 at a morning session on public health at the annual meeting of the AAAS that if AIDS cases are sexually transmitted, and the overwhelming majority of San Franciscans are heterosexual then why have there been only 266 (alleged) heterosexual female contact cases of AIDS in 27 years in SF, less than 10 per year?

    Padian seethed with anger, looked away and refused to answer.

    Hint: the answer can be found in Michelle Cochrane’s brilliant book, “When AIDS Began” (Routledge, 2004).

    Enjoy yourselves, keep saving the world, and I now leave you alone to play amongst yourselves. Ta ta……

  472. #473 apy
    September 28, 2007

    Padian seethed with anger, looked away and refused to answer.

    That could only be because she is being suppressed? Couldn’t possibly have anything to do with dealing with nitwits like you all the time?

    Let me know when you actually read her study.

  473. #474 Michael
    September 28, 2007

    Hey Jim. Although you stated it as, and assume it as, FACT, you said your “OPINION” and the researchers “OPINION” of their study was that:

    “A gay man can be easily infected through unprotected receptive sex, and then infect someone else through insertive sex.

    Oh, Now I get it, gay men must be somehow physically different, or perhaps genetically programmed to be easily infected by HIV, and also to more easily infect others, but heteros are not…. Hmmmmmm……

    and

    Gay men are therefore far more susceptible to the spread of the virus through the population, even with the same numbers of unprotected sexual partners.”

    Hmmmmm. We gays are far more susceptible…….

    Yes Jim. We are far more susceptible. Susceptible to the homophobic bullshit from people like you and from society and even quite often from our own familes. We are also susceptible to high stress from constantly being told that we are all to expect a slow and painful death by HIV/AIDS.
    We are susceptible to emotional stress and distress by trying to live in a world that constantly projects its homophobia and lack of acceptance for us and projects beliefs in imminent death upon us.

    Keep talking Jimmy, because I really am beginning to understand you. Really now. Gay men get infected easily, but straights do not……unless they also happen to be inner city drug addled blacks or poor black Africans or other destitute people in third world countries.

    Jim. You REEK of homophobia. You reek of rascism. You have transferred both into believing that it is about HIV and what you call AIDS. You demonstrate both by channeling your homophobic and rascist beliefs into beliefs of infectious viruses that only affects these downtrodden groups.

    Obviously the researchers who propose such a nonsensical explanation REEK of homophobia as well.

    Tell me Jim, did these researchers just so happen to be elite white heterosexuals? Well, yes indeed, investigation shows this to be exactly the case.

    Neither you, nor they, have proof nor evidence for such blatantly absurd projections of your homophobia. Nothing but correlations that YOU project are causations.

    You only have scared into immune suppression gay men, who deal internally and constantly with you and your ilks projections and declarations of sickness and death upon them by often engaging in very self destructive drug abuse and addictions that the non-stressed heterosexuals do not have to contend with, and often by being overwhelmed with immuno suppressing emotional stress from it all.

    Jim. You and your ilk ARE THE CAUSE OF AIDS.

  474. #475 franklin
    September 28, 2007

    Chuck tells Tara:

    You consciously, but predictably, evaded the key points that I’ve made and changed subjects.

    No, Chuck, the only evasion taking place is your’s. You presented us with an unreferenced assertion about the low rate of positive HIV tests among wokers in the adult film industry in the Los Angeles area.

    Chris Noble provided a full text reference on the epidemiological investigation of 4 HIV infections in that very same population in 2004.

    And although you promised to be “all ears and eyes” for the scientific discussion of this topic, in your subsequent posts you have just evaded the issues and started muttering the tired, old distortions of Padian’s work.

    The epidemiologic investigation of this cluster of cases in the adult film industry clearly documents heterosexual transmission of HIV. This transmission took place during the “window period” in between primary infection and the development of a positive result on an HIV diagnostic test, a period which prior studies have identified as having an increased risk for sexual transmission.

    In short, the very situation that Chuck brought to our attention turns out to provide a well-documented study of the molecular epidemiology of heterosexual transmission of HIV.

    Predictably, Chuck responds by burying his head in the sand.

  475. #476 Jim
    September 28, 2007

    Michael,
    Your little tirade and fall back position of homophobia and racism tells me nothing more than you are an intellectually bankrupt individual. You blatantly misinterpret an article and claim it supports your position and yet, somehow, I’m a racist and homophobe for pointing that out. I point out that you left out the end of another article that you also claim supports your position that, surprise surprise, includes information explaining that although the number of sexual partners doesn’t explain the nature of HIV spread, the difference in sexual BEHAVIOR may have a big impact. Do you own up to this intellectually dishonest behavior? No, you respond with more intellectual dishonest.

    “Oh, Now I get it, gay men must be somehow physically different, or perhaps genetically programmed to be easily infected by HIV, and also to more easily infect others, but heteros are not…. Hmmmmmm……”

    That is not what I nor the article said, but yet you assign that position to me. Why? Because you don’t have a leg to stand on and your argument is based on distortions and half truths. Instead of educating yourself on the topic, you repeat the same BS over and over and then scream “homophobe!!racist!!” at anyone who points out the obvious flaws. Believe whatever you want, Michael, it doesn’t make it true.

  476. #477 Adele
    September 28, 2007

    Michael you are a pathetic homophobe. Didn’t you know some gay people are the worst homophobes? And you say to other people stuff like

    Jim. You REEK of homophobia.

    Just because Jim said receptive anal intercourse is a higher risk for infection then vaginal intercourse.

    But its JUST FINE with you when Henry Bauer says we should take away free speech for gay men. Because their SO BAD SO VERY BAD for everyone we can’t let ANYONE ELSE be gay so take away their free speech and civil rihgts!! Yeah right over my dead body reactionary freaks.

    That’s what Henry Bauer said you idiot but oh he’s your friend. You NEVER said anything about him and his fasist BS.

    What about Peter Duesberg he’s another one. Oh but he AGREES with your homophobe attitude you know AIDS is caused by stuff that was illegal 20 years ago you know BEING GAY! So HES FINE whata great guy!!

    Hypacrite! Your part of the biggest homophobe movement since the catholic church. Its called deniosaurism. Get out before it goes extinct!

  477. #478 Tara C. Smith
    September 28, 2007

    Predictably, Chuck responds by burying his head in the sand.

    “Chuck” is Charles L. Geshekter, who resurfaces here from time to time under various names. Don’t expect to change his mind at all, or even have intelligent discussion. The only reason I countered his point is for any fencesitters out there, not because I thought it would actually be responded to honestly by “Chuck.”

  478. #479 cooler
    September 28, 2007

    “In 1984 gallo claimed hiv was the cause of AIDS, because of the lack of a reliable animal model and a extremely long ever extending window period we are going to follow hiv positive people with no other possible risk factors such as drug abuse, AZT, mycoplasma incognitus, severe mental illness/stress and compare them to matched controls to confirm or falsify Gallo’s hypothesis”

    Is this to much to ask? why has a study like this not been conducted? …say in 1985 or so………….? why, AIDS inc would never allow anyone to design a study that puts into question their sacred hypothesis, sounds like a religion, not science.

    see hiv fact or fraud google it

    read project day lily about the mycoplasma incognitus biowarfare program this microbe unlike hiv kills every animal injected as army scientist dr. shyh ching lo showed. google project day lily.

  479. #480 Michael
    September 28, 2007

    Oh well, Jim, then please explain EXACTLY how it is that

    “A gay man can be easily infected through unprotected receptive sex, and then infect someone else through insertive sex.

    and:

    “Gay men are therefore far more susceptible to the spread of the virus through the population, even with the same numbers of unprotected sexual partners.”

    Go on Jim, explain to us why the bodies of gay men are different in that THEY are EASILY INFECTED, and that THEY ARE MORE SUSCEPTIBLE, and that THEY PASS THE VIRUS EASILY.

    I am patiently waiting for your FULL EXPLANATION of why HIV somehow affects gays differently from straights with HIV but not with other STDs.

    And then explain to me why HIV is a HETEROSEXUAL disease in Africa, but not in the west.

    When you have sufficiently explained this, I will rescind my accusations of homophobia and racism. Until you fully explain it, my accusation stands.

  480. #481 Michael
    September 28, 2007

    What is really hilarious, Jim, is how those, such as yourself and the “researchers” who made comments on their “study”, who are COMPLETELY UNKNOWLEDGEABLE of gays and gay sex, make assumptions that you all just so happen to believe in your fantasies, but are miles from any type of reality.

    The very statement that you and they have made, that gay men are equally giving and equally receiving of getting and giving anal sex is completely ludicrous in the reality of 99% of the gay population.

    For instance, Jim, being gay for 50 years and having myself had 35 years of sexual experience, I know damn well that very very very few gays are what you would call “versatile” or do BOTH anal screwing and also getting anally screwed. Out of the hundreds, if not thousands of gay men that I personally know, nearly ALL are either ALWAYS anally receptive, or they are ALWAYS anally penetrative. They ARE very very seldom both. They may have tried the opposite a time or two, but do not practice anything other than their own preference of either receptive OR penetrative sex. Not both either willy nilly or even now and then.

    Gay men as individuals are EITHER turned on or turned off by the very idea of engaging in the opposite of their own preferred sexual position.

    One who is “turned off” by being the penetrator can’t even get it up to do so with a partner. One who is “turned off” by being penetrated, won’t let anyone near their ass. And very nearly every gay man has a preference in this.

    The vast majority, nearly every gay I have ever met, including myself, is EITHER 99.99% always insertive, OR 99.99% always anally receptive. Or as we call each other, one is EITHER a “top” or a “bottom” by innate preference, and very very seldom is one versatile in both.

    So do explain how those who are ALWAYS tops ever manage to get “infected” by their partners who are always bottoms, so that they transfer to others who are ALWAYS bottoms.

    And then explain how those who are ALWAYS receptive bottoms ever become infected from those who are ALWAYS penetrative tops.

    The reality of how gay sex actually plays out in the REAL WORLD does NOT match your fantasy version of it Jim. And it certainly does not match these researchers opinions or explanation.

    Your full explanation of the REALITY of the situation is in order. Until you explain it, the researchers take on this, and your own take on it, is PURE BULLSHIT!

  481. #482 Michael
    September 28, 2007

    Franklin said:

    “The epidemiologic investigation of THIS CLUSTER OF CASES in the adult film industry clearly documents heterosexual transmission of HIV.”

    Franklin, since when are eleven cases spread over thousands of different people, equivalent to a “cluster”?

    Come on, Frankie, explain yourself here. And don’t run off and hide and evade the question this time.

  482. #483 Michael
    September 28, 2007

    Hey Chris, I see you are not very proud of the fact that your favorite fantasy has resulted in Andre Parenzee being convicted to a 9 year sentence for supposedly spreading HIV. And I see that you are more than happy to project your own inner guilt over his conviction by projecting your guilt onto the dissidents who did their best to defend Parenzee by exposing the flaws of HIV belief. Well, Chris, you did your part to spread the fantasy, not the dissidents. The results fall squarely on you and those you unquestioningly follow.

    The case did not fall because the dissident’s evidence was insufficient. It fell because the scientists for the defence were refused acceptance as expert testimony.

    But the case is NOT over Chris. Just because Judge Sulan is as brainwashed as you, does not mean the next reviewer will not have common sense and examine the facts.

    According to September 10, 2007, in THIS months BMJ:

    http://www.sciencedaily.com/releases/2007/09/070906214854.htm

    Science Daily — Virological evidence cannot prove transmission in HIV criminal cases, warn experts in the British Medical Journal.

    Viral phylogenetics provides a way of assessing the relations between viruses from different people. It allows us to estimate the probability that viruses from two particular people have a recent common origin. But there are serious limitations on what can and cannot be inferred using this technique.

    The recent flurry of criminal cases brought against people in the United Kingdom accused of infecting their sexual partner(s) with HIV has resulted in several convictions, write Professor Deenan Pillay and colleagues in an editorial.

    This has caused concern amongst health professionals and community groups about the detrimental effect such cases may have on disclosure of HIV infection and uptake of voluntary HIV testing.

    In some cases, attempts have been made to present evidence on HIV viral sequence data in a similar way to DNA fingerprinting.

    In our view, this analogy is seriously misleading, say the authors. When attempting to establish that transmission occurred between specific people, virological evidence should be used with caution and only in conjunction with the clinical and epidemiological evidence.

    The greatest difficulty lies with the nature of the data, they write. Identifying a link between viruses from two people on its own says nothing about who infected whom. Other difficulties include the unlikelihood that all sexual contacts of all HIV infected people will be available for viral testing, co-infection with genetically diverse strains, and similarities in two virus genomes as a result of convergent or parallel evolution.

    They advise caution when interpreting such data because the strength of any apparent linkage between viruses will never approach the degree of certainty generally expected of DNA data in a criminal court.

    Phylogenetic evidence — together with clinical and epidemiological evidence regarding likely duration of infection, sexual history, and other relevant factors — can provide support for linkage between cases but cannot prove transmission, they say.

    Despite the difficulty in determining linkage between specific individuals, phylogenetics can provide important new insights in investigations, they say. A recent example is a study of the timing of HIV-1 infections among Libyan children in hospital, which showed that most infections occurred before the arrival of the accused medical workers in the country.

    It will be important that sufficient checks and balances are in place to allow full use of HIV surveillance data for public health benefit, without concern that the underlying purpose for identifying possible viral genetic linkage between people will be to support criminal proceedings, they conclude.

    Note: This story has been adapted from material provided by BMJ-British Medical Journal.

  483. #484 Roy Hinkley
    September 28, 2007

    Michael,

    I don’t have access to the journal in question but here’s some evidence that suggests you whould “rethink” your understanding of the sexual behavior of male homosexuals:

    Table 1 summarizes the demographic findings. Of the 205 participants, 36 (18%) self-identified as tops, 47 (23%) as bottoms, and 97 (47%) as versatiles, and 25 (12%) reported that these labels did not apply to them (hereafter referred to as the no label group).

    http://www.thefreelibrary.com/Sexual+behavior+among+HIV-positive+men+who+have+sex+with+men:+what's…-a0105518220

    This is why science has proven to be such successful innovation. By following its tenets we learn things that otherwise would have eluded us.

  484. #485 Michael
    September 28, 2007

    Roy. Your belief in your cite presentation shows that you too are quite far removed from gay social circles.

    Your presentation honestly DOES NOT jive with reality.

    Every gay man I know would simply laugh at it.

    The reason? It is a LONG STANDING GAY JOKE, that those who publicly tell others they are “versatile” ALWAYS inevitably turn out to be bottoms that just do not want to admit it to strangers. It has to do with fears of feeling shamed by some people who might perceive them as not being masculine.

    Gay men DO NOT honestly share their preference with strangers, even when the stranger is another gay. Usually one does not find out the truth until they are naked in bed.

    The 47% who told a stranger they were “versatile” and 12% who refused to be labeled, ARE ALL BOTTOMS.

    Don’t take my word for it Roy, go find ANY gay man, and just ASK HIM what it means when someone gay says they are “versatile”. He will simply chuckle to himself and to you, and tell you that it means they are a bottom.

  485. #486 Michael
    September 28, 2007

    Roy, you said: “This is why science has proven to be such successful innovation. By following its tenets we learn things that otherwise would have eluded us.

    And again, Roy, the reality of the situation is the opposite of what you were led to believe.

    The study you presented, if you choose to believe it and choose to believe the individuals who were questioned were honest when asked such extremely intimately personal questions that very much even threatened the egos of those being questioned, will not enlighten you as to the real world experience. It will simply result in you being even more deluded.

  486. #487 Michael
    September 28, 2007

    Roy, you said:

    “here’s some evidence that suggests you whould “rethink” your understanding of the sexual behavior of male homosexuals

    Roy, I am 50 years old. I have been active as a homosexual since I was 13. I have had several gay lovers and countless gay sexual experiences. I have always lived in the gay communities and socialized almost only with gays for 35 years. I even lived at a gay bath house for 8 months.

    As such, I believe my own experience with thousands of other gays qualifies me as a bit more of an expert in the understanding of gay sexual behavior than either yourself or the simple minded “data collectors” of Wegesin & Meyer-Bahlburgthat, who provided you with their supposed real world “evidence”.

  487. #488 Michael
    September 28, 2007

    Hey Roy. If your own preferred sexual act was getting screwed in the ass by another man, would you willingly admit it to strangers?

    Think about it.

  488. #489 Michael
    September 29, 2007

    I only wish that such statements as the one I just left for Roy, would be the 500,000th Winning Contest Comment.

    Hahahahahahahahahahahahahahahaaaaaaaaa

  489. #490 Michael
    September 29, 2007

    Tara, are you censoring dissidents comments to this thread again? My own comments will not post unless I either use someone elses email address in the email sign-in or use a different computer than my own to leave posts. Any posts I leave using my own email address comes back as “Held For Approval” by you.

    Other dissidents have emailed me that their comments are coming up the same as my own: “Held For Approval” by you.

    Whats up? Are you terrified that a “denialist” might be the 500,000th comment Tara? Or are you just censoring debate again?

  490. #491 Tara C. Smith
    September 29, 2007

    Censoring debate “again”? When have I ever? Hell, I’ve even banned you before and let you come back as long as you keep it somewhat restrained. The only comments I’ve removed are ones you falsely attributed to “Tony Fauci.” I don’t have any in my junk folder from you or any held in moderation, so I’m not sure what’s going on but it’s not on my end.

    And MIchael, the Seed contest is a drawing anyway, if you’d bothered to look. I know it’s beneath you to actually look at sources though…

  491. #492 franklin
    September 29, 2007

    Michael,

    If you read the paper, you will see four cases of HIV infection among workers in the adult film industry in the Los Angeles area. The four cases include a man and three women with whom he performed various sex acts in the line of duty.

    These four cases are a cluster, an index case and three of his primary sexual contacts.

    All of the actors in these film productions were required to provide the results of monthly testing for HIV infection. Negative test results were a condition of employment, and all of the actors had received negative test results prior to this outbreak. These four cases are well-documented new infections of HIV.

    Phylogenetic anlayses showed that the viruses in the man and two of the women had exactly the same nucleotide sequence. Therefore this cluster of cases is linked by molecular phylogenesis, as well as by the epidemiological criteria of primary sexual contacts.

    This cluster of cases demonstrates heterosexual transmission of HIV and uses the combined epidemiological and molecular approaches advocated by the other article you posted.

  492. #493 cooler
    September 29, 2007

    According to carter, he talked to an aids hospice head and 50% of the gay people think the hiv is a myth.

    All this name calling “denialists” “kool aid drinkers” is not working to well for you guys. The San Diego gay and lesbian times ran a very sympathetic article on the deniers…….once you lose the gays you lose it all.

    Looks like within the the next few years aids inc will have no choice but to debate the growing number of scientists like Duesberg, saying it is beneath them is just making people think you have no evidence besides some cobbled up nih fact sheet.

    Even the 9/11 debunkers debate, so keep saying you are above a debate when your myth evaporates.

    I went to a pretty good college, and every one I show the film “hiv fact or fraud” at least agree more investigation is needed, yes they are not experts, but like I’ve said experts usually support the states propaganda. Keep on laughing at us, calling us names, but its you guys that are totally out of touch with reality. Waiting for that debate where duesberg, shyh ching lo, strohamn, mullis all brillaint scientists who have questioned hiv get together blow you away.

    I find it disgusting that AIDS inc has participated in genocide by dismissing armed forces of pathology cheifs shyh ching lo md phd’s mycoplasma incognitus, it killed every animal injected mice/primates, unlike hiv which does nothing in most every animal, and has created an epidemic of CFS/RA/Fibro/als etc.
    Read Project Day Lily to find out how the guys in charge of the bioweapons program are laughing at how dumb doctors are to blame everything on a harmless retrovirus………..

  493. #494 cooler
    September 29, 2007

    they are laughing knowing full well mycoplasma incognitus is the only real microbe to worry about it………………project day lily google it

  494. #495 Roy Hinkley
    September 29, 2007

    ” those who publicly tell others they are “versatile” ALWAYS inevitably turn out to be bottoms that just do not want to admit it to strangers. It has to do with fears of feeling shamed by some people who might perceive them as not being masculine.

    Interesting that such feelings of shame and fear extends to the perceptions of anonymous paper surveys. Or perhaps its the pencils perceptions they’re worried about?

    The 47% who told a stranger they were “versatile” and 12% who refused to be labeled, ARE ALL BOTTOMS.”

    That would make 82% bottoms. Do you think such a finding has any implications for a sexually transmitted disease such as HIV Michael?

  495. #496 franklin
    September 29, 2007

    Cooler,

    You keep linking S.C. Lo to the idea that Mycoplasma has caused an epidemic of Chronic Fatigue Syndrome.

    Do you have a reference (nonfiction) to support your claim?

    When I look on Medline I keep coming up with this paper that seems to refute your claim:

    Komaroff AL, Bell DS, Cheney PR, Lo SC. (1993). Absence of antibody to Mycoplasma fermentans in patients with chronic fatigue syndrome. Clin Infect Dis. 17:1074-5.

  496. #497 Roy Hinkley
    September 29, 2007

    Oh franklin! Don’t you know?

    Absence of antibodies means your susceptible to a disease. Presence of antibodies indicates immunity. That’s why HIV antibody tests are meaningless and mycoplasma incognitus causes CFS Q.E.D.

  497. #498 Leni
    September 29, 2007

    Wow.

    You really brought ‘em out of the woodwork, Tara. I’d have banned Lisa after the second post for the thoughtless and repetetive issuance of really, really lame insults. Adso? Dr. Smearah Tit?

    Jesus. Frelling. Christ. That has got to be the stupidest thing I’ve seen on science blogs, ever. Maybe even on the whole internet.

  498. #499 Tara C. Smith
    September 29, 2007

    Yep; the best and brightest come out to play. Nothing’s more destructive to their cause than their own advocates, IMO.

  499. #500 cooler
    September 29, 2007

    the monkeys that died that lo injected only had a weak antibody reposnse when near death, so pcr is the way to detect this microbe, not antibodies

    do a pub med search for garth nicolson and youll see him find Lo’s mycoplasma incognitus in several diseases such as als/cfs by pcr.

    do a search on pub med for shyh ching lo, and youll see his animal models, and that even he used the PCR to detect it…………

    now why would Lo use antibodies testing in that study? well youll have to read Project day lily to find out, being a military scientist Lo was being handled by superiors.

    Project day lily’s events are true, it had to slightly fictionilized to stay out of court. rave reviews from several scientists, including a nobel laurete roger guilleman md phd.

    It was part of the bioweopons program. Every animal Lo injected with it mice/primates/embryos sickened/died. he found it in no healthy controls. These are all peer reviewed sources from Lo md phd, who was considered a scientific genius in china, which is why the military made him the highest ranking scientist, in 1990, he along with several other scientists came to Duesbergs defense, bc Lo had trouble believing the hiv hypothesis as well.

    If you are really interested you can search pub med, every time I post links my posts get held up for some reason.

    Shyh ching lo md phd is one of the only scientists since koch to discover a microbe that killed/sickened every animal injected….scientists from the nih like Tully were very impressed with his work, but Fauci sabotaged it and caused genocide. good work Tony Fauci.

  500. #501 cooler
    September 29, 2007

    the monkeys that died that lo injected only had a weak antibody reposnse when near death, so pcr is the way to detect this microbe, not antibodies

    do a pub med search for garth nicolson and youll see him find Lo’s mycoplasma incognitus in several diseases such as als/cfs by pcr.

    do a search on pub med for shyh ching lo, and youll see his animal models, and that even he used the PCR to detect it…………

    now why would Lo use antibodies testing in that study? well youll have to read Project day lily to find out, being a military scientist Lo was being handled by superiors.

    Project day lily’s events are true, it had to slightly fictionilized to stay out of court. rave reviews from several scientists, including a nobel laurete roger guilleman md phd.

    It was part of the bioweopons program. Every animal Lo injected with it mice/primates/embryos sickened/died. he found it in no healthy controls. These are all peer reviewed sources from Lo md phd, who was considered a scientific genius in china, which is why the military made him the highest ranking scientist, in 1990, he along with several other scientists came to Duesbergs defense, bc Lo had trouble believing the hiv hypothesis as well.

    If you are really interested you can search pub med, every time I post links my posts get held up for some reason.

    Shyh ching lo md phd is one of the only scientists since koch to discover a microbe that killed/sickened every animal injected….scientists from the nih like Tully were very impressed with his work, but Fauci sabotaged it and caused genocide. good work Tony Fauci.

  501. #502 cooler
    September 29, 2007

    sorry about the double post, some of lo’s work, note the lack of antibody response

    http://www.aegis.com/pubs/atn/1990/ATN09501.html

    garth nicolson phd is finding it by pcr in cfs/als/gwi etc

    his work is all over pub med

  502. #503 franklin
    September 29, 2007

    Cooler,

    Please try to find a nonfiction reference to support your claims.

  503. #504 cooler
    September 29, 2007

    the link above is nonfiction, lo’s peer reviewed work, here is nicolsons post, i told you to search pub med but you refused, so please try using pub med instead of lying about “fictional refrences” learn something from other scientists instead of dismissing them

    nicolsons peer reviewd work on gwi/als, search more and youll find a lot on CFS
    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=12383408&ordinalpos=13&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

  504. #505 franklin
    September 29, 2007

    Cooler,

    The nonfiction link you provided above has nothing to do with chronic fatigue syndrome.

    Here is what Garth Nicolson says about Mycoplasma incognitius and chronic fatigue syndrome:

    Nijs J, Nicolson GL, De Becker P, Coomans D, De Meirleir K. (2002) High prevalence of Mycoplasma infections among European chronic fatigue syndrome patients. Examination of four Mycoplasma species in blood of chronic fatigue syndrome patients. FEMS Immunol Med Microbiol. 34:209-14.

    Prevalence of Mycoplasma species infections in chronic fatigue syndrome (CFS) has been extensively reported in the scientific literature. However, all previous reports highlighted the presence of Mycoplasmas in American patients. In this prospective study, the presence of Mycoplasma fermentans, M. penetrans, M. pneumoniae and M. hominis in the blood of 261 European CFS patients and 36 healthy volunteers was examined using forensic polymerase chain reaction. One hundred and seventy-nine (68.6%) patients were infected by at least one species of Mycoplasma, compared to two out of 36 (5.6%) in the control sample (P less than 0.001 . Among Mycoplasma-infected patients, M. hominis was the most frequently observed infection (n=96; 36.8% of the overall sample), followed by M. pneumoniae and M. fermentans infections (equal frequencies; n=67; 25.7%). M. penetrans infections were not found. Multiple mycoplasmal infections were detected in 45 patients (17.2%). Compared to American CFS patients (M. pneumoniae>M. hominis>M. penetrans), a slightly different pattern of mycoplasmal infections was found in European CFS patients (M. hominis>M. pneumoniae, M. fermentans>M. penetrans).

    So according to Nicolson, M. incognitius is not even the most common species of mycoplasma observed in chronic fatigue syndrome patients in Europe or the United States.

    So where do you find support for your claim that M. incognitius is the cause of chronic fatigue syndrome?

    Please don’t send us to Project Day Lily.

  505. #508 franklin
    September 29, 2007

    Cooler,

    M. fermentans incognitius is not even the most frequent mycoplasma species identified in the papers you are citing.

    Is that your evidence that M. fermentans incognitius causes Chronic Fatigue Syndrome?

  506. #509 cooler
    September 29, 2007

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=9778455&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

    here is one that is.

    Obviously more research is needed. Ive given you animal model’s, correlations and lo did isolate and grow in culture aka kochs postulates folfilled.

    I suggest you read montagniers book “virus” where he scolds people like you for being so dissmissive of mycoplasmas.

    Are all cases of cfs caused by mycoplasmas no, but if you test positive for a microbe that kills every animal injected and have a mytesrious infection like syndrome like RA or CFS patients should be informed of this, i know that if merck had ads on TV for this kind of research youd be saying people that deny mycoplasma are holocaust deniers!

    Its pointless to argue with a drug company hack like you. You demand so much, can you provide me with the first scientific paper that proves hiv causes aids?

  507. #510 Jim
    September 29, 2007

    Cooler,
    Why are you even arguing about mycoplasma and CFS? What exactly does it (and Project Day Lily for that matter) have to do with HIV denialism?

  508. #511 franklin
    September 29, 2007

    I’m sorry, Cooler.

    Where did you give us the animal model for chronic fatigue syndrome?

  509. #512 cooler
    September 29, 2007

    http://www.aegis.com/pubs/atn/1990/ATN09501.html

    more than gallo ever had, this bug is found in many CFS cases, youre going to say lo’s animal model does not exactly resmemble CFS, the monkeys/mice wasted and died in 9 months (even though according to Lo’s patents its a definte possible cause of CFS I and I trust his opinions much more than yours, for he is obviously a much more competent scientist than you will ever dream of being, in one of his patents he incolated chimps and they displayed “symptoms of AIDS” )

    Funny how you scrutinize Lo’s animal models, when 150 chimps were incoulated with hiv and none have died after 20 years, nor do mice mice or chicken embryos get any type of disease when inoculated with HIV, lo incoulated all of these different species with mycoplasma incognitus/penetrans and they all sickened/deformed died.

    I suggest you call the armed forces institute of pathology and take an injection if you think they cant cause complex diseases like CFS/ALS

  510. #513 cooler
    September 29, 2007

    Chicken embroyos killed/deformed by mycoplasma penetrans/incognitus kochs postulates folfilled by the brillaint Lo once again………..take an injection franklin why not? they are harmless even though they kill primates/mice/deform embryos

    http://iai.asm.org/cgi/reprint/64/8/3419.pdf

    jim these mycoplasmas are found in many AIDS cases so when hiv fundamentalists like Fauci sobotage the research even when experts like joseph tully and Lo and montagnier say they can play a role in many other diseases including aids and Fauci ignores it BC it will upset the hiv religion, thats how it plays a role in the Hiv debacle.

    In order for you guys to take a microbe seriously a drug company or a poliical hack like fauci has to have a press confernce..sorry that didnt happen, didnt know press conferences were more important than a microbe that kills/sickens every animal injected, unlike hiv.

  511. #514 franklin
    September 29, 2007

    Cooler,

    You insist that Mycoplasma fermentans incognitius is the cause of chronic fatigue syndrome. You insist that Koch’s postulates have been fulfilled for this association. Yet I am unable to find one scientific paper that agrees with you.

    Has Garth Nicolson ever claimed that Koch’s postulates have been fulfilled to prove that Mycoplasma fermentans incognitius is the cause of chronic fatigue syndrome?

    Has Shyh Ching Lo?

    Has anyone other than Cooler ever made that claim?

  512. #515 cooler
    September 29, 2007

    I embrace the multifactorial hypothesis for CFS/AIDS

    If ten people ten people had a headache, its would be foolish to say the cause of the headache was the same in all ten people, some it might stress, others a virus etc.

    Kochs postulates have been folfilled for mycoplasma incognitus /penetrans causing disease in humans so if you test positive for it and feel sick, it is probably the cause of much of your symptoms, regardless of what garbage can diagnosis youve recieved , CFS, depression etc.

    CFS is a denegrating blanket term that lumps many people with differnt clinical histories together, for the subset of patients who test positive for the pathenogenic mycoplasmas, or for any patient complaining of complex symptoms w/ no firm diagnosis then Lo’s mycoplasmas are the cause if you test PCR positive.

  513. #516 cooler
    September 29, 2007

    yes nicolson has claimed KOchs postulates have been folfilled, Lo has suggested it as a cause of CFS in his patents

    lurkers should read http://www.projectdaylily.com/

    to find out how it was part of the bioweapons program

  514. #517 cooler
    September 29, 2007

    nicolson has claimed it folfilled kochs postulates, Lo in his patents said it could cause CFS

    lurkers should google project day lily to find out how it was part of the bioweapons program, true events slightly fictionilized

  515. #518 franklin
    September 29, 2007

    Cooler,

    You say that:

    Kochs postulates have been folfilled for mycoplasma incognitus /penetrans causing disease in humans so if you test positive for it and feel sick, it is probably the cause of much of your symptoms, regardless of what garbage can diagnosis youve recieved , CFS, depression etc.

    The first of Koch’s postulates states that:

    The microorganism must be found in all cases of the disease.

    Please provide evidence that this postulate has been fulfilled for mycoplasma incognitus /penetrans in any human disease.

    Please don’t send us to Project Day Lily or any other work of fiction.

  516. #519 cooler
    September 29, 2007

    well I guess hiv fails because of all the long term non progressors, and the fact that almost everyone with hiv is asymptomatic, I guess I could create a 10 year window period with mycoplasma incognitus. I guess hiv fails kochs 3rd postulate as well, bc 99% of animals injected dont get sick

    according to the body’s aids resource famous page Kochs postulates are this.

    epidemiological association
    The mycoplasmas are strongly associated with CFS. A 100% correlation could be acheived by making a postive mycoplasma test a essential criterion for CFS, thats how you idiots got your 100% correlation with hiv/aids.

    Isolation and growth in culture
    shyh ching lo did this, learn from him was considered a scientific genius in china, not a drug company hack like you.

    Induces disease in healthy host.
    every monkey, embryo, mouse sickened and died when injected with mycoplasma penetrans/incognitus. Peer reviewed refrences above. Are you stupid? You call me out on Kochs postulates when hpv, hiv, hep c does not induce disease in virtually every animal.

    You’re a pathetic drug company hack. There is no reason to further debate, Ive already embarrased you enough.

  517. #520 cooler
    September 29, 2007

    Lo found it no healthy controls either, not mycoplasma incognitus/penetrans, please read his studies and learn from a far more accomplished scientist, all the peer reviewed refrences are above. I do not really wish to further debate someone who is on the drug companies payroll in all probablilty, it makes me sick.

    Have you ever taken any money from a drug company for research? please disclose your conflicts of interest Franklin, I can not debate someone who is paid to take certain positions by drug companies, answer honestly. A debate with a drug comapny hack is like debating a robot, there is no point, disclose the funding youve recieved from drug companies now.

  518. #521 Adele
    September 29, 2007

    Debating a robot cooler Really? At least Franklins not using the same sentences over and over since what like five months ago? “armys top scientist, noble prize winners, 99% of animals ” sheesh cooler your like a little parrot at least a robot can have a bigger vocab!

    Anyway wasn’t M.fermentans incog a contaminant?

    J Antimicrob Chemother. 1997 Jan;39(1):25-30, Observations on the possible origin of Mycoplasma fermentans incognitus strain based on antibiotic sensitivity tests. Dr. PC Hannan checks out it’s drug sensistivities finds out it was a contaminant not really isolated from patients.

    J Clin Microbiol. 1992 Sep;30(9):2435-40 Evidence that Lo’s mycoplasma (Mycoplasma fermentans incognitus) is not a unique strain among Mycoplasma fermentans strains. These guys say its not unique. I like this paper its really cool how they check out what different mycoplasmas do on HIV replication. They find out you don’t need real infection with mycoplasma you don’t need live mycoplasma to enhance HIV! Just dead lysed mycoplasma does it! And all the strains not just fermenans incognitus. They do it bc they upregulate cytokines that are good for HIV multiplying. So basically there’s no unique thing about M.f. incognitius in AIDS. It can do stuff right but its not unique sorry cooler.

    Cooler gives us just the stuff he likes I’m putting up these papers to say, no there’s another side to the mycoplasma story and cooler’s ignoring it.

    What if I said oh no you can’t ever detect HIV by antibodies you have to use pcr, cooler He’d go nuts and hte other deniosaurs too. But its ok for his mycoplasma to go all incognito on us. Just hafta believe right cooler.

  519. #522 Chris Noble
    September 29, 2007

    Hey Chris, I see you are not very proud of the fact that your favorite fantasy has resulted in Andre Parenzee being convicted to a 9 year sentence for supposedly spreading HIV. And I see that you are more than happy to project your own inner guilt over his conviction by projecting your guilt onto the dissidents who did their best to defend Parenzee by exposing the flaws of HIV belief. Well, Chris, you did your part to spread the fantasy, not the dissidents. The results fall squarely on you and those you unquestioningly follow.

    Michael, I’m not convinced that a 9 year prison sentence is the best answer. However, Parenzee should take responsibility for his actions. He hasn’t yet.

    Michael you should read the actual editorial by Pillay et al

    They warn against using phylogenetic analysis by itself. Like many other types of forensic evidence juries have to understand the nature of the evidence. Phylogenetic evidence can yield estimates of the probability that two isolates are related. These are probabilities and it does not prove anything with 100% certainty. In the cluster of cases in the adult film industry the sequences from the isolates from all four were 100% identical. The isolates were obtained shortly after infection and little evolution of the virus had occured. In this case the probability that these three people were infected from somebody other than the initial case is very, very small. Together with other evidence that indicate who was infected first it is beyond all reasonable (and unreasonable) doubt that the infections occurrred as described.

  520. #523 Chris Noble
    September 29, 2007

    So basically there’s no unique thing about M.f. incognitius in AIDS.

    What about Garth Nicolson’s proof that M. incognitus has been weaponised with HIV Env?

  521. #524 cooler
    September 29, 2007

    sorry misery women youre wrong again researchers from the university of alabama concluded it was a novel strain, use your brain a ordinary contaminent would not induce disease in animals, u of alabama reserachers injected the ordinary mf into rats, nothing happened, when mfi was injected all hell broke loose.

    Lo had control cultures to ensure it wasnt a contaminent, misery women, call up lo and get injected if you think its harmless

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=8399932&ordinalpos=186&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

  522. #525 Chris Noble
    September 29, 2007

    Chuck wrote:

    I will be all ears and eyes.

    You can open your eyes and take your fingers out of your ears now.

    I wonder if Chuck can tell us exactly what lead to the formation of the Adult Industry Medical Health Care Foundation? Something about porn stars dying from AIDS in the 1980s?

  523. #526 cooler
    September 29, 2007

    misery women,
    I read hannans study, he found one strain of mycoplasma that Lo isolated and speculated it could be a contaminent or just that that patient overused abx. Its a pretty pathetic study from one scientist no ones heard of thats half a paragraph long.

    compare that with everything that lo did to ensure it was a novel strain, he only found it in sick patients, not in anyhealthy controls he identified in the tissues with electron microscopy, he had control cultures, caused disease in healthy hosts.

  524. #527 Chris Noble
    September 30, 2007

    From 1998 through 2005, approximately 81,000 HIV tests were given to men and women in the adult film industry (aka, porn stars) in the greater Los Angeles area, according to Gloria Leonard.

    Maybe Chuck can divulge what the false positive rate was in the 81,000 “totally nonspecific” HIV tests.

  525. #528 franklin
    September 30, 2007

    Cooler,

    Although you claim that “Lo found it no healthy controls either, not mycoplasma incognitus/penetrans,” the peer-revied study that you pointed to as proof that Mycoplasma fermentans causes chronic fatigue syndrome identified this organism in only 32% of chronic fatigue syndrome patients and in 8% of healthy controls.

    How do you explain this?

  526. #529 cooler
    September 30, 2007

    they were looking at all species of mycoplasmas, not the specific 2 species that lo found caused disease when inoculated animals mycoplasma penetrans/incognitus, when lo looked for only those 2 species he found it in ZERO healthy controls read his peer reviewed studies and patents.

    CFS like I said lumps together people who’s symptoms are caused by several different factors. If a positive mycoplasma test was essential for a CFS diagnosis youd have a 100% correlation, thats the trick you guys did with hiv remember?

    You classify diseases together based on the cause, not on sharing similar symptoms, everyone with fatigue is not suffering from the same mechanism of causation.

    Still waiting for the first scientific paper that hiv causes AIDS.

    Still waiting for you to disclose your conflicts of interest, what drug company research money have you recieved?

    All of the scientists that support mycoplasma research are not bought off by drug companies.

    shyh ching lo md phd
    garth nicolson phd
    nancy nicolson phd
    luc montagnier phd
    Joseph tully phd

    What about you? time to come come clean Franklin.

  527. #530 franklin
    September 30, 2007

    Cooler,

    Here’s a quote from the abstract of the paper you sent us to:

    Mycoplasma fermentans, M. hominis andM. penetrans were detected in 32, 9 and 6% of the CFS patients while they were detected in 8, 3 and 2% of the healthy control subjects, respectively.

    According to the paper you cited, M. fermentans was detected in 32% of CFS patients and 8% of healthy controls.

    How do you reconcile this finding with your contention that M. fermentans has been shown to fulfill Koch’s Postulates for Chronic Fatigue Syndrome and your claim that Lo is unable to detect this organism in healthy controls?

  528. #531 cooler
    September 30, 2007

    Drug company hack,
    mycoplasma fermentans (which can be a normal resident of the flora) and mycoplasma incognitus and mycoplasma penetrans are totally differnt strains. LO proved this with extensive electron microscopy/dna/antibody testing, reserachers at the university of Alabama confirmed his claim (see above)

    For example Lo’s incognitus while somewhat similar to mycoplasma fermentans is 1/3 the the size and does induce disease when inoculated into animals, while the ordinary mycoplasma fermantans does not.

    The healthy controls tested positive for the mycoplasma fermantans, not the pathenogenic mycoplasmas, besides i could say the healthy controls are in the “asymptomatic” phase of illness and give them a 10 year window period to make the sick to save my hypothesis, like you guys did with hiv, but I dont need to stoop to your level.

    Why do you keep avoiding my questions? I take it that your non response about drug company funding is a probable yes LOL no wonder.

  529. #532 cooler
    September 30, 2007

    Lo between his patents and papers looked at hundereds of healthy controls and found them in no healthy controls, if m penetrans/incognitus pops up in a few healthy controls, thats normal they could be false positives, they could be in the early stages of infection, etc etc……………….

    obviously more research is needed, Im sorry that your drug company employers are instructing you to “debunk” this research, but its hard to debunk a microbe that kills/sickens every animal injected when the microbes you push hiv, hpv, hepatitis c do
    zilch in virtually every animal.

    get a life I do not wish to debate a man who is on the payroll of a drug company any further. Ive showed this research to many scientists at my old university and they all agree this agent is real and more funding and research is needed, I do not wish to debate hacks that are associated with the Gallo/moore/wainberg drug company mob any longer.

  530. #533 franklin
    September 30, 2007

    Cooler,

    You cited a study as proof that Mycoplasma fermentans incognitius fulfills Koch’s postulates for chronic fatigue syndrome. When I pointed out that the very study you cited only found Mycoplasma fermentans in 32% of CFS cases, you now cliam that mycoplasma fermentans is totally different from mycoplasma incognitius!

    This after you explained to us, above, that “mycoplasma fermentans incognitus is a substrain on mycoplasma fermentans.”

    Are you now claiming that the paper you directed us to as proof that Mycoplasma fermentans incognitius has fulfilled Koch’s postulates for CFS really doesn’t look at this bacterial strain, at all?

  531. #534 Michael
    September 30, 2007

    Roy. You said: That would make 82% bottoms. Do you think such a finding has any implications for a sexually transmitted disease such as HIV Michael?

    I think it has immense implications, Roy. What it means is that there is a lot of oral only sex going on and far less anal then most would think. Matter of fact, Roy. Oral sex transmits few stds.

    This is another reason the HIV causation of AIDS thing does not add up in the gay community. What does add up, is a large number of emotionally stressed out people, in percentages much higher than in the straight community, as is evidenced by substantially higher drug and alcohol addiction and suicide rates.

    I know you are well aware that stress and beating ones self up with life in the fastlane on dope steadily weakens immunity. I know you are well aware that drug and alcohol abuse takes a huge toll on a person physically.

    And falling into emotional states of depression and hopelessness and panic after an HIV or AIDS diagnosis does not help them to recover at all.

    It ain’t rocket science as to why some of these people would get ill or be slow to recover or even die of common ailments, Roy, just simple common sense.

  532. #535 cooler
    September 30, 2007

    Are you stupid Franklin?,
    If a positive mycoplasma incognitus test or mycoplasma penetrans test was an essential criterion for a CFS diagnosis you would get a 100% correlation you dumb retard.

    DAmn go away weve debated this to death, get a life loser, youve made youre pathetic points and Ive blown you away, while youve provided me with NOTHING.

    YOU HAVE NOT DISCLOSED THE FIRST SCIENTIFIC PAPER THAT PROVES HIV CAUSES AIDS

    YOU HAVE NOT DISCLOSED YOUR CONFLICTS OF INTEREST

    GO AWAY, WHY WOULD I ARGUE WITH YOU WHEN I TALK TO REAL SCIENTISTS ALL THE TIME.

    PLEASE MAKE A DRIVE TO WASHINGTON DC, AND HAVE A TALK WITH THE CHEIF THEIR DR. SHYH CHING LO MD PHD. YOU TUBE THAT DEBATE BETWEEN YOU AND HIM, EXPLAIN TO HIM WHY HUMANITY SHOULD NOT FEAR HIS PATHENOGENIC MYCOPLASMAS WHEN THEY KILL EVERY ANIMAL HE INOCULATED AND HE DIDNT FIND IT IN ONE HEALTHY CONTROL.

    AND THEN TAKE AN INJECTION IF YOU STILL THINK THEIR HARMLESS. lO DETERMINED IT TO BE THE CAUSE OF DEATH IN 6 HIV NEGATIVE PEOPLE THAT DIED WITHIN 7 WEEKS OF MYTERIOUS INFECTIONS, HE USED ELECTRON MICROSCOPY TO SEE THE AGENT IN THE TISSUES, ISOLATED AND GREW IN CULTURE AND THE CAUSED DISEASE/DEATH IN HEALTHY ANIMALS. ARE YOU STUPID? WHAT DID THOSE 6 PEOPLE DIE OF YOU PATHETIC HACK?

    I’D LOVE TO SEE THAT DEBATE, A PATHETIC DRUG COMPANY HACK VS THE MOST BRILLIANT SCIENTIST OF HIS GENERATION IN CHINA, WHICH IS WHY THE MILITARY BROUGHT HIM HERE, YOU AREN’T FIT TO SHINE HIS SHOES. BYE BYE THIS DEBATE IS OVER.

  533. #536 Cooler
    September 30, 2007

    and then caused disease when he inoculated healthy animals (mice/primates)

  534. #537 Roy Hinkley
    September 30, 2007

    Roy. Oral sex transmits few stds.

    Few? You mean like six or so? Herpes 1,2 & 8. Gonnorhea, Chlamydia and occassionally syphillis, HIV, HPV and Hepatitiis.

    This is another reason the HIV causation of AIDS thing does not add up in the gay community.”

    By “does not add up” I assume you mean the excellent evidence provided by things like HIV+ status and HHV-8 infection in explaining the high incidence of specific opportunistic infections (like Kaposi’s Sarcoma) in specific risk groups (like male homosexuals)?

  535. #538 franklin
    September 30, 2007

    Michael,

    You brought an article to our attention because you somehow thought it supported your HIV denialist position:

    Specialty Journals
    Date: September 14, 2007

    Science Daily — Differences in sexual behaviours do not fully explain why the US HIV epidemic affects gay men so much more than straight men and women, claims research published ahead of print in the journal Sexually Transmitted Infections.

    When Jim and Roy pointed out that you omitted several key points made by that authors that can account for the differences between the rates of HIV infection in gay men versus the heterosexual population, you reverted to your usual as hominem attacks:

    Gay men DO NOT honestly share their preference with strangers, even when the stranger is another gay. Usually one does not find out the truth until they are naked in bed.

    The 47% who told a stranger they were “versatile” and 12% who refused to be labeled, ARE ALL BOTTOMS.

    Don’t take my word for it Roy, go find ANY gay man, and just ASK HIM what it means when someone gay says they are “versatile”. He will simply chuckle to himself and to you, and tell you that it means they are a bottom.

    Well, Michael, it turns out that at least one of the authors of the paper to which you directed our attention is an openly gay man. Here is a link to an editorial he wrote in favor of same-sex partner benefits and same-sex marriage.

    So, I guess at least one gay man disagrees with your blanket characterization of the sexual behavior of all gay men. Why should we accept your opinion over his, especially since his position is based upon scientific data–not merely on ignorant prejudices.

    The lengths to which you go to maintain the charade of denial that you beleive is somehow magically protecting your lover from the consequences of his HIV infection never ceases to amaze me.

  536. #539 franklin
    September 30, 2007

    Cooler,

    I have not claimed that mycoplasma fermentans incognitius is harmless.

    I have just asked you to back up your claim that mycoplasma fermentans incognitius has been shown to fulfill Koch’s Postulates as the cause of Chronic Fatigue Syndrome. You have been unable to back up your claim with credible evidence.

    You seem to think that the science behind this discovery should be emulated by scientists studying AIDS, but you are unable to explain how the causal association between mycoplasma fermentans incognitius and CFS has been proven.

    You seem to have different standards of proof when discussing mycoplasma fermentans incognitius than when you are discussing HIV.

    Perhaps this is because you have mostly learned about mycoplasma fermentans incognitius from a work of fiction. No, that can’t be it. You have mostly learned about HIV from Denialists Web Sites, which are also works of fiction.

  537. #540 Chris Noble
    September 30, 2007

    Cooler, before you storm off in a flurry of CAPITALs could you write down all of Koch’s postulates and give a reference to the evidence that Mycoplasm incognitus fulfills each one in turn.

    This should be an easy task for you

  538. #541 Chris Noble
    September 30, 2007

    GO AWAY, WHY WOULD I ARGUE WITH YOU WHEN I TALK TO REAL SCIENTISTS ALL THE TIME.

    Who are these “REAL SCIENTISTS”?

  539. #542 cooler
    October 1, 2007

    already did list kochs postulates above any how lo’s pathenogenic mycoplasmas folfill it for the cause of human diseases scroll up. (a subset of cfs/ra/als patients etc) scroll back, youll see how hiv folfills kochs postulates at a much lesser degree.

    I think its time you guys debated lo and montagnier, the nicolsons and tully, or debate me publicly and we can tape it on you tube, the debate will take place in front of scientists and students at a good university, and well take a poll at the end of the debate to see who wins.

    the debate topics will be hiv as the cause of aids
    and mycoplasmas a the cause of human diseases CFS etc.

  540. #543 Chris Noble
    October 1, 2007

    already did list kochs postulates above any how lo’s pathenogenic mycoplasmas folfill it for the cause of human diseases scroll up. (a subset of cfs/ra/als patients etc) scroll back, youll see how hiv folfills kochs postulates at a much lesser degree

    The references that you have given do not support your claim that Koch’s postulates have been fulfilled.

    List Koch’s postulates one by one. Giv a reference for each that demonstrated that Mycoplasma incognitus fulfills each of Koch’s postulates.

    For exactly which disease are you claiming that Mycoplasma incognitus fulfills Koch’s postulates?

  541. #544 cooler
    October 1, 2007

    well I guess hiv fails because of all the long term non progressors, and the fact that almost everyone with hiv is healthy and asymptomatic, I guess I could create a 10 year window period with mycoplasma incognitus to buy time if people were not sick, but there is no need for that. I guess hiv fails kochs 3rd postulate as well, bc 99% of animals injected dont get sick

    according to the body’s aids resource famous page Kochs postulates are this.

    epidemiological association
    The mycoplasmas are strongly associated with CFS. A 100% correlation could be acheived by making a postive mycoplasma test a essential criterion for CFS, thats how you idiots got your 100% correlation with hiv/aids.

    Isolation and growth in culture
    shyh ching lo did this, learn from him was considered a scientific genius in china, not a drug company hack like you.

    Induces disease in healthy host.
    every monkey, embryo, mouse sickened and died when injected with mycoplasma penetrans/incognitus. Peer reviewed refrences above. Are you stupid? You call me out on Kochs postulates when hpv, hiv, hep c does not induce disease in virtually every animal.

    You’re a pathetic drug company hack. There is no reason to further debate, Ive already won

    Refrences all posted above………..this internet debate is over………..debate me publicly on hiv and mycoplasma at cal berkeley, well you tube it, why dont you in your own words say how hiv folfills kochs postulates, please in your own words dont copy and paste from fauci’s website.

  542. #545 Chris Noble
    October 1, 2007

    epidemiological association
    The mycoplasmas are strongly associated with CFS. A 100% correlation could be acheived by making a postive mycoplasma test a essential criterion for CFS, thats how you idiots got your 100% correlation with hiv/aids.

    Which mycoplasma? None of the mycoplasmas are present in a majority of CFS cases. There are also no studies following mycoplasma incognitus infected cohorts to see if they develop CFS or RA or ALS or AIDS etc. There are for HIV. In addition HIV can be detected in close to 100% of AIDS cases even if they were diagnosed with the pre 1993 definition that did not have HIV antibody serology as a criterium.

    Isolation and growth in culture
    shyh ching lo did this, learn from him was considered a scientific genius in china, not a drug company hack like you.

    This has been done for HIV in 1984. Nicolson’s claims about detecting HIV env in the genome of Mycoplasma incognitus makes me suspect that he has a few technical problems.

    Induces disease in healthy host.
    every monkey, embryo, mouse sickened and died when injected with mycoplasma penetrans/incognitus. Peer reviewed refrences above. Are you stupid? You call me out on Kochs postulates when hpv, hiv, hep c does not induce disease in virtually every animal.

    You are again conflating several different mycoplasmas. Which one causes the diseases? Which diseases are these models for? Do they cause CFS in the animals? RA? ALS? AIDS? Nobody is saying that mycoplasmas are harmless but if you are claiming that these animal models fulfil Koch’s postulates then you have to specify which disease they relate to. It is problematic to claim that mycoplasma incognitus causes several different diseases.

    HIV/SIV and SHIV cause specific CD4+ loss, immune suppression and susceptibility to opportunistic infections in various animal models including macaques and SCIDhu mice.

  543. #546 noreen
    October 1, 2007

    More research should be done, especially on those who have died from AIDS. A doctor in Texas found that all of his patients who had died from AIDS also had Herpes Virus 6A, which is very destructive to the immune system. Many believe that HIV is not so important by itself but other co-factors such as the above virus or mycoplasmae such as, penetrans fermentas are the real culprits. An excellent book about the Herpes 6A virus is,”The Virus Within.”

  544. #547 Tara C. Smith
    October 1, 2007

    noreen, almost 100% of the population has had HHV-6. That a doctor found it in all AIDS patients isn’t surprising in the least. (And I’ve read “The Virus Within” and found it wanting in a lot of ways).

    [Edited to add: I should note that "TVW"'s author is another "dissident". ]

  545. #548 noreen
    October 1, 2007

    Yes, all of the population has been exposed to this virus, except one small group of people. Nevertheless, around 95% have been exposed to the harmless variety, which is HVV6B and the other 5% have the “A” variety, which causes havoic in the body when reactivated.

  546. #549 Jim
    October 1, 2007

    Noreen,
    Do you have a source for that?

  547. #550 DT
    October 1, 2007

    And while you look that one up, also give us the rference to your claim that HIV-PCR is positive in HIV negative people.

  548. #551 Braganza
    October 1, 2007

    Cooler

    CFS situation may be improved with chocolate. See BBC link

    http://news.bbc.co.uk/1/hi/health/7018055.stm

    Do you think AIDS could also be treated with chocolate ?

  549. #552 jspreen
    October 1, 2007

    Why are these people like this? What is wrong with their brains?

    I find the above some very interesting questions. Why? Well, because this time they may have been formulated by a HIV=Aids apologist, but each and every HIV=Aids dissident feels the same questions popping up into his brain when reading the Chris Nobel, franklin, etc. contributions.

    Which is one more proof for my statement that, in fact, Aids Apologists and Aids Denialists are one of a kind.

  550. #553 Adele
    October 1, 2007

    Cooler I have some quesitons about CFS and Mycoplasma.

    You say Lo didn’t find the mycoplasma in the GW vets bc he didn’t do PCR. So why did he tell a gov hearing he used PCR and he still didn’t find it?

    The Nicholson daughter infected thier cat with Mycoplasma and it died. Did she inject it or what? What was its name so we can honour it and maybe name a disease after it?

    The Nicholsons hubby and wife say they treated former Prez Bush and Barbara and their dog for mycoplasma is that true? And why the dog are they vets too.

    You say Dr. Lo is the top ranking scientist in Army. What’s his rank? Is he like a five star generallissimo of Armed Pathology?

    You keep talking the Armed Forces of Pathology. I never heard about it and I even know some real patholiogists. What is it?

    So many right wing internet people say the Nicolosons cover up a even bigger government conspiracy. Why are they in the “Zionist-Judeo Media” conspiracy too? Are you cooler?

    Obviously chemtrails are giving us all mycoplasmas. Does the chemtrails projects just do incognitus or are tehy dispensing more kinds of Mycoplasma.

    Why does “byebye I won the debate this is over” mean “Ahhll be baahhck” very soon.

  551. #554 cooler
    October 1, 2007

    misery women,
    you are not even worth talking to.

    Branzaga,
    I dont think chocolate will do much for the subset of cfs patients infected with lo’s pathenogenic mycoplasmas, i think high dose abx is a much better approach. Here is a case study of someone with a cfs like illness who tested positive for mycoplasma incognitus and was cured with high dose abx
    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=1788266&ordinalpos=226&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

  552. #555 cooler
    October 1, 2007

    part of the bioweapons program people, wake up, thats why no one has heard of it, its classified son, its not a coincidence that a military scientist published the most on it, for he had accsess to classified information and was trying to warn the world, but the frauds in charge of the establishment (Gallo fauci) engaged in genocide on the people.

    project day lily
    true story slightly fictionilzed. backed up all the info with peer reviewed sources above

    your government killed 3 million in vietnam, 1 million in Iraq wake up, 60k young soldiers to fight a war in asia for the globalists. Funny how you people find it so hard to beleive in conspiracies considering your governments criminal history.

    the tuskegee experiment, all on wars based on lies project day lily is just an extension of the terror being conducted by the criminal network that controls the government.

    http://www.projectdaylily.com/

    see hiv fact or fraud google it

  553. #556 Adele
    October 1, 2007

    Oooh forgot some apex11

    What is a “pathenogenic mycoplasma” is that more like a parthenogenic or a pathogenic one?

    Also you know Michael Fumento right the right wing journalist critical of big science SARS and stuff right? Weird how he said

    First, 123 different symptoms have been attributed to GWS according to Nicolson’s own assistant, a number which correlates roughly with my findings. But according to the nation’s pre-eminent authority on MF, Dr. Shyh-Ching Lo of the Armed Forces Institute of Pathology, only one symptom – joint problems – seems strongly correlated with MF. Another – breathing problems – may be related. I confirmed this with two other prominent MF researchers. So how do we account for those other 121 symptoms?
    http://www.fumento.com/gulf3.html

    Wow frummyBilly why did he say that is Fumento and Lo in that big conspiracy too?

  554. #557 cooler
    October 1, 2007

    misery women,
    you are really nuts, ill post on whatever forum I want to, why do you care? please stop stalking me, go away, get a life seriously, Lo was being handled by the way. I do not want to talk to you anymore about anything misery women, go away, get out of the house. Do you have any freinds, seriously? get a life.

  555. #558 Adele
    October 1, 2007

    Cooler, not sure why you so angry but I guess its probably bc your wrong about Dr. Lo and you know it.

    When Dr. Lo says something you like then you say he’s a genius and general of the “Armed Forces of Pathology”

    when you don’t like what he says and what he finds in his research then he’s getting “handled” and he’s getting forced to say stuff by the chemtrails gov people who like to infect the Nicolson’s cat with mycoplasma.

    You are one logical man cooler I hope you stick around here! Seriously!

  556. #559 cooler
    October 1, 2007

    Lo SC, Buchholz CL, Wear DJ, Hohm RC, Marty AM.
    Department of Infectious and Parasitic Diseases Pathology, Armed Forces Institute of Pathology, Washington, D.C. 20306-6000.

    The newly recognized human pathogenic mycoplasma M. fermentans (incognitus strain) causes a fatal systemic infection in experimental monkeys, infects patients with AIDS, and apparently is associated with a fatal disease in previously healthy non-AIDS patients. An apparently immunocompetent male who lacked evidence of HIV infection developed fever, malaise, progressive weight loss, and diarrhea and had extensive tissue necrosis involving liver and spleen. M. fermentans (incognitus strain) was centered at the advancing margins of these necrotizing lesions. Following the treatment of 300 mg doxycycline per day for 6 weeks, he recovered fully. He has no fever or diarrhea, and his abnormal liver function tests have returned to normal. He regained all lost strength and 14 kg of lost weight and has remained disease free for more than 1 year.

    PMID: 1788266 [PubMed - indexed for MEDLINE]

    yep just joint pains lol kills monkeys, kills hiv negative patients within 7 weeks, causes lesions in organs………….good day misery women leave me alone

  557. #560 Adele
    October 1, 2007

    Cooler you can learn alot from Dr. Lo. HE says “apparently is associated” You say “IT KILLS EVERYTHING IN ITS PATH 99% OF ALL LIFE IN THE UNIVERSE”

    I just told you what Fumento said I thought maybe you’d listen to a right winger like you. But no.

    Vernon, Shukla and Reeves in J Med Microbiol 2003 have this article called “Absence of Mycoplasma species DNA in Chronic fatigue syndrome”

    If you read it you find out why the Nicolsons might be wrong I mean beyond thinking they cured former Prez Bush’es dog of Mycoplasma and their cat died of it. This is Vernon et al,

    Our goal was to reproduce the results of Nasralla et al. (1999) and Nijs et al. (2002) in a systematic way by using well-defined CFS subjects and non-fatigued controls. These authors detected the presence of four species of Mycoplasma DNA in patients with CFS and fibromyalgia. These studies used patients in tertiary care clinics rather than the general population and the results may reflect recruitment bias. Our study tested persons with CFS identified in the general population. Previous studies did not include appropriate controls, thus reported associations may be spurious. Our study enrolled non-fatigued controls from the same population as CFS cases.

    Recruitment bias cooler. See no one says Mycoplasma isn’t interesting we all think it should get researched. That’s why Tony Fauci asked Lo to give a talk back in the eighties when he found the mycoplasma but Lo refused six times. everyone thinks its good to look at cooler. IT’s probably another opportunistic infection like PCP or KSV and stuff. Maybe its more than that who knows yet. But a bunch of people don’t find it more often in HIV then in uninfected people and that includes Montagnier WITH PCR. And people like Vernon et al who used better sampling then Nicolson don’t find it in CFS patient.

  558. #561 cooler
    October 1, 2007

    “Although cell-free plasma DNA may have limitations for monitoring the presence of Mycoplasma species, we believe this is unlikely, as numerous other cell-associated microbial pathogens can be detected readily in cell-free plasma DNA ”

    they did not look for it in the actual cells/ tissues like lo and nicolson did, and then made speculations.

  559. #562 cooler
    October 1, 2007

    yep that meeting did take place in 1990,

    The meeting was led by Dr. Joel B. Baseman, a mycoplasma expert at the University of Texas Health Sciences Center at San Antonio. He said the participants were ”very impressed with the quality of science that Dr. Lo’s group displayed.”

    ”The pathology data was solid and convinced us that the agent is in the tissues,” Dr. Baseman said. The ability of M. incognitus to cause a fatal wasting disease in monkeys and mice persuaded most participants that the microbe ”has the potential to cause disease in humans,” Dr. Baseman said, although solid proof is lacking.
    new york times 1990

    a year later the Miami herald impressed with LO’s work tried to call fauci and ask him what happened after the panel reccomended funding and research, faucis response

    When asked for an interview concerning Lo’s work, NIAID director Anthony Fauci said through spokesperson Mary Jane Walker that he “will not talk about mycoplasma or any other AIDS co-factor.”

    miami herald 1990, no reason why he refused funding, just didnt want to upset the hiv religion, even though this microbe sickened and killed hiv negative patients………….FAUCI IS GUILTY OF GENOCIDE, for this microbe has infected a subset of cfs/als patients and been the final death blow to many AIDS patients

  560. #563 AK
    October 1, 2007

    Hi Tara…

    I’m not really buggy (heh) on the subject of genetic diversity, but I’ve always thought that was an issue that deserves more attention, either from those studying AIDS or in communicating the results to us amateurs (or maybe both).

    My thought is that an HIV infection won’t cause AIDS unless it has enough diversity in its initial infection(s) so that between recombination and mutation it can stay ahead of the immune system.

    It’s been a while (years) since I dug into the literature, and most of it’s locked away where you have to pay for it, but I just ran across this article referenced in a recent article in PLoS ONE that documents apparent recombination as well as “superinfection”. From the discussion:

    Two main consequences could be derived from this study. From a virological point of view, this work reports the first case of a dual superinfection that, together with a recombination event between the infecting strains, provides evidence for the extremely high viral genetic diversity and complexity that can be observed in HIV-1 in vivo infections. From the clinical perspective, we have demonstrated that superinfection (with >1 strain) could occur at any moment during the infection. These results highlight the importance of reducing risky behaviors in HIV-1-infected individuals.

    Please correct me if I’m wrong, but doesn’t this sort of imply that it may not be HIV per se that produces AIDS so much as infection by a sufficiently diverse population of HIV?

    BTW, I noticed some mention of resistant strains and “Voluntary treatment interruptions and poor adherence to treatment“. Could this sort of thing be building up new, resistant populations of HIV?

  561. #564 cooler
    October 1, 2007

    Yo, I have a comment being held in moderation that refutes Adeles lie that Lo refused to disclose his research
    http://query.nytimes.com/gst/fullpage.html?res=9C0CE3DF1038F935A25752C0A966958260&sec=&spon=&pagewanted=1

    scientists sent from the NIH were very impressed with Lo’s work and reccomeneded further research/funding,
    a year later the miami herald called Fauci to ask why there has been no funding, with no reason he said he would not discuss “mycoplasmas” aka he caused genocide bc he didnt want to upset the hiv religion

  562. #565 Michael
    October 1, 2007

    Franklin, The lengths to which you go to maintain the charade of denial that you have enriched yourself through, never ceases to amaze me.

    You asked: So, I guess at least one gay man disagrees with your blanket characterization of the sexual behavior of all gay men. Why should we accept your opinion over his, especially since his position is based upon scientific data–not merely on ignorant prejudices.

    First of all, Frankie, I could not care less what YOU think or whose opinion YOU accept, as you have already shown yourself to be challenged at your limited attempts to quantify the realities of life into scientific data and assundry extrapolations.

    Secondly, this guy is as nerdie as you and has near zero experience in the gay community at large. He is sweet, unlike you, but just as nerdie, with just as very little real life experience.

    Thirdly, as a “scientist”, he could only answer for the data that he collected, whether individuals he queried were threatened by the very question or not, and whether they told the truth or not.

    Fourth, even with his extrapolations and even with his “opinions” as to what his extrapolations mean, the fact is the data still comes up as nonsensical in relating valid reasons for gays versus straights.

    Fifth, and the greatest reason is that most of his MSM “subjects” were also illicit drug abusers with various other time and again verified “cofactors” from heterosexuals at large.

    Sixth, we have NO idea of how he had even verified what he believed to be HIV infections. He certainly didn’t isolate it from anyones sera! Nor did he check it against the well known list of factors that have well been verified to cause false positive results.

    But at least he received a well paid grant for producing another meaningless study that was conclusive of nothing, and that again shows that you HIV researchers don’t have the slightest clue what is going on.

  563. #566 franklin
    October 1, 2007

    Cooler,

    You referred to a report that you characterized as a “case study of someone with a cfs like illness who tested positive for mycoplasma incognitus and was cured with high dose abx.”

    You later posted the abstract from this paper, including this description of the patient:

    An apparently immunocompetent male who lacked evidence of HIV infection developed fever, malaise, progressive weight loss, and diarrhea and had extensive tissue necrosis involving liver and spleen.

    Cooler, this patient’s disease is nothing like chronic fatigue syndrome. Extensive tissue necrosis involving the liver and spleen rules out chronic fatigue syndrome.

    In his paper looking at the possible association of M. fermentans with Gulf War Syndrome, here’s how S. C. Lo characterized this patient and similar patients:

    We later reported, in non-HIV infected patients, a previously unrecognized fulminant disease apparently associated with systemic M. fernentans infection [6-91. These highly unusual cases revealed a rapidly deteriorating illness with adult respiratory distress syndrome (ARDS) and/or multiple organ failure. These findings suggested that M. fernfentans may be pathogenic in humans. However, although no other infectious agents could be identified, it was not clear if these patients had another yet unknown underlying condition.

    [Lo et al. (2000) Lack of Serological Evidence for Mycoplasma fermentans Infection in Army Gulf War Veterans: A Large Scale Case-Control Study. Epidemiology and Infection, 125:609-616.]

    Again, a “fulminant illness” is nothing like chronic fatigue syndrome. And it seems that S.C. Lo feels that he has not proven that M. fermentans was the cause of illness in these patients.

    On the other hand, the response of this patient’s illness to doxycycline suggests an obvious test of the hypothesis that chronic fatigue syndrome is due to M. fermentans (incognitus strain).

    Seems strange that after all this time Nicolson hasn’t published a randomized trial of doxycycline for chronic fatigue syndrome.

    Such a trial has been published for Gulf war syndrome (491 patients with mycoplasma detectable in the blood), but a one year course of doxycycline led to no improvement in symptoms compared to placebo.

  564. #567 franklin
    October 1, 2007

    Michael,

    Just admit that you were wrong. Here is what you said:

    Don’t take my word for it Roy, go find ANY gay man, and just ASK HIM what it means when someone gay says they are “versatile”. He will simply chuckle to himself and to you, and tell you that it means they are a bottom.

    It turns out at least one of the authors of the paper is an openly gay man.

    So you are wrong–”ANY gay man” will not agree with your blanket characterization.

    Continuing your ad hominen attacks that the scientist is “nerdie” in no way helps your case.

  565. #568 Michael
    October 1, 2007

    Hello AK. The link you put up says a lot, depending on the viewpoint you look at it from:

    http://www.jaids.org/pt/re/jaids/fulltext.00126334-200605000-00002.htm;jsessionid=HB5Tr4kSnHGKsTVsn8vLpF1mHvWDsFlskQnvbFb0vvW0RJQ9hv5j!1330140564!181195629!8091!-1

    You said: “My thought is that an HIV infection won’t cause AIDS unless it has enough diversity in its initial infection(s) so that between recombination and mutation it can stay ahead of the immune system.

    However, the link to the guy you show us in the study verifies the following, which shows this guy to be nonstop abusing himself by IV drug abuse since 1981, and further shows him to be on extremely harsh aids drugs, including AZT, D4T (related to DDT), 3TC, and others, all with well verified extremely toxic effects (just google them) on his entire body:

    The plasma samples analyzed were obtained from an HIV-1 patient diagnosed in 1987 who reported continuous intravenous drug use since 1981

    AK, is not being a verified self destructive junkie, with all of its own associated emotional negativity, poor nutrition, etc, not quite “enough diversity” as you put it, of a reason to have an extremely rundown immune system?

    If it is not, perhaps we can add in the fact that he has also been taking the following highly toxic drugs with vast verified toxic effects including attacking bone marrow, since 1995:

    FIGURE 1. Immunological and virological characteristics of the patient follow-up. Different antiretroviral regimens are AZT + didanosine Symbol, AZT + zalcitabine Symbol, 3TC + d4T + NFV Symbol, didanosine + d4t + NFV Symbol, and d4T + indinavir (IDV) + ritonavir + abacavir Symbol. Short treatment regimens (15 days of treatment) are indicated by vertical gray arrows in the x axis; first, 3TC + d4T + IDV, and later, d4T + IDV + ritonavir + abacavir.

    And if that is not “enough diversity” for you, consider just for a moment factoring in this obviously self destructive individuals personal emotional stress factors over the years of shame, guilt, apathy, etc, including the intensity of his diagnoses of HIV and AIDS, which all must have been quite intensely stressful and shocking to his immune system by themselves.

    Would you, AK, agree or disagree that with all this person had going on, it is impossible to say what part of his problems were caused by what, or do you simply attribute any and all health problems strictly to HIV?

    Should you find that the overall assault on this guys body, from drugs, nutrition, AIDS drugs, emotions, and perhaps even other things this guy went through is enough to take down most peoples health, then you will understand why there are so many HIV dissidents who say: “Its NOT THE HIV, Dummy!”.

  566. #569 Michael
    October 1, 2007

    AK, looking at your link also shows us that the patient was in prison as well, as the piece thanks the prison’s doctor.
    Only of interest as again it evidences a highly stressed life which certainly affects ones immune system.

    Also of extreme note, at least from a dissident perspective, is that the patients CD4 (T-Cell) count, and his viral load, show absolutely no correlation with each other!

    So much for CD4 counts and viral load counts being meaningful of anything having to do with each other.

    Did the HIV researchers ever get anything right?

  567. #570 cooler
    October 2, 2007

    “seems strange” when there is no funding its a bit difficult

    besides the necrosis, that patient could have easily been diagnosed with CFS…..or a number of garbage can diagnosis’s, funny how you have such a explicit defintion for CFS must be, but when it comes to hiv its ok for some people to have dementia, some not, ok to have some progress in 2-3 years, and others progress in 20 years, thats all ok right?

    the real question is if you are not feeling well, and have been given a mulititude of garbage can diagnosis like MS, Fibromylagia, CFS, you should have a right to get tested for a microbe that kills/sickens every animal inoculated unlike hiv.

    I know of several people that have recieved several of these diagnosis’s simultuaneoulsy! You dont group diseases by the symptoms, you group them by the cause.

    And bc its clear that LO’s pathenogenic mycoplasmas kill every animal injected, are found in the tissues of people who died of mysterious infections, are not found in healthy controls and there are clear correlations PCR with a subset of CFS/RA/ALS patients, you should get tested and treated if pcr positive, especially with strain ingonitus/penetrans if you are not feeling well, and get a new diagnosis every week.

    I know this will lose a lot of money for the drug companies you work for, but for people who are feeling horrible with this microbe in thier blood they have every right to eradicate it with ABX.

    As for that gulf war abx study, well if you wait 14 years to treat the infection, any infection chances are slim for a recovery, try treating a syphillis patient 14 years later. Secondly the study was conducted by several people who didnt want national scandal, ie how did the mycoplasma get in their blood?

    Independent scientists should conduct studies.

  568. #571 Chris Noble
    October 2, 2007

    besides the necrosis, that patient could have easily been diagnosed with CFS…..or a number of garbage can diagnosis’s, funny how you have such a explicit defintion for CFS must be, but when it comes to hiv its ok for some people to have dementia, some not, ok to have some progress in 2-3 years, and others progress in 20 years, thats all ok right?

    HIV causes a particular form of immune suppression with the specific depletion of CD4+ cells.

    the real question is if you are not feeling well, and have been given a mulititude of garbage can diagnosis like MS, Fibromylagia, CFS, you should have a right to get tested for a microbe that kills/sickens every animal inoculated unlike hiv.

    Mycoplasmas do not cause MS, Fibromyalgia, CFS, AIDS, rheumatoid arthritis, GWS in animals.

    You are claiming that a multitude of diverse illnesses are all cuased by mycoplasma incognitus. The evidence that you have presented is not sufficient to conclude a relationship between mycoplasmas and one of them let alone all of them.

  569. #572 franklin
    October 2, 2007

    Cooler,

    Doxycycline is cheap. It would not be an expensive study.

    Then again if it showed no improvement, it might be bad for business.

    Liver necrosis is not a minor difference. S. C Lo, himself, describes the patient as having a “fulminant infection.” Look that up in the dictionary and see if it sounds anything like chronic fatigue syndrome

  570. #573 cooler
    October 2, 2007

    an hiv patient with dementia and one w/o dementia is no minor difference, so they possibly couldnt have the same cause (HIV) LOL

  571. #574 Michael
    October 2, 2007

    Chris, you said: “HIV causes a particular form of immune suppression with the specific depletion of CD4+ cells.”

    However, you forgot to mention that this only happens in a small percentage of the HIV diagnosed. And quite far from all of them.

    Even DT, the avowed HIV negative HIV believer and AIDS clinician admitted to personal CD4 counts that varied greatly, including as low as 400, and was even free of HIV infection.

    DT’s 400 count, which would have been classified as AIDS or on the way to progressing to AIDS at the time were DT an HIV positive, he/she would even have been recommended by the CDC to be taking the aids drugs that he/she has prescribed for decades.

    The fact is, CD4 counts are seldom ever even tracked in any other diagnosis other than HIV, so who knows what CD4 counts anyone would have with or without any other known or unknown infections of any other viruses or diagnoses.

    Furthermore Chris, you seem to have conveniently forgotten that Rodriguez et al found CD4 counts as having no bearing in progression to AIDS, except for a small percentage of individuals.

    How convenient that selective memory of yours seems to be, Chris!

  572. #575 cooler
    October 2, 2007

    Lo’s mycoplasmas cause disease in animals, fatal in monkeys/mice none of the control animals got sick died, but in one of his patents lo incoculated chimpanzees with m penetrans, he said they got “symptoms of AIDS”, while the controls didnt.

    he didnt talk much about it, this was years later probably bc he gave up on the scientific establishment knowing it was dominated by criminals like Fauci/Gallo.

    Funny how you you scrtutize Lo’s animal models, when hiv does nothing in chimpanzees (2-3 were immunosupressed after living in a cage for 20 yrs, what do you expect, the rest were fine), mice, dogs, cats etc etc. I love your animal models for hiv, siv that doesnt occur in the wild, only occurs in macaque monkeys and there is no 10 year latent period.

    Or that mouse that was engineered to have a human immune system! Im sure the process of an immune transplant is a far more likely cause of illness in that poor mouse, how do you think a human would feel if they were given an immune transplant from a member of another species?

  573. #576 Michael
    October 2, 2007

    By the way Chris, Tony Fauci, director of NIAIDS, says you are full of crap about HIV causing a loss of CD4 T Cells. Tony Fauci says HIV infection INCREASES CD4 T-CELLS, and quite well pointed out that HIV drugs themselves cause loss of these cells:

    For some reason, perhaps personal modesty, Dr Fauci had not informed the general public previously of his breakthrough in understanding, but merely communicated it to the Proceedings of the National Academy and included it in a chapter on the Immunology of AIDS he wrote for the textbook “Fundamental Immunology”, edited by William E. Paul MD and published by Lippincott, Williams and Wilkins in 2003 (p. 1295):

    Fauci pointed out:

    “Several investigators have demonstrated that there is an increase in CD4+ T-cell proliferation in both HIV and SIV infection. In certain studies, the enhanced T-cell proliferation that was observed during active disease was significantly decreased following the initiation of anti-retroviral therapy, and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals”.

    What Fauci confirmed to the few graduate students and working scientists who perused this book was that the result of HIV arriving in the human body was to touch off and maintain proliferation of T-cells, rather than killing them off.

    What happens is that for a 56 fold (5600 per cent) gain in HIV early on CD4 T-cells drop maybe 6% but CD8 T-cells rise 20 per cent. The net increase is there until drugs are provided, in which case this beneficial effect is wiped out. If the drugs are stopped, then the benefit is once again felt.

    The total outcome is hidden in the complexity of the immune system – there are other major factors involved in the standard and rather misleading T-cell count, such as rate of production, redistribution, longevity of cells, level of apoptosis and activation induced cell death – but these trends are clear.

    Thanks to http://www.scienceguardian.com/blog/how-fauci-solved-aids.htm

  574. #577 franklin
    October 2, 2007

    Cooler,
    You continue to claim that the case report you brought to our attention represents a CFS-like illness.

    Please direct us to any study of Chronic Fatigue Syndrome in which the patients show a fulminant course with extensive necrosis of the liver and spleen.

    Please don’t send us to Project Day Lily or any other work of fiction.

  575. #578 Chris Noble
    October 2, 2007

    However, you forgot to mention that this only happens in a small percentage of the HIV diagnosed. And quite far from all of them.

    In studies where cohorts have been followed only a small proportion do not show progressive depletion of CD4+ cells. LTNPs are a minority.

    Even DT, the avowed HIV negative HIV believer and AIDS clinician admitted to personal CD4 counts that varied greatly, including as low as 400, and was even free of HIV infection.

    CD4+ counts vary from individual to individual and from time to time. In non HIV infected people the average CD4+ count is much higher and the distribution goes to zero at around 200.

    In HIV negative people some low CD4+ cell counts occur but these are transient. In comparison CD4+ counts in HIV infected people start in the normal range and decrease progressively over time. Eventually CD4+ counts progress to single digits.

    The fact is, CD4 counts are seldom ever even tracked in any other diagnosis other than HIV, so who knows what CD4 counts anyone would have with or without any other known or unknown infections of any other viruses or diagnoses.

    There are studies that have looked at CD4+ counts in non-HIV infected people. DT has personally taken part in one of them.

    Furthermore Chris, you seem to have conveniently forgotten that Rodriguez et al found CD4 counts as having no bearing in progression to AIDS, except for a small percentage of individuals.

    I am yet to hear a single HIV “rethinker” accurately describe this paper. Your version here bears no resemblance to the paper at all. What are you talking about? Have you read the paper?

    How convenient that selective memory of yours seems to be, Chris!

    I can’t remember things that never were.

    However, I do remember you promising to give up your Denialism if the Parenzee appeal failed.

  576. #579 cooler
    October 2, 2007

    a patient complains of diahrrea, mild fatigue, painful urination, memory loss, joint pain she claims its slowly worsening. All tests are normal, except for an abnormal spect scan, and some lymph node swelling.

    Most doctors write it off as stress, one gave her a diagnosis of CFS, another lupus, another complicated depression w mild paranioa, all the while she has Lo’s mycoplasma penetrans in her blood.

    The patient repeatedly goes to the doc saying the symptoms are worsening. Patient feels suicididal and does not respond to antidepressents………………………

    HOW DARE YOU NOT LET HER KNOW ABOUT LO’S RESEARCH AND THAT SHE IS PCR POSITIVE FOR MYCOPLASMA PENETRANS, a microbe that causes aids like symptoms in chimps and kills every other animal inoculated ARE YOU PEOPLE SICK TO NOT INFORM HER OF THIS?

  577. #580 Chris Noble
    October 2, 2007

    What Fauci confirmed to the few graduate students and working scientists who perused this book was that the result of HIV arriving in the human body was to touch off and maintain proliferation of T-cells, rather than killing them off.

    Michael, unlike you, I have actually read this chapter. It takes a high level of arrogance, ignorance, dishonesty and stupidity on Liversedge’s part to misinterpret the chapter in this manner.

    The actual text and the references cited do not support Liversedge’s contorted misrepresentation.

    Several investigators have demonstrated that there is an increase in CD4+ T cell proliferation in both HIV and SIV infection. In certain studies, the enhanced T cell proliferation that was observed during active disease was significantly decreased following the initiation of anti-retroviral therapy, and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals.

    Mathematical models of lymphocyte turnover derived through analysis of immediate changes in circulating CD4+ T-cell counts in individuals following the initiation of HAART led to estimates that approximately 2 × 109 CD4+ T cells are destroyed, and replenished, each day (21,288). However, studies utilizing a variety of techniques to measure lymphocyte proliferationdincluding Ki-67, BrdUrd, and 2H-glucosedto evaluate the effects of HIV on T-cell turnover have yielded mixed results. Several investigators have demonstrated that there is an increase in CD4+ T-cell proliferation in both HIV and SIV infections (289-297). In certain studies, the enhanced T-cell proliferation that was observed during active disease was significantly decreased following the initiation of antiretroviral therapy (289,291,295), and proliferation increased again in parallel with plasma viremia following the cessation of treatment in these individuals (289). These data suggest that HIV infection results in a high turnover of CD4+ T cells, perhaps as a consequence of destruction of CD4+ T cells through certain of the mechanisms reviewed above. However, several investigators have had contrary results and have suggested that HIV replication blocks the ability of new CD4+ T cells to regenerate (294,296-298).

    289. Lempicki RA, Kovacs JA, Baseler MW, et al. Impact of HIV-1 infection and highly active antiretroviral therapy on the kinetics of CD4+ and CD8+ T cell turnover in HIV-infected patients. Proc Natl Acad Sci U S A 2000; 97: 13778 – 13783

    290. Mohri H, Bonhoeffer S, Monard S, et al. Rapid Turnover of T Lymphocytes in SIV-Infected Rhesus Macaques. Science 1998; 279: 1223 – 1227

    291. Zhang ZQ, Notermans DW, Sedgewick G, et al. Kinetics of CD4+ T cell repopulation of lymphoid tissues after treatment of HIV-1 infection. Proc Natl Acad Sci U S A 1998; 95: 1154 – 1159

    292. Sachsenberg N, Perelson AS, Yerly S, et al. Turnover of CD4+ and CD8+ T lymphocytes in HIV-1 infection as measured by Ki-67 antigen. J Exp Med 1998; 187: 1295 – 1303

    293. Rosenzweig M, DeMaria MA, Harper DM, et al. Increased rates of CD4(+) and CD8(+) T lymphocyte turnover in simian immunodeficiency virus-infected macaques. Proc Natl Acad Sci U S A 1998; 95: 6388 – 6393

    294. Hellerstein M, Hanley MB, Cesar D, et al. Directly measured kinetics of circulating T lymphocytes in normal and HIV-1-infected humans. Nat Med 1999; 5: 83 – 89

    295. Hazenberg MD, Stuart JW, Otto SA, et al. T-cell division in human immunodeficiency virus (HIV)-1 infection is mainly due to immune activation: a longitudinal analysis in patients before and during highly active antiretroviral therapy (HAART). Blood 2000; 95: 249 – 255

    296. McCune JM, Hanley MB, Cesar D, et al. Factors influencing T-cell turnover in HIV-1-seropositive patients. J Clin Invest 2000; 105: R1 – R8

    297. Fleury S, Rizzardi GP, Chapuis A, et al. Long-term kinetics of T cell production in HIV-infected subjects treated with highly active antiretroviral therapy. Proc Natl Acad Sci U S A 2000; 97: 5393 – 5398

    298. Fleury S, de Boer RJ, Rizzardi GP, et al. Limited CD4+ T-cell renewal in early HIV-1 infection: effect of highly active antiretroviral therapy. Nat Med 1998; 4: 794 – 801

    299. Folks TM, Kessler SW, Orenstein JM, et al. Infection and replication of HIV-1 in purified progenitor cells of normal human bone marrow. Science 1988; 242: 919 – 922

  578. #581 cooler
    October 2, 2007

    Hosts respond differently to infections, with hiv some get dementia some dont, some people recover from meningitis/ebola some dont, use your brain.

    you group diseases bases on the cause, not symptoms

    If 10 people had a headache, and the cause in 5 was a virus, and the other five it was stress IT DOES NOT MEAN THAT THE VIRUS IS NOT THE CAUSE OF THE HEADACHE IN THOSE 5 PEOPLE, JUST BC THERE ARE OTHER PEOPLE WITHIN THE SAME GROUP WITH THE SAME SYMPTOMS.

    WITH CFS ITS THE SAME, JUST BC THE SYMPTOMS ARE SOMEWHAT SIMILAR DOESNT MEAN THE CAUSE IS THE SAME IN EVERY PATIENT. SO THEY SHOULD NOT BE GROUPED TOGETHER, THEY SHOULD BE DIVIDED BASED ON THE CAUSATION, WITH SOME IT COULD BE DEPRESSION , OTHERS MYCOPLAMSA INCOGNITUS, OTHERS METABOLIC DISORDERS………..ETC

  579. #582 Michael
    October 2, 2007

    “In studies where cohorts have been followed only a small proportion do not show progressive depletion of CD4+ cells.”

    Prove it Chris, with a cite, so I can take down your cite by showing all of the drug addicts and all of the people taking ARV’s which are proven to lower CD4 counts, and all of the other cofactors to CD4 loss and poor immune system health in every cohort cite that you present.

    “LTNPs are a minority.”

    Really? They had no problem rounding up a thousand of them in short order in Boston recently. And that they found that many when the vast majority of Long Term NonProgressors’s refuse to have anything to do with HIV drugs or HIV doctors and researchers is fairly amazing.

    LTNP’s and even HIV positives who take the AIDS drugs are not displaying any immune problems or any low CD4 counts unless they have other cofactors of self destructive behaviors and other factors, including some of the HIV drugs.

    “CD4+ counts vary from individual to individual and from time to time.”

    Exactly. So why are you trying to attribute it to HIV.

    I can’t remember things that never were.

    How convenient to decide that things that go against your propaganda and preaching “never were”. But your memory lapses do not erase Rodriguez et al from the books, now do they.

    Furthermore, Chris, you conveniently have also forgotten the very recent CD4 mathematical modelling study that also shows CD4 counts to be impossible to being due to HIV.

  580. #583 Jim
    October 2, 2007

    Michael,
    From your link above:
    “”Our assessment of these natural hosts like mangabeys offers insight into the disease and shows us that progression to AIDS likely results from the cumulative effects of HIV/SIV replication, CD4 T-cell depletion, generalized immune activation and non-CD4 T-cells depletion or dysfunction,” said Sodora.”

    You see that, GENERALIZED IMMUNE ACTIVATION. HIV infection is recognized and the body reacts the same way it does to other viral infections. This is not as wild and crazy of an idea as you seem to think it is. The problem is when the immune system is activated for prolonged periods of time (ie-neutralizing antibodies no longer effective because escape mutant expansion), resulting in T cell exhaustion. Read this:

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17272504&ordinalpos=7&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

    And in case you didn’t notice, an increase in CD8+ T cells is responsible for the increased T cell population. This would be expected, as CD8+ T cells are the primary effector cells of an aquired anti-viral response (you did know HIV is a virus, right?)

  581. #584 Franklin
    October 2, 2007

    Michael,

    Once again you demonstrate your ignorance.

    Unlike the blind men and the elephant, your ignorance is voluntary. You are the ostrich and the elephant, burying your head in the sand while trying to describe that which your refuse to see.

    The full text of the PNAS paper you refer to is available free of charge to anyone who is interested.

    This paper does not demonstrate that “HIV infection INCREASES CD4 T-CELLS,” as you falsely claim. Nor does the paper show that “HIV drugs themselves cause loss of these cells.”

    This paper shows an increase in the proliferation of CD4 T-cells in HIV-infected patients, even though the level of CD4 T-cells declines.

    Hmmmmm? How could the number of cells decline even if cell proliferation increases? Oh, I get it, the cells are dying!

    The finding that HIV RNA plasma levels correlate with levels of T cell proliferation strongly suggests that polyclonal lymphocyte activation and T cell division are driven by the level of viral replication. Blocking HIV-1 replication with HAART leads to decreased immune activation, cell division, and cell death. By treating HIV-1 infection with HAART, although one sees decreases in CD4+ T cell division, there is an increase in the CD4+ T cell count as the rate of CD4+ T cell production (although now decreased) exceeds the rate of cell death. Conversely, after cessation of HAART, although one sees increases in CD4+ T cell division, T cell counts decline as cell death exceeds cell production as the viral load rebounds.

    Michael, in this case you are copying-and-pasting from what, I guess, passes as a leading Denialist Web Site–and they got the science completely wrong. Compare the actual paper to the distortion from the Denialist Web Page–Such a distortion cannot possibly be an honest mistake. It can only be a lie by individuals with a baltant disregard for the truth.

    I can see why youget along with them so well.

  582. #586 Jim
    October 2, 2007

    A couple more:
    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17641065&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

    “Programmed death 1 expression on HIV-specific CD4+ T cells is driven by viral replication and associated with T cell dysfunction”

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=16917489&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

    “Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.”

    Seriously Michael, go to one of the above links, read the paper and then follow the links on the side to more papers and stop reading the denialist websites.

    As for “you are full of crap about HIV causing a loss of CD4 T Cells” read these and again, please follow the links and read up.

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=9028959&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

    “Role of Fas ligand and receptor in the mechanism of T-cell depletion in acquired immunodeficiency syndrome: effect on CD4+ lymphocyte depletion and human immunodeficiency virus replication”

    http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=16046522&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

    “CD4+ T-cell death induced by infectious and noninfectious HIV-1: role of type 1 interferon-dependent, TRAIL/DR5-mediated apoptosis”

  583. #587 Chris Noble
    October 2, 2007

    Really? They had no problem rounding up a thousand of them in short order in Boston recently. And that they found that many when the vast majority of Long Term NonProgressors’s refuse to have anything to do with HIV drugs or HIV doctors and researchers is fairly amazing.

    The elite controller study was recruiting worldwide for volunteers. The eligibility criteria included not taking antiretrovirals so it is hardly a surprise that they do not take antiretrovirals.

    As you refer to the work done in Boston do you actually read the papers that they write?

    Like the one currently online at Nature Immunology.
    Published online: 30 September 2007 | doi:10.1038/ni1515
    Upregulation of CTLA-4 by HIV-specific CD4+ T cells correlates with disease progression and defines a reversible immune dysfunction

    How convenient to decide that things that go against your propaganda and preaching “never were”. But your memory lapses do not erase Rodriguez et al from the books, now do they.

    I don’t expect that Rodriguez would like to be erased. I do expect that he would appreciate it if scientifically illiterate people would stop misrepresenting his paper. Your description of the study bears no resemblance to the actual data.

    Furthermore, Chris, you conveniently have also forgotten the very recent CD4 mathematical modelling study that also shows CD4 counts to be impossible to being due to HIV.

    I am not going to forget something that isn’t true. The paper that you refer to does not say this. The authors of the paper do not say or believe that the paper says that HIV cannot cause AIDS.

  584. #588 Chris Noble
    October 2, 2007

    Really? They had no problem rounding up a thousand of them in short order in Boston recently

    Ummm. They still appear to be recruiting. Have they gotten 1000 elite controllers yet. They report that they are attempting to find 1000. Are you sure that you aren’t — misreading something?

    They also state that they estimate that 1 in 300 HIV infected people are elite controllers

  585. #589 Chris Noble
    October 2, 2007

    Really? They had no problem rounding up a thousand of them in short order in Boston recently.

    As far as I can tell they’re up to 300 and still recruiting. If you have better information then tell us.

    In the mean time if you know anybody that is eligible then get them to volunteer.

    http://www.massgeneral.org/aids/hiv_elite_controllers.asp

    It only involves giving a single blood sample.

  586. #590 Chris Noble
    October 2, 2007

    If 10 people had a headache, and the cause in 5 was a virus, and the other five it was stress IT DOES NOT MEAN THAT THE VIRUS IS NOT THE CAUSE OF THE HEADACHE IN THOSE 5 PEOPLE, JUST BC THERE ARE OTHER PEOPLE WITHIN THE SAME GROUP WITH THE SAME SYMPTOMS.
    WITH CFS ITS THE SAME, JUST BC THE SYMPTOMS ARE SOMEWHAT SIMILAR DOESNT MEAN THE CAUSE IS THE SAME IN EVERY PATIENT. SO THEY SHOULD NOT BE GROUPED TOGETHER, THEY SHOULD BE DIVIDED BASED ON THE CAUSATION, WITH SOME IT COULD BE DEPRESSION , OTHERS MYCOPLAMSA INCOGNITUS, OTHERS METABOLIC DISORDERS………..ETC

    So what you are saying is that Mycoplasma fermentans(incognitus) does not fulfil Koch’s postulates.

  587. #591 noreen
    October 2, 2007

    I think what cooler is saying is correct. Take fibromyalgia for instance, there are numerous symptoms for this problem and every patient does not have all of them. The patients generally has two of the most common, which is pain at the pressure points and sleep issues. This problem was at the heart of my sicknesses. This is a tough problem to diagnosis because, like AIDS, the symptoms are unrelated, therefore most doctors miss it, don’t diagnose it nor do they know how to treat it. Nevertheless, in the end it boils down to treating each symptom as it arises, which should be how AIDS is treated as opposed to blanket antiretrovirals, which cannot address all the diseases lumped under the AIDS umbrella. If AIDS doctors would treat the appropriate symptom, then AIDS would go away.

  588. #592 cooler
    October 2, 2007

    quite the opposite, just like the virus that caused the headache in 5 of 10 people with the same symptoms, while in the other 5 it was stress, you take those 5 people with virus induced headache and classify them in a new disease category, which is the same thing that should be done for those people with complex multi organic infectious like symptoms that are positive for Lo’s pathenogenic mycoplasmas.

    Those who test postitive for mycoplasma penetrans/incognitus should be given a put in a new disease category, they should be labeled as being mycoplasma penetrans positive, much like hiv positive people, they get diagnosed on basis of causation, not similar sharing symptoms, for if we used that method hiv could not be the cause of AIDS bc the symptoms vary greatly from one person to another, some get dementia, some dont etc etc.

  589. #593 Braganza
    October 2, 2007

    Is there any explanation of why the number of CD8 cells is decreasing during an AIDS infection ?

    Montagnier in his book does not provide one, but points that this is a mark of the disease progression.

  590. #594 AK
    October 2, 2007

    Michael:

    The point of my post had nothing to do with whether HIV-1 had produced AIDS in this patient. (I’m assuming it had.) The key item was this:

    Phylogenetic analysis of viral sequences obtained during the follow-up has permitted the identification of superinfection with 2 strains and the appearance of a recombinant virus in the viral population.

    This means that the genetic diversity of HIV-1 (and presumably any other sort of HIV) will increase through both point mutation and recombination.

  591. #595 Jim
    October 2, 2007

    Braganza,
    Go to a few of the links I posted above on T cell exhaustion and follow the links on the side of the screen to similar papers. I think you may begin to find your answer there.

  592. #596 Adele
    October 2, 2007

    Cooler says I lie about Lo and the mycoplasma. The guy who says they didn’t find data recorders in Pennsylvania!

    Lo said he found a new AIDS virus in 1986. He didn’t give more details for three years! He didn’t give other scientists his materials so they could verify it. He still said it was a virus in 1989. He was wrong for at least three years. He had EMs and he called it a virus. Cooler calls him a genius.

    HEres an article from 1989 when Lo still said it was a virus. New york Times Lawrence K. Altman, “The Doctor’s World; AIDS Finding piques curiosity, but scientists are wary” April 11, 1989

    Dr. Lo has apparently not provided crucial biological reagents to other researchers. Such reagents include molecular probes that can detect genetic material in viruses. In addition, Dr. Lo has been remarkably reticent, declining to discuss his studies recently with reporters or to participate in the usual give and take with scientists.

    Even though he acted like that to people other people were still interested in his stuff.

    More than a dozen AIDS researchers said Dr. Lo’s work was provocative. In general, they agree with Dr. David Baltimore, the Nobel Prize-winning virologist, who said the findings were “interesting and ought to be followed up.”

    But so scientists who looked at the EMs thought it didn’t look like a virus but they couldn’t check it because Lo wouldn’t give it out like scientists are supposed to do.

    Scientists have cited several limitations in Dr. Lo’s paper, including the poor quality of the photographs of the virus taken through an electron microscope. Some critics contend that the photos do not show a virus.

    Everyone wanted more info. Like Dr. Fauci.

    Dr. Anthony S. Fauci, an AIDS expert who directs the National Institute of Allergy and Infectious Disease, said that Dr. Lo had given a seminar at the National Institutes of Health about his research. But Dr. Fauci said he had to ask Dr. Lo about six times before he agreed to do it, and he came only under the stipulation that no one from Dr. Gallo’s laboratory could be there. “That is ridiculous for a scholarly person,” Dr. Fauci said, “and he turned off a lot of people.”

    Six times. He refused. Then he complains no ones interested in his research. But they were, even after that Gallo still said good things about the research.

    Cooler says Fauci does “GENOCIDE” all caps. What asking a dude to present his stuff six times is genocide? I think you do all caps at Lo not Fauci.

    article from later,
    Lawrence K. Altman, “The Doctor’s World; Unusual Microbe, once dismissed, is now taken more seriously” January 16 1990 New York Times

    A guy whose suppressing stuff to do GENOCIDE doesn’t say stuff like this,

    “We have an open mind and we are trying to see if we can settle this one way or the other over the next several months,” said Dr. Anthony S. Fauci, who heads the National Institutes of Allergy and Infectious Diseases. “If it is an important pathogen, then let’s see what we can do about it. And if not, let’s move on.”

    And what happened at that meeting in 1990

    “The pathology data was solid and convinced us that the agent is in the tissues,” Dr. Baseman said. The ability of M. incognitus to cause a fatal wasting disease in monkeys and mice persuaded most participants that the microbe “has the potential to cause disease in humans,” Dr. Baseman said, although solid proof is lacking.

    Solid proof lacking.

    Twenty years now and still not much good evidence the Nicolson studies and Los studies are with small numbers. Some people don’t find the mycoplasmas in CFS like the Vernon et al study. A Japanese lab and a English lab did experiments and they didn’t think the Lo mycoplasma was unique. STill today a lot of people think it was contaminants. Montagnier was really interested in this thing but his lab found mycoplasmas by PCR in healthy people and sick people at low rate, Kovacic et al JCM 1996, and weren’t statisticly different. Montagnier found some reasons to think penetrans is a OI in AIDS patients and it could make progression faster.

    Cooler looks at this stuff and he speculates and he says it causes all these different diseases when even Lo doesn’t say that. Cooler thinks like this. If Nicolson or Lo finds mycoplasma in tissue with antibodies then the antibodies are fine. But if Lo doesn’t find it with antibodies then well the government was forcing him to lie or the antibodies don’t work. If Nicolson finds it in blood with PCR then PCR is great. But when Lo doesn’t find it in blood then it’s the government again or the top Armed Pathology generalissimo has a lab where they don’t store blood right. If other labs like Vernon et al don’t find it in blood with PCR then they should of looked in cells or in tissues with the antibodies that don’t work or do work depending whose using them. But when Montagnier, Kovacic et al JCM 1996 looks in cells its there in like ten percent of healthy people and less of people with HIV.

    Maybe Mycoplasma does something in “CFS” or “GWS” and maybe its another OI in AIDS but if you read all this papers your thinking well what the hell. This is lots of contradiction and not very much proof. Defanitely much much weaker then the papers for HIV and AIDS. It kinda helps to be a conspiracy theorist I guess.

  593. #597 Braganza