environmental education
sporte | January 13, 2010A common theme I hear in talks on personalized medicine, is that increased access to genomic data and medical literature are changing the relationship between doctors and patients. Patients are through being passive recipients of paternalistic health care. They are demanding to participate and be treated as partners with health care providers.
Citizen science can serve a similar role.
Just as personalized medicine is starting to make it possible for individuals to monitor and participate in their own personal health, citizen science is making it possible for people to participate and…
sporte | January 11, 2010Do citizen science efforts ever go beyond "feel good" contributions? Do the data get published in peer-reviewed journals?
In an earlier post, I started a list of citizen science projects that allow students to make a contribution. Many commentors are graciously adding to that list and I thank you all! I'm glad to learn there are so many interesting projects and ways for people to get involved. Science is so empowering!
My question today concerns things like outcomes and deliverables. We'd like to assume that good things are coming from citizen science because people are involved, but I…
sporte | January 8, 2010Next Saturday afternoon, at ScienceOnline2010, the science goddess, the chemspider, and I will be presenting a workshop on getting students involved in citizen science.
In preparation, I'm compiling a set of links to projects that involve students in citizen science. If you know of any good citizen science efforts, please share them in the comments.
Here we go!
Before I start listing links, I am limiting this list to projects that allow both students and citizen scientists to participate. I know of plenty of student projects, where students can isolate phage and annotate their genomes or…
sporte | January 4, 2010If you're in Seattle, Dr. Bruce Alberts will be talking tomorrow night (Jan 5th) at the Seattle Aquarium on science education and the role that scientists play.
There are also some really interesting talks at a day-long workshop, Wednesday (Jan 6th) at the UW South Campus Center.
The details and registration info are below:
~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
Tuesday:
COSEE Ocean Learning Communities & Washington SeaGrant Present
Redefining Science Education and the
Roles that Scientists Play in Society
Dr. Bruce Alberts
Tuesday,…
sporte | September 23, 2009We always see interesting creatures whenever we walk on the beach. Now, a new program from the University of Washington and the state department of Fish and Wildlife is seeking to enlist beach walkers in a community science project where they can help monitor biodiversity.
The program is called NatureMapping and it's mission is to enlist the community and schools in monitoring the health of our beaches and contributing data to a state-managed biodiversity database. If you can get to a beach, you can help survey invertebrate species and intertidal marine fish.
Two free facilitator…
sporte | March 15, 2009"Digital biology," as I use the phrase, refers to the idea of using digital information for doing biology. This digital information comes from multiple sources such as DNA sequences, protein sequences, DNA hybridization, molecular structures, analytical chemistry, biomarkers, images, GIS, and more. We obtain this information either from experiments or from a wide variety of databases and we work with this information using several kinds of bioinformatics tools.
The reason I'm calling this field "digital biology" and not "bioinformatics" (even though I typically use the terms as…
sporte | January 7, 2009I don't know if any DIY biologists are looking for projects, but I think engineering yeast with a gene to detect heavy metals might be a good DIY biology project and I have some ideas for how to do this.
What are the advantages of using yeast and working on this kind of problem?
This could have a socially beneficial result. Contamination of soils, water, and even toys with heavy metals like lead, arsenic, and others, is a growing problem. If DIY biologists could make a cheap test, it could be helpful for a large number of people.
Yeast, at least the ones I'm thinking about, Saccharomyces…
sporte | November 9, 2008It was a wet and rainy day yesterday, and we have a dissecting microscope, so I decided to see if I could find some tardigrades.
Tardigrade photo by nebarnix
Reposted from Nov. 2006
I went outside and scraped a bit of moss and some lichens off of our deck. Then I put the lichens and moss in a dish. We don't have distilled water in our house, so I added a bit of cool some tap water to the dish. I squeezed the moss and lichens in the water. Then I took a pipette and transferred a bit of the stuff in the water to a plastic petri dish and looked for tardigrades.
Sure enough, I saw one…
sporte | August 25, 2008A few days ago, I wrote about a cool project that some high school students did where they used DNA sequencing to identify seafood.
One question that came up from one of my commenters was how a school would start a project like this. I'm totally biased, but I think DNA sequencing (well, actually the data analysis) is one of the most interesting things that a class can do as part of a research project. These days, getting started with this kind of project, wouldn't be so hard.
Here's are some ways that I would get started:
Find an existing project where my students could collaborate and…
sporte | August 22, 2008Two teenagers, Kate Stoeckle and Louisa Strauss, carried out their own science project over the past year. They visited 4 restaurants and 10 grocery stores and gathered 60 samples of fish and sent them off to the University of Guelph to get sequenced.
I like this story. One of my former students did a project like this for the FDA years ago, sampling fish from the Pike Place Market and identifying them with PCR. He was an intern, though. Here we have students identifying sushi on their own!
Quoting the New York Times article:
They found that one-fourth of the fish samples with…
sporte | August 6, 2008This the third part of case study where we see what happens when high school students clone and sequence genomic plant DNA. In this last part, we use the results from an automated comparison program to determine if the students cloned any genes at all and, if so, which genes were cloned. (You can also read part I and part II.)
Did they clone or not clone? That is the question.
But first, we have to answer a different question about which parts of their reads are usable and which parts are not. (A read is the sequence of bases obtained from a chromatogram file.)
How does our data get…
sporte | May 1, 2008Yesterday morning I was sitting at conference table, downing coffee to keep my eyes open, when I heard someone say that it's springtime now and the snakes are waking up. Well, those kinds of statements at the breakfast table do have a way of getting my attention.
I turned sideways and realized the words were coming from a high school science teacher, that I know, from Arizona.
"Snakes hibernate?"
"Sure," she said, "and people who move here in the winter time are pretty surprised when a snake wakes up and crawls out from under their porch."
A few other questions and everyone at the table…
sporte | April 17, 2008In the class that I'm teaching, we found that several PCR products, amplified from the 16S ribosomal RNA genes from bacterial isolates, contain a mixed base in one or more positions.
We picked samples where the mixed bases were located in high quality regions of the sequence (Q >40), and determined that the mixed bases mostly likely come from different ribosomal RNA genes. Many species of bacteria have multiple copies of 16S ribosomal RNA genes and the copies can differ from each other within a single genome and between genomes.
Now, in one of our last projects we are determining where…
sporte | March 16, 2008Conflicts between predators like cougars and coyotes and human companions like pets and small children are becoming more common as people move into areas that used to be wildlife habitat.
The Seattle Times has a great story this morning about biologists in Washington who are studying cougars to learn if cougars and people can coexist. The biologists think most of the trouble might be caused by teenage male cougars who move in to the territory when the older, smarter males get killed.
There's also a cool video
sporte | March 13, 2008I think all of us; me, the students the OO advocates, a thoughtful group of commenters, some instructors; I think many of us learned some things that we didn't anticipate the other day and got some interesting glimpses into the ways that other people view and interact with their computers.
Some of the people who participated in the challenge found out that it was harder than they expected.
Lessons learned
Okay, what did we learn?
1. The community is the best thing about Open Source
The Open Office advocates enjoy a challenge and are truly, quite helpful. That was something that adventure…
sporte | March 11, 2008Your canopy is disappearing, you're likely to freeze.
NASA's Earth Observatory reports that over 1,110 acres of forest were illegally logged, during the past four years, in the Monarch Butterfly Biosphere Reserve in central Mexico.
Monarch butterflies travel here from all over the United States and Canada. Images from the Ikonos satellite tell us though, that future migrating butterflies are likely have problems in this reserve. The top image is from 2004, the bottom image shows what things are like now.
NASA's Earth Observatory
Without the trees to protect them, the butterflies could…
sporte | March 10, 2008The NASA Earth Observing System is an incredible resource for both science and education. One of the amazing things about it is all the different kinds and quantities of data are assembled together into pictures that even grade school kids can immediately comprehend.
How do they do it?
Each of the EOS satellites delivers a terabyte or more of data per day from many different instruments.
How do they take satellite imagery, rainfall statistics, temperature information, and other kinds of data and assemble these data into meaningful pictures?
The answer is HDF (hierarchical data format…
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
sporte | February 26, 2008This is third video in our series on analyzing the DNA sequences that came from bacteria on the JHU campus.
In this video, we use a pivot table to count all the different types of bacteria that students found in 2004 and we make a pie graph to visualize the different numbers of each genus.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria
IV. Counting the bacteria by biome
Part III. Pivot tables from Sandra Porter on…
sporte | February 26, 2008What do you do after you've used DNA sequencing to identify the bacteria, viruses, or other organisms in the environment?
What's the next step?
This four part video series covers those next steps. In this part, we learn that a surprisingly large portion of bioinformatics, or any type of informatics is concerned with fixing data entry errors and spelling mistakes.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria…