genomics
mikethemadbiologist | March 20, 2008OK, last post about this bozo, and then I'm done (famous last words...). In the previous post, I dealt with Egnor's claim that the evolution of antibiotic resistance by selection of resistant genotypes is obvious, and not germane (namely, that it wasn't obvious at one point in time). What bothered me with not just Egnor's claim (which I'll get to a minute) and ScienceBlogling Mike's response is that evolutionary biology does have a significant role to play in combating the evolution and spread of antibiotic resistance.
First, what Egnor said:
The important medical research on antibiotic…
sporte | March 17, 2008One of my colleagues has a two part series on FinchTalk (starting today) that discusses uncertainty in measurement and what that uncertainty means for the present and Next Generation DNA sequencing technologies.
I've been running into this uncertainty myself lately.
I have always known that DNA sequencing errors occur. This is why people build tools for measuring the error rate and why quality measurements are so useful for determining which data to use and which data to believe. But, some of the downstream consequences didn't really hit home for me until a recent project. This project…
mikethemadbiologist | March 17, 2008Sean Carroll at Cosmic Variance, in an excellent post, argues that much of the opposition to evolution stems from opposition to (mis)perceived liberal elites (bold original; italics mine):
What scientists tend to underestimate is the extent to which many people react viscerally against science just because it is science. Or, more generally, because it is seen as part of an effort on the part of elites to force their worldview on folks who are getting along just fine without all these fancy ideas, thank you very much.
In the old-time (1980's) controversies about teaching creationism in…
sporte | March 13, 2008I think all of us; me, the students the OO advocates, a thoughtful group of commenters, some instructors; I think many of us learned some things that we didn't anticipate the other day and got some interesting glimpses into the ways that other people view and interact with their computers.
Some of the people who participated in the challenge found out that it was harder than they expected.
Lessons learned
Okay, what did we learn?
1. The community is the best thing about Open Source
The Open Office advocates enjoy a challenge and are truly, quite helpful. That was something that adventure…
sporte | March 12, 2008Okay OpenOffice fans, show me what you can do.
Earlier this week, I wrote about my challenges with a bug in Microsoft Excel that only appears on Windows computers. Since I use a Mac, I didn't know about the bug when I wrote the assignment and I only found out about it after all but one of my students turned in assignment results with nonsensical pie graphs.
So, I asked what other instructors do with software that behaves differently on different computing platforms. I never did hear from any other instructors, but I did hear from lots of Linux fans. And, lots of other people kindly…
evolgen | March 11, 2008The Next Generation Sequencing blog has a post on low coverage of A/T regions with Solexa sequencing. The post is in reference to a paper in Nature Methods on genome resequencing in C. elegans (doi:10.1038/nmeth.1179). Here's how the NextGen Sequencing blog summarizes it:
However, it points to a general lack of coverage in A/T rich regions (see figure 2 of the supplementary material) which leaves a number of zero size gaps in the assembly - places where reads sit shoulder to shoulder but simply do not overlap. Having found these problematic A/T rich regions, the authors went back and took a…
sporte | March 11, 2008I read about this in Bio-IT World and had to go check it out. It's called the Genome Projector and it has to be the coolest genome browser I've ever seen.
They have 320 bacterial genomes to play with. Naturally, I chose our friend E. coli. The little red pins in the picture below mark the positions of ribosomal RNA genes (It's not perfect, at least one of these genes is a ribosomal RNA methyltransferase and not a 16S ribosomal RNA.)
I'm not entirely happy about finding it now, after I've already written and posted all the assignments for my class, but still, I'll post a link for my…
mikethemadbiologist | March 11, 2008Over at evolgen, ScienceBlogling RPM discusses a paper that describes a new barcoding technique for plants. It struck me while reading his post that barcoding has two very different meanings, even though both techniques are used in genomics--and often, at the same time.
One meaning of barcoding, and the one discussed by RPM, is the use of a gene to assign different groups of organisms a taxonomic DNA label (or barcode...). In other words, we're replacing Latin bionomials, like Escherichia coli or Homo sapiens, with a DNA sequence from a single gene (or a set of closely related sequences).…
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
evolgen | March 7, 2008Identifying and cataloging biological diversity is challenging. One way to do go about IDing all the life forms is to sequence a known region of the genome in all those species. This is known as DNA barcoding. An article in PNAS reports on the DNA sequence of a gene found useful for DNA barcoding in plants. In a review of the paper, the following table is presented:
DNA Barcoding
Genomics
Number of species
All (or most)
One (or few)
Number of gene regions
One (or few)
All (or most)
The gist: DNA barcoding results in the sequencing of a single gene in a bunch of species, while genome…
evolgen | March 6, 2008Olivia Judson (aka, Dr. Tatiana) has a blog at the NYTimes website. It's usually a good read, but she has been known to go off the deep end. In this week's entry, Judson posts on how bones are not the only fossils. What other fossils does Judson write about? Genomes.
Judson's focus is on genome size. She's clear that differences in genome size are the result of stuff other than genes, but she doesn't want to call that extra stuff "junk". Here's why:
I don't like "junk," which suggests the DNA is useless: even if it doesn't hold the instructions for making proteins, it may still serve a…
evolgen | March 5, 2008Brian Charlesworth has reviewed Michael Lynch's The Origins of Genome Architecture for Current Biology. Charlesworth's review is generally positive, and he agrees that population size may be an important factor in genome evolution. However, he thinks that Lynch overplays the role relaxed selective constraint in small populations plays in the evolution of genomic complexity.
Charlesworth argues that sexual reproduction may be partly to blame for some of the features found in the bloated genomes of many eukaryotes. For example, the abundance of transposable elements may be the result of sexual…
evolgen | February 12, 2008Jonathan Eisen's been blogging the Advances in Genome Biology and Technology (AGBT) meeting in Marco Island. Here's what he's written so far:
Advances in Genome Biology and Technology Meeting - First Post
AGBT Marco Usland Update - Long Live Sequencing
Marco Island Evening One - The Strange and the Good
More notes from Marco Island/ AGBT
Coolest Thing at Marco Island - The Polonator
Marco Island sequencing frenzy - are we getting lost in all the data?
Marco Island - Saving Some of the Best for Last
The second to last post is the best, in my opinion. But there's some interesting points about…
mikethemadbiologist | January 28, 2008When I read Olivia Judson's post about hopeful monsters, I didn't think she used the term correctly (here are some good explanations why), but I was surprised by Jerry Coyne's response.
First, the personal attack on Judson is unwarranted: when we reach the point where the serious challenge to evolutionary biology is the misuse of a discredited decades-old idea, as opposed to the politically powerful anti-science creationist movement, we're in a pretty good place. She made a mistake--I don't think her motives were self-aggrandizing. Second, if you're going to launch an ad homeniem attack,…
mikethemadbiologist | January 16, 2008By way of ScienceBlogling Razib, I came across this Reason article by Ronald Bailey summarizing the presidential candidates views' on evolution. Bailey highlights two reasons what lack of support for evolution says about a candidate:
The candidate probably is weak on the separation of church and state.
The candidate is unable to rationally assess evidence.
But I think this misses the point entirely: evolution matters because evolutionary biology matters.
Granted this sounds like something Yogi Berra would say, but I'm tired of the Coalition of the Sane, regardless of where individual…
evolgen | January 16, 2008Alex is pissed about science writers neglecting important discoveries in cell biology:
Why are cell biology, molecular biology, biochemistry, microbiology never covered in the media? I've spoken to so many science journalists - most of whom have no science training. I've come to the conclusion that the barrier is too high - as a result when it comes time to write about these topics, most science journalists end up writing about "genomes" and "junk DNA". These are easy subjects - sometimes they're discussed within the framework of evolution, but never within the context of "how a cell or an…
evolgen | January 15, 2008What's a gene chip? Well, it's not a gene chip, that's for sure. It's a microarray. It has various parts of a genome arrayed on a small chip. The parts of the genome you put on the chip depends on what you're interested in studying. You then take some DNA you're interested in and apply it to the chip. If a DNA sequence matches a sequence on the chip, it hybridizes to the part of the chip with the matching DNA sequencing. You then use a special technology to visualize which parts of the chip have DNA hybridized to them.
This technology can be used to differentiate between different single…
sporte | January 9, 2008The New England Journal of Medicine published a study yesterday showing that small changes in the DNA in the long arm of chromosome 16 are associated with autism.
I met a teenager with autism last summer, when I attended family night at the Seattle Park and Rec summer camp program for kids with special needs. It's a fantastic program. The kids spend a week or more at summer camp and the parents get some much needed time off.
I sat down on a log and my daughter (one of the counselors) introduced to me a boy in her cabin and told me that he's interested in trains. Since I rode a train for…
evolgen | January 7, 2008Matt Nisbet thinks that Francis Collins should be the next presidential science advisor. He does this after rejecting excellent popularizes of science, such as Neil deGrasse Tyson and E.O. Wilson, on the following grounds:
Most science popularizers such as Wilson or Tyson don't have the years of government experience to understand the machinations of Federal science policy. Moreover, they have a paper trail of strong opinions on issues that might make appointment politically tough.
I'm not sure what exactly those issues upon which they have strong opinions are. Is it that they're both…
sporte | December 19, 2007In which we're reminded that database searches are experiments, too.
One of the trickiest things with bioinformatics experiments is repeating them. This challenge isn't related to the validity of the original results, the challenge is that, unless you made your own database and kept it in the same state, the database that you'll be using at a later time, sometimes even a day later, is a different database. And, if you query a different database, you may get a different result.
The series that I'm currently posting is one that I started working on a couple of years ago. Originally, I was…