May 10, 2010
What is this odd little beast?
Five points each for the first person to pick the order and the family.
The cumulative points winner for the month of May will win either 1) any 8x10 print from my insect photo galleries, or 2) a guest blog post on the (safe-for-work) topic of their choosing.
May 10, 2010
...because badass mandibles are in style this season:
Odontomachus turneri, Australia
photo details:
Canon EOS 50D camera
Canon MP-E 65mm 1-5x macro lens
ISO 100, f/13, 1/250sec
May 9, 2010
The very funny Rowan Atkinson:
May 9, 2010
Pea Aphids, Acyrthosiphon pisum
May 9, 2010
Dandelion through the eyes of a macro-adapted iPhone 3G
Nothing warms the heart of a blogger more than birthing a meme. A couple weeks ago I posted a short article on how a hand lens can enable a cell phone to do macrophotography. Other bloggers have taken to the idea and have been posting their…
May 8, 2010
A: If, at birthday parties, the featured game is "pin-the-stinger-on-the-bee."
your intrepid blogger, circa 1985
You may thank my mother for sending along this, um, interesting photo.
May 7, 2010
Anthrenus sp. carpet beetle
Urbana, Illinois
Little Anthrenus beetles are one of the most common insects across the northern hemisphere. Adults can be found in flowers feasting on pollen, and the detritivorous larvae are often inhabitants of homes and buildings. If you'd like to see one of…
May 6, 2010
New this week at alexanderwild.com we have photographs of the Savanna Strobe Ant Opisthopsis haddoni. These delightfully perky insects inhabit open environments in northern Australia and are one of my favorite ants.
Opisthopsis has excellent vision. The location of the compound eyes atop the head…
May 5, 2010
From the "I-never-thought-I'd-use-this-class" file, I took a semester course once from an oil spill expert. Professor Ed Gilfillan had studied the response of Prince William Sound to various clean-up regimens following the wreck of the Exxon Valdez, and we spent weeks learning about chemistry of…
May 4, 2010
They looked like little flowers, or miniature suction cups, but yesterday's mystery was neither. Here's a more recent view:
Arilus cristatus, a newly hatched wheel bug nymph with eggs
Ted MacRae of Beetles in the Bush picks up 6 points for guessing that they were Reduviid eggs, and MarekB gets 4…
May 4, 2010
An amazing photo posted this week at Antweb shows a developing male Cerapachys ant inside the silken cocoon:
(Image by Erin Prado)
May 3, 2010
What's this?
2 points for naming the structure, 4 for family, and 4 for genus/species.
The cumulative points winner for the month of May will win either 1) any 8x10 print from my insect photo galleries, or 2) a guest blog post on the (safe-for-work) topic of their choosing.
May 2, 2010
How did they catch this footage of an ANTi-pesticide protest? Here's a peek behind the scenes.
May 2, 2010
Take a photograph, of course:
Tapinoma sessile, the odorous house ant
photo details:
Canon EOS 50D camera
Canon MP-E 65mm 1-5x macro lens
ISO 100, f/13, 1/250sec
April 30, 2010
A pleasingly pink pea aphid (Acrythosiphon pisum)
A long time ago, on a host plant far, far away, an aphid became infected with a fungus. And then it did something unusual: it incorporated some fungal genes into its own genome.
New research by Nancy Moran and Tyler Jarvik, published yesterday in…
April 30, 2010
Podabrus sp. Soldier Beetle
Urbana, Illinois
Last week we featured a larval soldier beetle. Today we have an adult of the same family (Cantharidae), in the genus Podabrus.
photo details:
Canon EOS 50D camera
Canon MP-E 65mm 1-5x macro lens
ISO 100, f/13, 1/250sec
April 29, 2010
Blog posts are long, thin things.
One could, for example, use a blog to post a high-resolution map of Chile. Or a single strand of spagetti. Any image up to 500 pixels wide, for as long as it goes. In that vein, here's a Cephalotes varians turtle ant:
Just wait until I find a stick insect.
April 28, 2010
Yesterday, Antweb posted its first images of Anomalomyrma workers, and I've been staring at them ever since.
This is a strange ant indeed, a member of the ancient subfamily Leptanillinae that is potentially a sister lineage to the remaining extant ants. It's ostensibly a subterranean predator in…
April 27, 2010
What was that dazzling sequence of nucleotide bases? Here's a more holistic view:
Aedes albopictus, the Asian Tiger Mosquito
The gene was ribonucleotide reductase, which is essential for DNA synthesis. If you followed the BLAST results back through to the paper where this sequence was published,…
April 27, 2010
The U.K.-based film company Ammonite has been blogging their ant-filming experiences in Costa Rica and Spain. The glamor of making nature documentaries apparently includes skin parasites and volcano-related travel limbo.
The journal Myrmecological News has a trio of new articles, including…
April 27, 2010
I apologize for the slow blogging this weekend. We took a little road trip up to beautiful Madison, Wisconsin and were too busy with bratwurst, cheese, beer, and roller derby to bother with the internet.
Atta cephalotes in the fungus garden
The University of Wisconsin is home to Cameron Currie,…
April 26, 2010
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene…
April 26, 2010
You're in luck! Antweb has added an excellent blog to handle submitted questions. The answer squad is headed by myrmecologists at the Chicago Field Museum, and so far they've fielded queries about what ants do in winter, whether fire ants will reach the northern U.S., the difference between…
April 25, 2010
From "Life in the Undergrowth", perhaps the finest insect documentary ever made, a scene featuring Australia's intertidal ants:
A few years back I traveled through northern Queensland with myrmecologists Phil Ward and Gary Alpert. Having heard about the aquatic abilities of these ants, we searched…
April 23, 2010
This velvety worm-like creature may not look like a beetle, but it is. Beetles are like butterflies, passing through a complex metamorphosis on the way to adulthood, and this insect is the larval stage of a soldier beetle.
photo details:
Canon EOS 50D camera
Canon MP-E 65mm 1-5x macro lens
ISO 100…
April 21, 2010
Earlier, while noting greater rates of pseudonymous blogging by women, Morgan Jackson raised the topic of why the majority of tenure-track science positions go to men. It's a striking pattern, especially considering that at the graduate student level women predominate in many fields- including…
April 21, 2010
...just for you.
Cimex lectularius, the common Bed Bug
More photos from this series are posted here.
photo details:
Canon EOS 50D camera
Canon MP-E 65mm 1-5x macro lens
ISO 100, f/13, 1/250sec
April 21, 2010
What happens if you score bug blogs for various characters and crunch them through a phylogenetic analysis?
Morgan Jackson investigates:
Although Morgan's exercise was tongue-in-cheek, he did uncover a pattern worthy of further exploration:
The last thing I want to comment on is the huge skew…
April 20, 2010
What was that odd squishy-hairy thing in yesterday's SEM?
It's the tip of the foot of a muscid fly, showing the adhesive pads (called pulvilli) that allow the fly to cling to surfaces. Here's a slightly less magnified view:
Points are awarded as follows:
-Two for JasonC., for being the first to…
April 20, 2010
Forget the heavy pro-grade camera gear for a moment. This shot was taken with a $300 Panasonic Lumix DMC-ZS3 digicam. These small cameras do wide-angle macro exceptionally well, and their tiny sensors and lenses give them a small-world perspective that SLR cameras struggle to replicate. Here, I…