sporte | March 16, 2008Things move off of our entry page pretty quick sometimes. If you missed this post from Bioephemera, go take a look.
She has great pictures and a fascinating story about one Seattle's favorite places.
sporte | March 16, 2008Conflicts between predators like cougars and coyotes and human companions like pets and small children are becoming more common as people move into areas that used to be wildlife habitat.
The Seattle Times has a great story this morning about biologists in Washington who are studying cougars to learn if cougars and people can coexist. The biologists think most of the trouble might be caused by teenage male cougars who move in to the territory when the older, smarter males get killed.
There's also a cool video
sporte | March 14, 2008It's a good thing my 13 yr old doesn't read my blog.
Why? Because I'm on to her. Being a biologist, well, acronyms are my life. And, for a long time, I've been able to interpret some of the lingo that she uses on AIM. Lately, we've certainly been having our little talks about cell phone bills for texting and the things she can around the house to earn the right to keep her phone.
But now I'm empowered. I have a dictionary.
Watch out kiddo!
sporte | March 14, 2008I've been writing quite a bit this week about my search for a cross platform spread sheet program that would support pivot tables and make pie graphs correctly.
This all started because of a bug that my students encountered in Microsoft Excel, on Windows. I'm not personally motivated to look for something new, since Office 2004 on Mac OS 10.5 doesn't seem to have the same bugs that appear on Windows. However, I would like things to work for my students. Since I don't want to have to write instructions for every software system on the planet, Google Docs would be my ideal answer, if it…
sporte | March 13, 2008I think all of us; me, the students the OO advocates, a thoughtful group of commenters, some instructors; I think many of us learned some things that we didn't anticipate the other day and got some interesting glimpses into the ways that other people view and interact with their computers.
Some of the people who participated in the challenge found out that it was harder than they expected.
Lessons learned
Okay, what did we learn?
1. The community is the best thing about Open Source
The Open Office advocates enjoy a challenge and are truly, quite helpful. That was something that adventure…
sporte | March 13, 2008It's a Solexa data directory.
I've held off on blogging about Next Generation Sequencing here, but now that one of my colleagues has started blogging about it, it seems like a good time to write a little about FinchTalk, our company blog.
We've decided that we can serve an educational role for people who are interested in Next Generation DNA Sequencing.
Certainly, FinchTalk is our company blog and it is a place where you can expect to read about our products. But, we've noticed that quite often, the sexy technologies and fancy graphs get the press and the practical aspects - how do…
sporte | March 12, 2008Okay OpenOffice fans, show me what you can do.
Earlier this week, I wrote about my challenges with a bug in Microsoft Excel that only appears on Windows computers. Since I use a Mac, I didn't know about the bug when I wrote the assignment and I only found out about it after all but one of my students turned in assignment results with nonsensical pie graphs.
So, I asked what other instructors do with software that behaves differently on different computing platforms. I never did hear from any other instructors, but I did hear from lots of Linux fans. And, lots of other people kindly…
sporte | March 11, 2008I read about this in Bio-IT World and had to go check it out. It's called the Genome Projector and it has to be the coolest genome browser I've ever seen.
They have 320 bacterial genomes to play with. Naturally, I chose our friend E. coli. The little red pins in the picture below mark the positions of ribosomal RNA genes (It's not perfect, at least one of these genes is a ribosomal RNA methyltransferase and not a 16S ribosomal RNA.)
I'm not entirely happy about finding it now, after I've already written and posted all the assignments for my class, but still, I'll post a link for my…
sporte | March 11, 2008Your canopy is disappearing, you're likely to freeze.
NASA's Earth Observatory reports that over 1,110 acres of forest were illegally logged, during the past four years, in the Monarch Butterfly Biosphere Reserve in central Mexico.
Monarch butterflies travel here from all over the United States and Canada. Images from the Ikonos satellite tell us though, that future migrating butterflies are likely have problems in this reserve. The top image is from 2004, the bottom image shows what things are like now.
NASA's Earth Observatory
Without the trees to protect them, the butterflies could…
sporte | March 11, 2008The other day, I wrote that I wanted to make things easier for my students by using the kinds of software that they were likely to have on their computers and the kinds that they are likely to see in the business and biotech world when they graduate from college.
More than one person told me that I should have my students install an entirely different operating system and download OpenOffice to do something that looks a whole lot harder in Open Office than it is in Microsoft Excel.
I guess they missed the part where I said that I wanted to make the students work a little easier.
Before I go…
sporte | March 10, 2008The NASA Earth Observing System is an incredible resource for both science and education. One of the amazing things about it is all the different kinds and quantities of data are assembled together into pictures that even grade school kids can immediately comprehend.
How do they do it?
Each of the EOS satellites delivers a terabyte or more of data per day from many different instruments.
How do they take satellite imagery, rainfall statistics, temperature information, and other kinds of data and assemble these data into meaningful pictures?
The answer is HDF (hierarchical data format…
sporte | March 10, 2008Three (or more) operating systems times three (or more) versions of software with bugs unique to one or systems (that I don't have) means too many systems for me to manage teaching.
Thank the FSM they're not using Linux, too. (Let me see that would be Ubuntu Linux, RedHat Linux, Debian Linux, Yellow Dog Linux, Vine, Turbo, Slackware, etc.. It quickly gets to be too exponential.) Nope, sorry, three versions of Microsoft Office on three different operating systems are bad enough.
This semester, I'm teaching an on-line for the first time ever. The subject isn't new to me. I've taught…
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
sporte | February 26, 2008Do different kinds of biomes (forest vs. creek) support different kinds of bacteria?
Or do we find the same amounts of each genus wherever we look?
Those are the questions that we'll answer in this last video. We're going to use pivot tables and count all the genera that live in each biome. Then, we'll make pie graphs so that we can have a visual picture of which bacteria live in each environment.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data…
sporte | February 26, 2008This is third video in our series on analyzing the DNA sequences that came from bacteria on the JHU campus.
In this video, we use a pivot table to count all the different types of bacteria that students found in 2004 and we make a pie graph to visualize the different numbers of each genus.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria
IV. Counting the bacteria by biome
Part III. Pivot tables from Sandra Porter on…
sporte | February 26, 2008What do you do after you've used DNA sequencing to identify the bacteria, viruses, or other organisms in the environment?
What's the next step?
This four part video series covers those next steps. In this part, we learn that a surprisingly large portion of bioinformatics, or any type of informatics is concerned with fixing data entry errors and spelling mistakes.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria…
sporte | February 26, 2008For the past few years, I've been collaborating with a friend, Dr. Rebecca Pearlman, who teaches introductory biology at the Johns Hopkins University. Her students isolate bacteria from different environments on campus, use PCR to amplify the 16S ribosomal RNA genes, send the samples to the JHU core lab for sequencing, and use blastn to identify what they found.
Every year, I collect the data from her students' experiments. Then, in the bioinformatics classes I teach, we work with the chromatograms and other data to see what we can find.
This is the first part of a four part video series…
sporte | February 25, 2008Bora had an enjoyable post yesterday on obsolete lab skills. I can empathize because I have a pretty good collection of obsolete lab skills myself. These days I'm rarely (okay, never) called upon to do rocket immunoelectrophoresis, take blood from a rat's tail, culture tumor cells in the anterior eye chamber of a frog, locate obscure parasites in solutions of liquid nitrogen, or inoculate Kalanchoe leaves with pathogenic bacteria.
(Wow! It sounds like I worked for the three witches in MacBeth! Fire burn and cauldron bubble!)
I don't entirely think that my lab skills are "obsolete." I…
sporte | February 23, 2008Long ago, I worked in a large lab that was divided into several small rooms. For part of that time, I shared one of the small rooms with a graduate student from Taiwan. She was a wonderful person who taught me that many cultural norms are not normal in other cultures.
One moment stands out.
She sneezed.
"Gesundheit" I replied.
She stared at me, clearly puzzled. "What?"
"You know, it's a word we say when people sneeze. It keeps demons from running up your nose"
If she looked puzzled before, now, she was clearly alarmed. I could see her sneaking furtive glances towards the door. Was she…