Your Name in Protein

Thanks to the internet, you can find out your pirate name and your Jersey Shore name, and now thanks to the EMBL-EBI learning tools, you can find your protein name too!

i-56b4be169b9300bc69843e0238e66ba2-decode-thumb-510x92-56078.pngWhen you type your name into the box, the program reads the letters of your name as if they were the single-letter codes for amino acids. Since there are only 20 amino acids, if you have a B, J, O, U, X, or Z in your name the program reads it as "X" which just means any amino acid could go in that spot.

i-0c67972e7d973d10a9b37dfa87582d3b-aminoacidcodes.pngThe amino acids are then translated back into one of the possible three-letter DNA codes for each amino acid, and that DNA sequence is searched against the genome databases for the protein that has the closest match to your name.

i-71c25520f21df22392a8ac954c9f840a-genetic code.jpgMy name becomes TGCCACAGAATCAGCACCATCAACGCCGCCGGCGCCCCCGCCAAGATCAGC
in DNA, and the closest protein match is Phosrestin from fruit flies (apparently they allow a lot of gaps in the search), a protein involved in the fly photoreceptor.

i-d27dd965cd7ee94548bb8b97d1f1c2d2-proteinname.pngSynthetic biologists like Craig Venter sometimes like to code their own "watermark" into artificially synthesized DNA sequences as a way to sign their work, so it's fun to be able to turn it around and search for words already there (btw, Craig Venter's closest protein name match is Fructose-bisphosphate aldolase 1 from the garden pea).

What's your protein name?

via @christianbok, the DNA poet.

More like this

As we all know, the genetic code is redundant. Within protein coding regions, substitutions at silent sites do not affect the amino acid sequence of the encoded protein.
In which we search for Elvis, using blastp, and find out how old we would have to be to see Elvis in a Las Vegas club.

You shouldna done dis. You doan unnerstan: I coulda had class -- on the Jersey Shore, dey call me da T'rill. I coulda been a contender -- the pirate Machete Rupert Mango-Terwilliger. I coulda been SOME body ... instead of a heat shock protein in Salmonella paratyphi A, which is what I am.

By Plinthy the Middling (not verified) on 22 Sep 2010 #permalink

Well, I appear to work on digesting insects on behalf of a bacteria (Photorhabdus luminescens) that lives in symbiosis with a parasitic nematode worm. I'd always suspected as much.

50S ribosomal protein in Wigglesworthia glossinidia brevipalpis, a microbe that carves out a living as an endosymbiont in the gut of a tsetse fly. Damn it, now people are going to start calling me Wigglesworth.

You could take it one step further and turn your protein name into music:
http://www.doe-mbi.ucla.edu/cgi/pettit/gene2musicweb
Who knows, you might be able to fist pump to the situation's protein name. They have some example protein jams on the site as well. However, I don't recommend the Huntingtin protein; the trinucleotide repeat music even sounds like a disease.