microbiology
mikethemadbiologist | April 8, 2008I've recently written a couple of posts about how evolution is used in medicine. Randolph Nesse and Stephen Stearns in Evolutionary Applications have written an article about evolutionary medicine. Here's one part that provides some additional examples (italics mine):
Some of the most useful applications of evolution often do not use evolutionary theory directly; instead they use technologies developed by evolutionary biologists. In particular, methods for reconstructing phylogenies are being applied to genetic data with very practical results. HIV is especially susceptible to such methods…
sporte | April 3, 2008Goodbye desktop, we're off to see the web.
Both my students and I have been challenged this semester by the diversity of computer platforms, software versions, and unexpected bugs. Naturally, I turned to the world and my readers for help and suggestions. Some readers have suggested we could solve everything by using Linux. Others have convincingly demonstrated that Open Office is a reasonable alternative.
But, now there's something new and cool on the web.
Okay, it's still in the beta stages, and apparently it can only be used by a limited number of people at a time, but it's certainly…
mikethemadbiologist | April 2, 2008Over at denialism blog, PalMD has two posts which, to me anyway, are related. The first has describes how sexually transmitted diseases (STDs) are actually treated with antibiotics:
After hours, we see walk-ins, and that's where the STD fun really begins. For whatever reason, I see STDs daily at the walk-in clinic, but almost never in my private practice. Most commonly, we see only one partner, and, at least in my state, treatment of the absent partner is prohibited. Basically, we only get one shot at folks, and we don't have access to rapid tests. So what do we do? We order a lot of "…
mikethemadbiologist | April 2, 2008When I started blogging, I never (EVAH!) thought I would describe the biology of E. coli with a Tolkein poem:
All that is gold does not glitter,
Not all those who wander are lost;
The old that is strong does not wither,
Deep roots are not reached by the frost.
From the ashes a fire shall be woken,
A light from the shadows shall spring;
Renewed shall be blade that was broken,
The crownless again shall be king.
I'm referring, of course, the spinach outbreak strain of E. coli O157:H7. You know, this one:
It turns out that this particular strain of E. coli O157:…
sporte | March 27, 2008If you're old enough or you've taken microbiology, there's a chance that sometime in your life you heard of Legionaire's disease.
This disease was caused a bacteria that inhabited the air conditioners in a hotel where several veterans held a conference. Naturally, it was the microbiologists who collected samples of the bacteria and figured out what was going on.
Now, there's something else going on and I'm thankful to Mike for letting us know.
In a strange twist of fate, those archives have been destroyed. And those weren't the only valuable samples.
Why? For what reason? I usually…
mikethemadbiologist | March 27, 2008Because of bureaucratic infighting, a valuable repository of microbiological specimens spanning over twenty years of collection was destroyed. Researchers, including the Mad Biologist, want to know why (italics mine); you can sign the petition here:
Scientists Call for Inquiry into Destruction of Microbes in VA Special Pathogens Laboratory
233 scientists and physician researchers from 27 countries have collectively expressed outrage over the destruction of an irreplaceable collection of microbes numbering in the thousands. The collection included Legionella bacteria (the cause of…
sporte | March 27, 2008I made this video (below the fold) to illustrate the steps involved in making a phylogenetic tree. The basic steps are to:
Build a data set
Align the sequences
Make a tree
In the class that I'm teaching, we're making these trees in order to compare sequences from our metagenomics experiment with the multiple copies of 16S ribosomal RNA (rRNA) genes that we can find in single bacterial genomes. Bacteria contain between 2 to 13 copies of 16S rRNA genes and we're interested in knowing how much they differ from each other. Later, we'll compare the 16S ribosomal RNA genes from multiple species of…
mikethemadbiologist | March 25, 2008If you missed my talk, then you missed this slide
I leave to give a talk for a few hours, and suddenly all hell breaks lose on ScienceBlogs over the whole PZ Myers getting expelled from the movie Expelled incident, you damn kids! So I thought I would peeplay too.
First, I'm not sure the charge that this helps the movie is true: since the Great Expulsion, there have been cancellations of some pre-release showings. But this incident, and various ScienceBloglings' reactions to it, to me, appears to be functioning as a Rorschach blot for a whole host of larger issues.
One of the things that…
mikethemadbiologist | March 22, 2008Flasing back to my marine biology days, International Polar Year researchers have discovered all sorts of neato critters (sadly, I can't find any pictures):
Scientists who conducted the most comprehensive survey to date of New Zealand's Antarctic waters were surprised by the size of some specimens found, including jellyfish with 12-foot tentacles and 2-foot-wide starfish.
A 2,000-mile journey through the Ross Sea that ended Thursday has also potentially turned up several new species, including as many as eight new mollusks.
...Hanchet singled out the discovery of "fields" of sea lilies that…
mikethemadbiologist | March 20, 2008OK, last post about this bozo, and then I'm done (famous last words...). In the previous post, I dealt with Egnor's claim that the evolution of antibiotic resistance by selection of resistant genotypes is obvious, and not germane (namely, that it wasn't obvious at one point in time). What bothered me with not just Egnor's claim (which I'll get to a minute) and ScienceBlogling Mike's response is that evolutionary biology does have a significant role to play in combating the evolution and spread of antibiotic resistance.
First, what Egnor said:
The important medical research on antibiotic…
sporte | March 13, 2008I think all of us; me, the students the OO advocates, a thoughtful group of commenters, some instructors; I think many of us learned some things that we didn't anticipate the other day and got some interesting glimpses into the ways that other people view and interact with their computers.
Some of the people who participated in the challenge found out that it was harder than they expected.
Lessons learned
Okay, what did we learn?
1. The community is the best thing about Open Source
The Open Office advocates enjoy a challenge and are truly, quite helpful. That was something that adventure…
mikethemadbiologist | March 13, 2008No, that's accurate:
The first national study of four common sexually transmitted diseases among girls and young women has found that one in four are infected with at least one of the diseases, federal health officials reported Tuesday.
Nearly half the African-Americans in the study of teenagers ages 14 to 19 were infected with at least one of the diseases monitored in the study -- human papillomavirus (HPV), chlamydia, genital herpes and trichomoniasis, a common parasite.
The 50 percent figure compared with 20 percent of white teenagers, health officials and researchers said at a news…
sporte | March 12, 2008Okay OpenOffice fans, show me what you can do.
Earlier this week, I wrote about my challenges with a bug in Microsoft Excel that only appears on Windows computers. Since I use a Mac, I didn't know about the bug when I wrote the assignment and I only found out about it after all but one of my students turned in assignment results with nonsensical pie graphs.
So, I asked what other instructors do with software that behaves differently on different computing platforms. I never did hear from any other instructors, but I did hear from lots of Linux fans. And, lots of other people kindly…
mikethemadbiologist | March 12, 2008I've written before about CTX-M-15 beta-lactamases which make bacteria resistant to most cephalosporin antibiotics--those antibiotics that begin with cef- (or ceph-) or end with -cillin. I've also discussed the role of clonal spread in the rise of antibiotic resistance: most (but obviously not all) resistant infections are not the result of a sensitive strain evolving resistance during the course of infections, but rather due to colonization by a previously resistant strain. A recent article in Emerging Infectious Diseases discusses the role of clonal spread in the dissemination of CTX-M-…
sporte | March 11, 2008I read about this in Bio-IT World and had to go check it out. It's called the Genome Projector and it has to be the coolest genome browser I've ever seen.
They have 320 bacterial genomes to play with. Naturally, I chose our friend E. coli. The little red pins in the picture below mark the positions of ribosomal RNA genes (It's not perfect, at least one of these genes is a ribosomal RNA methyltransferase and not a 16S ribosomal RNA.)
I'm not entirely happy about finding it now, after I've already written and posted all the assignments for my class, but still, I'll post a link for my…
mikethemadbiologist | March 11, 2008Over at evolgen, ScienceBlogling RPM discusses a paper that describes a new barcoding technique for plants. It struck me while reading his post that barcoding has two very different meanings, even though both techniques are used in genomics--and often, at the same time.
One meaning of barcoding, and the one discussed by RPM, is the use of a gene to assign different groups of organisms a taxonomic DNA label (or barcode...). In other words, we're replacing Latin bionomials, like Escherichia coli or Homo sapiens, with a DNA sequence from a single gene (or a set of closely related sequences).…
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
mikethemadbiologist | March 5, 2008Yes, this is O157:H7, not ExPEC. Bully for you.
One thing regarding popular accounts of antibiotic resistance I've noticed is that there is an overemphasis on the evolution of resistance, and an underemphasis on the spread of resistant bacteria. While the evolution of resistance is important, most of what we see in a hospital is not the de novo change of a sensitive strain into a resistant one (i.e., evolution), but, instead, the survival and spread of already resistant bacteria in this antibiotic-laden environment.
What this means is that changes in the frequency of resistant organisms,…
mikethemadbiologist | February 29, 2008One piece of infection control legislation moving (slowly) through Congress is the Healthy Hospitals Act, H.R. 1174 (it's so slow that it's, erm, an act of 2007). H.R. 1174 would amend "the Social Security Act to require public reporting of health care-associated infections data by hospitals and ambulatory surgical centers and to permit the Secretary of Health and Human Services to establish a pilot program to provide incentives to hospitals and ambulatory surgical centers to eliminate the rate of occurrence of such infections."
There are many good provisions in this legislation:
Hospitals…
mikethemadbiologist | February 27, 2008And that includes the pets. Since I saw the 'TV version' while at the gym yesterday, that spurred me to get around to discussing this article about the transmission of E. coli within families.
In the article, the authors sampled at least seven isolates* of E. coli from 152 people and 76 pets, and then genetically typed them. Within households, pets were most likely to share genetically identical E. coli (58% of possible 'pet-pet' pairs), followed by adult-child (34%), child-child (33%), adult-adult (24%), adult-pet (18%), and child-pet (15%). What's interesting is that only 12% of shared…