puzzle
esiegel | July 28, 2012"Arithmetic! Algebra! Geometry! Grandiose trinity! Luminous triangle! Whoever has not known you is without sense!" -Comte de Lautréamont
When you think about it, it's amazing that our physical Universe makes sense at all. The fact that we can observe what's happening, determine the laws that govern it, and predict what will happen under the same or similar circumstances is the most remarkable power that science has. If that's what you're doing in any aspect of your life, congratulations, you are a scientist. But that doesn't tell us, fundamentally, what the Universe is like at its most basic…
sciencepunk | August 31, 2011My folks have a pear tree at the end of the garden. It never really produces much in the way of fruit - I think it's too close to the much bigger apple tree. I found this pear lying on the ground in some long grass. It has a weird pattern of holes made in a perfect spiral along the fruit. What happened?
stoat | June 5, 2011Following the success of Where are we now? from Jules-n-James, I present you with a slightly harder one:
[*] I am, of course, not there now. Nor was I there when I wrote this. But I was there when I took the photo.
Refs
* Poppies
sciencepunk | June 23, 2010This is a story about how a simple puzzle ended up haunting me for over 20 years. It's a story of hubris blocked by a mountain of cold mathematics, and the obsession spawned by knowing an answer is out there, but not knowing how to find it.
Growing on a remote island, my youthful thirst for new reading material was quenched in regular bursts from the Scholastic catalogue, a thrilling piece of folded A3 paper that flaunted great collections of tremendously exciting tomes on everything from monsters to maths. The best were the ones that combined the two.
Popular at the time, these…
sporte | April 11, 2008I know some of you enjoy looking at data and seeing if you can figure out what's going on.
For this Friday's puzzler, I'm going to send you to FinchTalk, our company blog, to take a look at lots of data from a resequencing experiment that was done to look for SNPs and count alleles. The graph is at the end of the post.
The graph shows data from 4608 reads (sequenced from both strands, forward and reverse). And there are some interesting patterns. Can you figure them out?
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…