apalazzo | August 25, 2006This week it's an easy one.
Click here for a blowup.
Hint:
The debate stems from work done here.
What the hell am I talking about? You tell me.
(P.S. Ignore the arrow.)
apalazzo | August 24, 2006OK this post was a warm up for today.
Microtubules are long hollow polymers. They are also polar. Their minus ends are inert and are found towards the cell center while their plus ends grow and shrink and are found towards the cell periphery.
Question: Why are microtubules hollow?
Well you might think that a tube provides more strength and is less flexible. Now that might be true for a cluster of microtubules bunched up together, but beyond a couple of micrometers, single microtubules are as limp as a wet noodle.
Could there be another role?
Others have claimed that various micro "cargo"…
apalazzo | August 24, 2006Just an update for those who know me. This past week has been a little crazy. We just bought our first car (my wife needs it for her new job). Having lived close to 10 years in Manhattan and then downtown Boston, we never really needed a car and probably saved quite a bit by never owning one. But I guess it was inevitable.
So what did we buy?
At first we checked out Craig's List. You can find superb deals there, however the condition and state of the car + reliability of the seller is always in doubt. A friend of mine went through the car listings on Craig's List, only to find out that many…
apalazzo | August 22, 2006The Cytoskeleton. Now that's what you call a misnomer. It is one of the most fascinating, yet misunderstood, macromolecular assemblies of the cell. Yes, the cytoskeleton can act as a scafold onto which the rest of the cell is drapped (so to speak), but in reality the cytoskeleton is a dynamic responsive network that can mold the cell and organize the cell's contents to maximize inner-cell differentiation. Perhaps a bettler title is the psychoskeleton, as one noted researcher once called it.
Take the microtubule cytoskeleton. This is a highly dynamic structure that grows and shrinks constantly…
apalazzo | August 20, 2006What decade are we in? I've always wondered, are we the in the Zeros'?
The study of Biology is a cross between Occam's Razor and Murphy's Laws.
"I don't believe in evolution" is like saying "I don't believe in algebra".
Evolution is like the free market, intelligent design is communism.
(PS Inspired by this, but not playing by the rules ... i.e. quotes were generated by me in a drunken state)
apalazzo | August 19, 2006Not so long ago I wrote about piRNA. After reading a bit more, there are some points I'd like to make:
- It would seem that piRNA (read this for background) are required for proper spermiogenesis.
- The argonaute family members associated with piRNA (Piwi, Miwi, Mili, Riwi ...) are only expressed in testes.
- The piRNA transcripts all come from specific loci in the genome.
It would seem like the piRNA may be processed fragments of a few transcripts that are transcribed from certain promoters within the genome. These piRNA don't seem to recognize retrotransposons or other "selfish genes" so…
apalazzo | August 18, 2006So look what I saw:
Yes this current issue.
Midway down, you'll bump into this paragraph:
Yeah I know mostly frivolous stuff. It kinda pisses me off that its always the S&S entries that get lots of comments and the really neat and cool stories like my centrosome endosymbiotic theory entry gets 1 comment (if I'm lucky).
I guess I shouldn't complain, others have a much more valid reason to be upset.
apalazzo | August 18, 2006In celebration of the 11th edition (and because I enjoy presenting my hints in doublets) I present this week's mystery campus as a dialogue. Have fun:
X: [thinking to himself] Going out during evenings ... lovely.
I: Hello X, what a coincidence, I came out for a nice brisk stroll and I saw you passing by.
X: Funny, you tell me the same story everyday.
I: So will they solve it?
X: There are clues.
I: Yes the clues ... they must find the unifying idea.
X: But there may not be enough.
I: Clues?
X: You can never have too many clues.
I: Not this again.
X: Formally, to represent reality within a…
apalazzo | August 17, 2006Wow, centrosomes attract a strange crowd.
Strange theories about centrosomes are plentiful. Some quacks have claimed that they are , "the eyes of the cell", some sort of quantum pulse generator that secretes consciousness and now a turbine.
Ian Musgrave at Panda's thumb posted a summary of how ID proponents ... really don't have a clue about centrosome research.
(Also FrinkTank proposes its own centrosome theory - sorry Dan, I guess two central spots is a lot sexier than theories on cancer/dedifferentiation.)
apalazzo | August 17, 2006Everyone is all up in arms about whether Pluto (+ other massive objects at the far end of our solar system) is a planet. It would seem like every ScienceBlog blogger expounded his/her opinion on the subject.
I thought this would be a one day affair in our ADD world, but again this morning I pick up the NYTimes and there is an Editorial entitled "Dissing Pluto and other Plutons". (The NYTimes used the word Dissing???)
The trouble is, the new definition of a planet will include an awful mélange of icy rocks found on the outer fringes of the solar system. It would be far better to expel Pluto…
apalazzo | August 16, 2006(in the best possible way)
I'm scanning through Science when BAM:
He's imaging RNA polymerase as it transcribes DNA .... nucleotide by freakin' nucleotide ... it's sequencing at the individual molecule level.
(To all those thinking about the future of biology and day dreaming of "big biology", this is where it's at ... single molecule enzymology.)
Ref:
William J. Greenleaf and Steven M. Block
Single-Molecule, Motion-Based DNA Sequencing Using RNA Polymerase
Science (2006) 313:801
apalazzo | August 16, 2006Yes I wrote about centrosome kissing and then ... another paper appears in Nature Cell Biology.
But this time it's not in mammalian cells but in yeast. Remember what I once said:
prokaryotic (bacterial) strategy: out-multiply your neighbors
eukaryotic strategy: out-sophisticate your neighbors
yeast strategy: shed many of your eukaryotic tools and go back to out-multiplying your neighbors
Durring cell division in eukaryotes, microtubules that eminate from two centrosomes form a spindle. The spindle microtubules act to yank the duplicated chromosomes to each daugther cell. But microtubules are…
apalazzo | August 14, 2006GpppGACUCAUAUUUCUAUUUCAUGUCGUGCUCCUAGCCGCCAUGGCUAAUUA
UAUGGCUUAUCAUGCUGUUGAAUCUGAAGAAAAUACUCAUAUUUCUCAUGA
ACGUGAAAUCAGGUAGGCAUCACACACGAUUAACAACCCCUAAAAAUACA
CUUUGAAAAUAUUGAAAAUAUGUUUUUGUAUACAUUUUUGAUAUUUUCAAACA
AUACGCAGUUAUAAAACUCAUUAGCUAACCCAUUUUUUUCUUUGCUUAUGCUUA
CAGUAUGUAUGUUGAACGUUCUAACCCUCUUGAAGCUUCUGAACGUGAACCU
CUUUAUUGGAUUACUCAUGCUACUCGUGCUAAUUCUUGUCGUAUUCCUACUACU
CAUGCUAAUAAAUCUUAAACUCAUGAAGAAAAUGAUUAUAUAAAAGAAUC
UAAAAAAAAAAAAAAAAAA
apalazzo | August 12, 2006A new paper provides evidence that certain RNAs associate with centrosomes and may represent a centrosomal RNA genome. Furthermore this potential genome includes an enzyme that could copy the centrosomal associated RNA. But first some background.
For many years, there have been scientists interested in the mysterious entity called the centrosome. Often refered to as the black hole of the eukaryotic cell, these intracellular structures (see red dots) are often located next to the nucleus (blue), where the microtubule cytoskeleton (green) converges (called the microtubule organizing center).…
apalazzo | August 11, 2006Can it be? Number ten?
OK time for a real challenge. Here is a little twist, I'll present two aerial photos, and you tell me
what is the connection?
(that's a big hint)
View larger photo
View larger photo
Leave your answers in the comments section.
apalazzo | August 10, 2006
This has to be one of the funniest/strangest blogs:blog.tenderbutton.com
He recently performed NMR and TLC on his earwax.
I love his rant on old crappy bottles of reagents. (Great graphics too!)
And his love for dirt cheap reagents with antiquated warning lables.
I really like this TBSCl, mainly because of the packaging. The bottle looks like a giant pickle jar. The best part is the little corrosive warning icon. I'm pretty sure it's supposed to be that familiar graphic of the acid melting through the guys hand, but it's so poorly rasterized and pixellated that it's almost unrecognizable.…
apalazzo | August 10, 2006Others write about it.
So apparently some rant by a Physicist has been making the rounds (and it's not the first time). Lots of bloggers have commented on it.
Should students be discouraged from going into science? Do we have to many PhDs? Should we help science undergrads organize their careers? And yes, poor physicists can't even jump ship and get a job in industry (unless they start designing semiconductors) ...
But I refuse to participate! Enough whining! (Yes I know, by writing this entry I'm a hypocrite.)
So what do I have to say? Well anyone who reads this blog on a regular basis knows…
apalazzo | August 9, 2006In the world of science blogging, it would seem, that there ain't many cell biologists (as far as I can tell). What is a Cell Biologist? Well lets just say that one of the main tools of your trade is photographing fluorescent images of cells.
Here is another definition (from the Disciplines of the Life Sciences):
Cell Biologist:
Cell biologists are the psychiatrists of the cellular world. They observe cell "behavior" through a microscope. They give cells drugs. They probe cells with microinjector needles. They shine big lasers ... well it's not always clear what they do with their lasers. A…