Genetics & Molecular Biology
sporte | June 4, 2008Have you ever wondered what kinds of viruses can be found in human waste?
Mya Breitbart and team have been sequencing nucleic acids from fecal samples in order to find out. You might expect that we'd find viruses that infect humans or viruses that infect the bacteria in our gut.
I wouldn't have expected to learn the result that they found.
A large number, 60% of the viral DNA sequences were from unknown viruses. That's not a surprise. The surprise came when they looked at the RNA viruses.
Instead, the viral sequences most often came from a plant pathogen called the pepper mild mottle…
sporte | June 4, 2008I'm in Berkeley right now at the annual Bio-Link Summer Fellows forum. We're getting to hear talks from people in the biotech industry, listen to enthusiastic instructors describe their biotech programs and ideas, and try out new educational materials.
Yesterday, two speakers (Damon Tighe and Jason Baumohl) from the Joint Genome Institute in Walnut Creek, CA, gave a fun talk about DNA sequencing and sequence assembly.
They also showed some very nice Flash animations, made by Damon Tighe, at the JGI, that illustrate how DNA sequencing is done. There's no sound, but the animations are…
sporte | May 29, 2008I got my copy of "A short guide to the human genome" by Stewart Scherer today from Cold Spring Harbor Laboratory Press (2008, ISBN 978-087969791-4). Usually, I would wait until after I've read a book to write a review, but this book doesn't require that kind of study. As soon I skimmed through it and read some of the questions and answers, I knew this would be the kind of quick reference that I would like to have sitting above my desk.
Scherer has compiled a wonderful text that not only answers many of the kinds of questions that I can think to ask about the human genome, but the kinds of…
sporte | May 29, 2008RFLP is an acronym that stands for "Restriction Fragment Length Polymorphism." That's quite a mouthful and once you've said this phrase a few times, you realize why we use the initials instead.
I know a Restriction Fragment Length Polymorphism sounds like something that must be impossibly complicated to understand, but if we take the name apart, it's really not so bad.
Let's start with most familiar one of the four words and work from there. My guess is that for many of you, that word is "length." When we talk about length in this context, we are talking about the length of a piece of…
sporte | May 8, 2008Dave Robinson and Joann Lau from Bellarmine College in Kentucky are going to be describing their student project in a free webinar next Friday, May 16th. Their students clone GAPDH (Glyceraldehyde 3-Phosphate Dehydrogenase) genes from new plants, assemble the DNA sequences, and submit them to the NCBI. Here's an example.
Plus, since GAPDH is a highly conserved, it's a great model for looking at evolution.
You can get more information and register here.
The cool thing about plants is that there's lots of material to work with.
sporte | April 17, 2008In the class that I'm teaching, we found that several PCR products, amplified from the 16S ribosomal RNA genes from bacterial isolates, contain a mixed base in one or more positions.
We picked samples where the mixed bases were located in high quality regions of the sequence (Q >40), and determined that the mixed bases mostly likely come from different ribosomal RNA genes. Many species of bacteria have multiple copies of 16S ribosomal RNA genes and the copies can differ from each other within a single genome and between genomes.
Now, in one of our last projects we are determining where…
sporte | April 16, 2008Ribosomes are molecular machines that build new proteins. This process of synthesizing a protein is also known as translation.
Many antibiotics prevent translation by binding to ribosomal RNA. In the class that I'm teaching, we're going to be looking at ribosome structures to see if the polymorphisms that we find in the sequences of 16S ribosomal RNA are related antibiotic resistance.
This is related to our metagenomics project where we investigate the polymorphisms we find in 16S ribosomal RNAs.
This 6 minute video introduces ribosomes, discusses where they're found, what they're made of,…
sporte | April 9, 2008You can find out. Blaine Bettinger, the Genetic Genealogist has a fun little quiz.
sporte | April 3, 2008Goodbye desktop, we're off to see the web.
Both my students and I have been challenged this semester by the diversity of computer platforms, software versions, and unexpected bugs. Naturally, I turned to the world and my readers for help and suggestions. Some readers have suggested we could solve everything by using Linux. Others have convincingly demonstrated that Open Office is a reasonable alternative.
But, now there's something new and cool on the web.
Okay, it's still in the beta stages, and apparently it can only be used by a limited number of people at a time, but it's certainly…
sporte | April 2, 2008A few months ago I posed some questions about the regulations that might oversee personal genomics companies (Who's your Daddy? and Step right up, get your very own DNA profile).
Why?
Because I am biased. At Geospiza, where I work, we make software products that help our customers, who do DNA testing, meet FDA and CLIA regulations. Since some of our customers do DNA testing for diagnostics and clinical studies, we are well aware of the regulatory issues that concern DNA sequencing and DNA sequence data. Most DNA diagnostics labs are regulated by CLIA, the Clinical Laboratory Improvement…
sporte | March 27, 2008I made this video (below the fold) to illustrate the steps involved in making a phylogenetic tree. The basic steps are to:
Build a data set
Align the sequences
Make a tree
In the class that I'm teaching, we're making these trees in order to compare sequences from our metagenomics experiment with the multiple copies of 16S ribosomal RNA (rRNA) genes that we can find in single bacterial genomes. Bacteria contain between 2 to 13 copies of 16S rRNA genes and we're interested in knowing how much they differ from each other. Later, we'll compare the 16S ribosomal RNA genes from multiple species of…
sporte | March 19, 2008Have you ever wondered how to view and annotate molecular structures? At least digital versions?
It's surprisingly easy and lots of fun.
Here's a movie I made that demonstrates how you can use Cn3D, a free structure-viewing program from the NCBI. Luckily, Cn3D behaves almost the same way on both Windows and Mac OS X.
Introduction to Cn3D from Sandra Porter on Vimeo.
sporte | March 11, 2008I read about this in Bio-IT World and had to go check it out. It's called the Genome Projector and it has to be the coolest genome browser I've ever seen.
They have 320 bacterial genomes to play with. Naturally, I chose our friend E. coli. The little red pins in the picture below mark the positions of ribosomal RNA genes (It's not perfect, at least one of these genes is a ribosomal RNA methyltransferase and not a 16S ribosomal RNA.)
I'm not entirely happy about finding it now, after I've already written and posted all the assignments for my class, but still, I'll post a link for my…
sporte | March 7, 2008Here's a fun puzzler for you to figure out.
The blast graph is here:
The table with scores is here, click the table to see a bigger image:
And here is the puzzling part: Why is the total score so high?
If you want to repeat this for yourself, go here.
You can use this sequence as a query (it's the same one that I used).
>301.ab1
CTAGCTCTTGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATGGAG
GGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGA
CCTTCGGGCCTCACACCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGG
CTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGA…
sporte | February 26, 2008What do you do after you've used DNA sequencing to identify the bacteria, viruses, or other organisms in the environment?
What's the next step?
This four part video series covers those next steps. In this part, we learn that a surprisingly large portion of bioinformatics, or any type of informatics is concerned with fixing data entry errors and spelling mistakes.
The parts of this series are:
I. Downloading the data from iFinch and preparing it for analysis. (this is the video below) (We split the data from one column into three).
II. Cleaning up the data
III. Counting all the bacteria…
sporte | February 12, 2008Well, probably getting a stipend to help you do it.
And, the really cool thing is that's part of the deal!
Hustle, hustle the deadline is March 7th, and all the contact info is below.
The NSF Research Experience for Undergraduates program in Environmental Microbiology at UNLV is accepting applications.
This grant provides students with the opportunity to work on a research project for a 10 week period with a faculty mentor. Students receive a $4000 stipend, round trip airfare, and housing in a UNLV dormitory.
Mentors have projects in the following areas:
⢠Adaptation of…
sporte | January 9, 2008The New England Journal of Medicine published a study yesterday showing that small changes in the DNA in the long arm of chromosome 16 are associated with autism.
I met a teenager with autism last summer, when I attended family night at the Seattle Park and Rec summer camp program for kids with special needs. It's a fantastic program. The kids spend a week or more at summer camp and the parents get some much needed time off.
I sat down on a log and my daughter (one of the counselors) introduced to me a boy in her cabin and told me that he's interested in trains. Since I rode a train for…
sporte | December 28, 2007If you look below the fold, you can see two molecules locked in a tight embrace. These molecules or their closely related cousins can be found in any cell because their ability to evolve is slowed by their need to interact with each other in the right way.
In an earlier post, I asked:
Who are they?
One partner is a small bit of 16S ribosomal RNA, about 56 nucleotides to be precise. The other partner is S15, one the proteins in the ribosome.
If we could look inside the bacteria that made these, we would see lots of other proteins binding to these two partners within a molecular machine.…
sporte | December 26, 2007Genetics textbooks abound with stories of European royalty and the hazards of having children after you've married one of your cousins. It struck me as an interesting parallel that the lion is such a popular symbol in so many royal coats of arms. Like the royal families of Europe, certain lion populations have also suffered from a few too many copies of certain recessive genes.
I first read about the Florida panthers a few years ago while researching material for a class that I teach on using bioinformatics. It wasn't my first encounter with big cats and their DNA. Years before, while…
sporte | December 20, 2007You can get a jump on the Darwin Day festivities.
Once again the Alliance for Science is sponsoring an essay contest for Darwin Day. If you download their suggestions for good essay writing, you can get your essay done over winter break and have a good crack at winning on those cash prizes!
The Alliance for Science is pleased to announce our second annual National High School Essay Contest. We invite interested students to submit essays of up to 1,000 words on one of two topics -- Climate and Evolution or Agriculture and Evolution. Click on the topic names for some possible ideas to explore…