Science
bioephemera | April 11, 2010Fellow lab rats, banish the lingering odor of LB broth from your nostrils and imagine how awesome research would be if these little cuties were your model organisms!
Buy them from Specimen7 on MakersMarket.
bioephemera | April 10, 2010Skeptvet has created a pithy, albeit cynical, table summarizing what scientists write, what it really means, and what the public thinks it means. I've clipped a little bit of it here, but go to Skeptvet for the whole thing. Nice work!
pharyngula | April 10, 2010
For many years, the NSF has been producing a biennial report on American attitudes (and many other statistics) about science called Science and Engineering Indicators. This year, as they have every year, they got the uncomfortable news that a majority of our compatriots reject human evolution and the Big Bang (that last one might have been partly because of the dumb way the question is phrased). What's different, though, is that for the first time the NSF has decided to omit the fact.
This is very strange. It is a serious problem in our educational system that so much of the public is vocal…
drorzel | April 9, 2010The National Science Board made a deeply regrettable decision to omit questions on evolution and the Big Bang from the Science and Engineering Indicators report for 2010. As you might expect, this has stirred up some controversy.
I wasn't surprised to learn this, as I had already noticed the omission a couple of months ago, when I updated the slides for my talk on public communication of science-- the figure showing survey data in the current talk doesn't include those questions, while the original version has them in there. I noticed it, and thought it was a little odd, but it had no effect…
awild | April 9, 2010
Penthe pimelia (Tetratomidae)
Illinois, USA
A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity.
As I'm not a Coleopterist, I spent most of my time lost in a befuddled daze of incomprehensible taxonomy. There are so many beetles. The larger families each hold more species than all of the vertebrates combined. Think about all the mammals and birds you know- the warblers, the polar bears, the shrews, the…
grrlscientist | April 9, 2010
Image: wemidji (Jacques Marcoux).
Nam et ipsa scientia potestas est (And thus knowledge itself is power)
-- Sir Francis Bacon.
The next edition of Scientia Pro Publica (Science for the People) will publish on Monday and as usual, it is seeking submissions and hosts! Can you help by sending URLs for your own or others' well-written science, medicine, and nature blog essays to me or by volunteering to host this carnival on your blog?
Scientia Pro Publica is a traveling blog carnival that celebrates the best science, environment, nature and medical writing that has been published in the…
catdynamics | April 8, 2010The volcanic eruption at Eyjafjallajökull continues, but, for now at least, is a "tourist eruption", as nice as they get, with a huge flood of tourists to the mountain on clear days and a boom industry in getting sightseers out to the mountain.
From rainbowgirl on flickr via fiveprime - click through to source and full size photos
The original fissure that erupted has closed after building up a nice cinder cone, but the second fissure mostly consolidated into a single crater which continues strong.
The mountain is still rumbling and swelling, suggesting magma continues to flow under the…
bioephemera | April 8, 2010
While I was guest-posting over at Collective Imagination last month, I suggested that while better public access to peer reviewed research articles is a priority for the scientific community, knocking down firewalls may not be sufficient to help many patients, who lack the scientific background to plow through a Nature article. To get there, we may need efforts to provide plain language, accessible, searchable summaries of the research that clearly signpost the articles' relevance to patient needs. In addition to many interesting comments on the post, I got an email from the people behind…
drorzel | April 8, 2010Via Twitter, Michael Barton is looking for some good books about physics. I was Twitter-less for a few days around the period of his request, and this is a more-than-140-characters topic if ever there was one, so I'm turning it into a blog post.
The reason for the request is that he's going to be working as an intern at the Einstein exhibit when it visits Portland, which makes this a little tricky, as relativity is not an area I've read a lot of popular books in (yet-- that's changing). That will make this a little more sparse than it might be in some other fields.
There's also an essential…
drorzel | April 8, 2010Back when I was in grad school, and paper copies of journals were delivered to the lab by a happy mailman riding a brontosaurus, I used to play a little game when the new copy of Physical Review Letters arrived: I would flip through the papers in the high energy and nuclear physics sections, and see if I could find one where the author list included at least one surname for every letter of the alphabet. There wasn't one every week, but it wasn't that hard (particularly with large numbers of physicists from China, where family names beginning with "X" are more common).
Every so often, somebody…
grrlscientist | April 7, 2010tags: education, public outreach, SciCafe, science cafe, AMNH, American Museum of Natural History, NYC, streaming video
Who: Kristin Baldwin, Assistant Professor at Scripps Research's Department of Cell Biology
What: free public presentation, "The Future of Stem Cells"
When: TONIGHT at 700pm
Where: Gottesman Hall of Planet Earth, American Museum of Natural History, Enter at the 81st Street (Rose Center) [directions and maps]
Cost: FREE, and there is a cash bar too! (must be 21+ with ID)
What if your cells could be engineered to grow your own replacement organs? Glimpse the future of…
drorzel | April 7, 2010I'm still getting things squared away after my blogging break, but as a step on the way back toward normal programming, here's a Dorky Poll: What kind of numbers do you most like to work with?
What kind of numbers do you like best?online surveys
You can only choose a single answer, which I'm sure will come as a disappointment to many of those favoring the later options. You could always vote a second time from a different computer, though...
bioephemera | April 6, 2010
So the word among my friends is that the iPad, which, as Stephen Fry noted, may be the closest thing humanity has yet produced to a Hitchhiker's Guide to the Galaxy, might just be worth buying -- if only as a stunningly cool toy and not, alas, the tablet many of us wanted. For example, I give you TouchPress' ebook The Elements for iPad, by Theodore Grey:
As the first really new ebook developed from the ground up for iPad, The Elements beautifully shows off the capabilities of this lovely device. It is impossile to describe in words the experience of seeing and almost feeling over 500…
awild | April 6, 2010
Plega sp. (Mantispidae)
Who was the source of Monday's DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae.
10 points to Aaron Hardin, who guessed it first.
For future reference, these genetic puzzles are only slightly more complicated than a Google search. Go to NCBI's BLAST page, select "nucleotide blast" (because we have nucleotide data), click the box for "others" to get you out of the human genome, enter the sequence in the search box, and click the "BLAST" button. Any significant…
grrlscientist | April 6, 2010tags: education, public outreach, SciCafe, science cafe, AMNH, American Museum of Natural History, NYC, streaming video
Who: Kristin Baldwin, Assistant Professor at Scripps Research's Department of Cell Biology
What: free public presentation, "The Future of Stem Cells"
When: Wednesday, 7 April at 700pm
Where: Gottesman Hall of Planet Earth, American Museum of Natural History, Enter at the 81st Street (Rose Center) [directions and maps]
Cost: FREE, and there is a cash bar too! (must be 21+ with ID)
What if your cells could be engineered to grow your own replacement organs? Glimpse the…
awild | April 6, 2010Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil:
Having trouble? I've arranged a Formica specimen to model the pose:
In the comments below, Vincent provides his perspective:
Well, sounds that the ant nature of our fossil is getting much controversy here! I understand that the photograph provided in our paper is not very clear, so I'd like to clarify things and try to convince everyone. First of all the photograph you are commenting on was published here…
grrlscientist | April 5, 2010
Image: wemidji (Jacques Marcoux).
Nam et ipsa scientia potestas est (And thus knowledge itself is power)
-- Sir Francis Bacon.
This week's edition of Scientia Pro Publica (Science for the People) has been published at two separate locations: "Scientia Pro Publica 24: Origins Edition" by Andrew at 360 Degree Skeptic and by Andrew at Southern Fried Science. This twin edition is christened (by me): "The Twin Sons of Different Mothers" edition, or perhaps "The Revenge of the Andrews".
How did this happen? I wonder. Haven't I sent out enough emails about this blog carnival, the host schedule…
awild | April 5, 2010
In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
awild | April 5, 2010Today's breaking news in Ant Science is this:
Newly discovered pieces of amber have given scientists a peek into the Africa of 95 million years ago, when flowering plants blossomed across Earth and the animal world scrambled to adapt.
Suspended in the stream of time were ancestors of modern spiders, wasps and ferns, but the prize is a wingless ant that challenges current notions about the origins of that globe-spanning insect family...Inside the Ethiopian amber is an ant that looks nothing like ants found in Cretaceous amber from France and Burma.
Wow- that's big news! I wonder what this…
bioephemera | April 5, 2010This is kind of cool:
For the second year in a row, AAAS [the American Association for the Advancement of Science] will be arranging hands-on science activities for children attending the White House Easter Egg Roll.AAAS was invited by the Office of Science and Technology Policy to help infuse science into the event on Monday 5 April. In partnership with AAAS, the Lawrence Hall of Science at the University of California, Berkeley, also will be participating in the event.With the theme "The Science of Spring," AAAS staffers have arranged activities, such as bean dissection and viewing of seeds…