In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
- Log in to post comments
More like this
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene…
Mystery #1
I admit, I like to pick on iStockphoto, the pioneering company behind the high volume/low cost microstock model of media licensing.
There's nothing wrong with microstock. After all, the thriving web-based market for cheap images is a ripe opportunity. But buyers get what they pay for…
Tonight's challenge is this rather unusual insect.
What is it?
Points will be awarded to the first person to pick the order (3), family (3), and genus (3). Plus, a bonus point for explaining what is unusual about this insect's life cycle.
The cumulative winner for the month of June 2010 will get…
Tonight's mystery is a straight-up Name That Bug:
From central Florida, the mystery insect
One point for picking the order, two points for family, five points for genus, and five points for species. [added in edit- you've got to be first in any one category].
And guess what? We've finally decided…
Oh, I can do this one. BLAST against nr says Plega!
random guess: Acyrthosiphon???
I second Aaron, Plega dactylota - a mantispid.
Jerusalem artichoke? (Helianthus tuberosus)
Yellow Perch? (Perca flavescens)
Florida lancelet? (Branchiostoma floridae)
I'm going to go with the 'choke.
Oh yeah, this is an insect blog. So, one might suspect the mantispid - a totally rad beast!
Camponotus! :D
Drosophila??? Phlebotomus????? Rhodnius?????? Anopheles? Apis? oh, I don't know.
one more wild guess: Solenopsis? Linepithema?
You know, if you just cut and paste every animal genus name you're bound to hit it at some point. :)
Genbank has a 100% match to the CAD gene of a Mantidfly called Plega dactylota
How do you use Genbank? I don't really understand it.
I was way too late to be first here. Do I get a point for being first to nail it on Facebook? :-)
Ah, now I've finally found it.
Finally one I could get and I'm too late. Genbank says Plega dactylota.
I would've so totally gotten this one if I'd gotten here earlier :)
that's funny :)
Plega (Mantispidae)
Aw, I'm not first by a long shot.