fun
clock | April 16, 2010
Hat-tip: Annalee Newitz:
Crazy Brazilian pranksters managed to get a colony of real ants to carry tiny protest signs in a demonstration against the insecticide Baygon. Need I say that I welcome our new insect overlords?
clock | April 16, 2010
Neil Fraser was curious about this question, so he built a centrifuge at home and recorded a lava lamp at 3G (which is higher than Jupiter, actually). He explains the details here.
[hat-tip]
awild | April 14, 2010I would be remiss in my duties as an ant blogger to not pass this on from NCBI ROFL:
Transcultural sexology: formicophilia*, a newly named paraphilia in a young Buddhist male.
*The sexual interest in being crawled upon or nibbled by small insects, such as ants
Abstract: Children whose species-specific, juvenile sexual rehearsal play is thwarted or traumatized are at risk for developing a compensatory paraphilia. The case of a Buddhist male exemplifies the cross-cultural application of this principle. His syndrome, formicophilia, was endogenously generated without reference to or influence by…
cagapakis | April 14, 2010As you can probably imagine, there are a lot of very interesting things that pop up when you have a google alert for "synthetic biology." Here is today's special find: a short dubstep song about synthetic biology by Dysoniq, featuring a voice talking about computer chips for your brain from this video, an interesting hour-long BBC presentation about intelligent robots (thanks again, Google!).
Synthetic BiologybyDysoniq
awild | April 13, 2010The winners of the NCSU insect blog Hexapod Haiku Challenge have been announced. Here's the best in show:
Major, Undeclared
Silverfish, tell me,
Darwin and Dostoevsky,
do they taste the same?
-Martha Love
Gastonia, NC
Ha! I love it.
awild | April 12, 2010[note: this and all preceding entries are reposted from myrmecos.wordpress.com; guesses for this Monday Night Mystery are also lodged here.]
What in the world is this strange creature?
The point breakdown* will be as follows:
2 points for order
2 points for family
2 points for genus
2 points for species
2 points for describing the behavior
As in past weeks, you have to be first in each category.
*What are Myrmecos points good for? The cumulative winner at the end of the month gets to choose either 1)any 8x10 print from alexanderwild.com, or 2) a guest blog post on a topic of their choosing.
clock | April 11, 2010
The other night I went to the opening night of RENT at Duke, the latest production of the Hoof 'n' Horn ensemble, the 'South's oldest student-run musical theater organization' (find them on Facebook and Twitter). Here's the promo video, released before the opening night:
I always have difficulty judging plays by amateur ensembles - at exactly which standard should I hold them? I have seen amazing high-school plays and horrible professional ones (I mentioned both in this post), as well as, of course, amazing professional ones. The Duke group is a mix of people with some stage experience and…
awild | April 5, 2010
In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
awild | April 5, 2010[a guest post by myrmecologist Andrea Lucky]
Andrea & her intrepid field team in New Guinea
It was a dark and stormy night...
...actually, it was a dark and stormy morning. The dawn of the 7th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week before when the sun emerged and for a glorious 10 minutes it was warm enough to splash some water on my arms, legs and neck and wipe away the accumulated grime that is synonymous with field work. I wondered if that lovely burst of sunshine would ever come again (no, it wouldn't), and every time I…
awild | April 3, 2010We're hosting a party for the roller derby girls, so I'm otherwise preoccupied today. Help yourself to some links, though:
Mark Moffett, the quintessential National Geographic bug photographer, has a new ant book.
Margaret Atwood (yes, that Margaret Atwood), reviews E. O. Wilson's novel.
Carl Zimmer suffers genome fatigue.
Mantis shrimp glow in the dark.
Who wants to help Tim Eisele identify his mystery ants?
cagapakis | March 31, 2010Because of my recent interest in autonomous, biologically inspired robots, my friend Tami sent me some fascinating links about designs and concepts for future flesh eating robots.
From New Scientist, furniture that captures vermin and uses the biomass to power fuel cells that run small electronics:
From Wired, Human corpse powered robots being developed by the Defense Department:
From the file marked "Evidently, many scientists have never seen even one scary sci-fi movie": The Defense Department is funding research into battlefield robots that power themselves by eating human corpses. What…
cagapakis | March 29, 2010Another Hydrocalypse Industries original production, the Beard-ome presents imaginary work on the genomics of the beard. What's lying beneath your beard?
awild | March 24, 2010What was that dashing bug in pastel colors? As so many of you picked, it's a palmetto planthopper.
Order: Hemiptera
Family: Flatidae
Genus: Ormenaria
Species: rufifascia
Points are awarded as follows:
James Trager: 8 points
Chris Grinter: 5 points
And, one point each for TGIQ, Pete Yeeles, and Ted MacRae for providing additional information including suborder and species year & author.
awild | March 17, 2010Not a fire ant.
But I'll give ten Myrmecos (â¢) points to the first person who can identify what species it really is.
clock | March 12, 2010
ROFL! Can you recognize your favourite sciencebloggers in this comic strip by Joseph Hewitt? To see larger (and read the associated text) go to Ataraxia Theatre