genetics
awild | April 26, 2010
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study.
I'll post the answer tomorrow. Since we've reached the end of the month, I'll tally all the points from the preceding mysteries and announce the March/April mystery winner, who is entitled to either 1) any 8 x 10 print from my photo galleries, or 2) a guest blog slot on any (…
tsmith | April 22, 2010Student guest post by Liz Stepniak
In the field of chronic disease, genetics has long been determined as a component of disease susceptibility. Infectious disease was believed to be caused by an agent of infection, such as a virus or bacteria which comprises a large environmental factor. In the past decade or so, this view has been expanded to include an important genetic factor as well.
There has been scientific evidence supporting the controversial idea that one error in a single gene can significantly alter the individual's risk of obtaining a bacterial infection. Can infectious…
ddobbs | April 19, 2010A few calendar notes: I've got a three-day run starting next Sunday in which I'll be talking to authors and journalists about book proposals; NY science writers about the future of social media; and to genomic geeks about genes and temperament. If you've questions you'd like raised at any of these, please shoot me a note in the comments or privately at david.a.dobbs [at] gmail.com.
This Sunday morning, April 25, I'll be on a panel at the American Society of Journalists and Authors annual conference in New York discussing, along with agents Michelle Brower and Chris Parris-Lamb and GP Putnam…
clock | April 9, 2010Next American Scientist Pizza Lunch:
It's not often that we get to dive a little deeper into a topic encountered at a recent pizza lunch talk. But we will this month. In March, Geoff Ginsburg from Duke briefed us well on the current science regarding genomic (or personalized) medicine and its promising applications. At noon on Tuesday, April 20, Jim Evans from UNC-Chapel Hill will discuss the complexity of implementing this new medicine with a talk entitled: Personalized Medicine: Too Much Information / Too Little Information. Like Dr. Ginsburg, Dr. Evans is a doctor-scientist. He is also…
grrlscientist | April 8, 2010tags: evolutionary biology, behavioral ecology, molecular ecology, personality, novelty seeking, exploratory behavior, dopamine receptor, dopamine receptor D4 gene, DRD4 gene polymorphism, ornithology, birds, Great Tit, Parus major, researchblogging.org,peer-reviewed research, peer-reviewed paper
Bold or cautious? Individuals with a particular gene variant are very curious --
but only in some populations.
Image: Henk Dikkers.
Research suggests that personality variations are heritable in humans and other animal species, and there are many hypotheses as to why differences in personality…
awild | April 5, 2010
In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
ddobbs | April 1, 2010
from "Would dew believe it: The stunning pictures of sleeping insects covered in water droplets," at the Daily Mail
Given the day, we find both foolishness and meat.
Fun stuff first:
Science, Nature Team Up on New Journal - ScienceNOW
Does the WTF1 gene trigger the inferior supra-credulus? @edyong209 falls for the whole thing: http://bit.ly/bLlzqx
Getting real:
Is the Mirror Neuron theory unfalsifiable?: Greg Hickok thinks so.
Pfizer paid $35m to MDs and Researchers. Latter claim $ doesn't influence practice.. Somebody's mistaken.http://s.nyt.com/u/N5m
Motherly love may alter genes for…
mikethemadbiologist | April 1, 2010When I'm not fighting the forces of evil or calling idiots who desperately need my help fucking morons, I'm doing various genomics-related things. One of the things I'm involved with is a project to sequence a bunch of commensal (not associated with disease) E. coli. When most people think of the genus Escherichia, they think of a single species, E. coli. But a recent paper describes five new lineages (clades) of Escherichia that, while found mostly in the environment, are also found in humans (and, yes, we're sequencing ten of these). Here's how they're related to each other:
UPMGA…
laelaps | March 31, 2010A grey mouse lemur (Microcebus murinus). Image from Wikipedia.
Charles Darwin's visit to the Galapagos Archipelago has been celebrated time and again for its influence on his evolutionary thoughts, but I have to wonder what would have happened if the Beagle skipped the Galapagos and visited Madagascar instead. What would Darwin have made of the animals which had been evolving in splendid isolation on the African island? Would "Darwin's lemurs", rather than Darwin's finches, be among the most recognizable icons of evolution?
Answers to such questions are beyond our grasp, but the diverse array…
mikethemadbiologist | March 31, 2010A while ago, I described how previous decisions allowing the patenting of human genes--and thereby making cheap, affordable diagnostics impossible--flew in the face of the goal of federally-funded research. There's no reason to patent something and charge thousands of dollars for something a high school student could do (PCR and sequencing). From The NY Times (italics mine):
Judge Sweet, however, ruled that the patents were "improperly granted" because they involved a "law of nature." He said that many critics of gene patents considered the idea that isolating a gene made it patentable "a '…
ddobbs | March 29, 2010
Early homind skulls, from A Kansan's Guide to Science (seriously)
A couple weeks ago, the Guardian ran an article in which Oxford neurobiologist Colin Blakemore described "how the human got bigger by accident and not through evolution." Though I didn't get to it at the time, I thought that an odd headline, since evolution actually occurs when genetic accidents -- those mutation things -- grant an advantage. Now John Hawks has written a post addressing what he says is a pretty big muckup by Blakemore:
Thanks to Jerry Coyne, I encountered an interview in the Guardian with Colin Blakemore…
razib | March 24, 2010The complete mitochondrial DNA genome of an unknown hominin from southern Siberia:
With the exception of Neanderthals, from which DNA sequences of numerous individuals have now been determined...the number and genetic relationships of other hominin lineages are largely unknown. Here we report a complete mitochondrial (mt) DNA sequence retrieved from a bone excavated in 2008 in Denisova Cave in the Altai Mountains in southern Siberia. It represents a hitherto unknown type of hominin mtDNA that shares a common ancestor with anatomically modern human and Neanderthal mtDNAs about 1.0 million…
ddobbs | March 23, 2010Daniel McArthur and Daniel Vorhaus have a beef:
Earlier this month, the Sunday Times published an op-ed piece by Camilla Long critiquing the practice and business of direct-to-consumer (DTC) genetic testing ("When DNA means do not ask"). It is Long's right, of course, to express her opinions, but the article is peppered with factual inaccuracies and exaggerations that demand correction.
...
While it is regretful that Long herself chooses to remain willfully ignorant of her own genetic information, she is within her rights to do so. However, her attempt to impose that ignorance on her…
razib | March 21, 2010The Andrew Pollack piece which I hinted at came out a few days ago: Consumers Slow to Embrace the Age of Genomics. For what it's worth, I think this chart from Dr. Daniel MacArthur is right on:
This too will pass. I believe that like the internet the knowledge and analysis of our genetic information is going to be ubiquitous after a rough period when most of the dreams of grandeur from the first generation entrepreneurs fade.
razib | March 18, 2010Henry Louis Gates Jr. is looking for his male Irish forebear using genetics:
Well, it turns out that the men sharing that Ui Neill haplotype tended to have certain surnames. If we use those surnames, we narrow the number of possibilities in Allegany and Hampshire counties to 178 men born between 1800 and 1830 bearing 22 surnames.
What's so exciting about this? Well, it turns out that the men in the Gates family line have a particular mutation, a slight variation, in our Ui Neill haplotype. And we inherited that slight mutation, a spelling variant in that DNA signature, through one of those…
razib | March 17, 2010A few weeks ago I commented on the paper about the origin of the small dog phenotype in the Middle East. Now The New York Times has an article on a newer paper, New Finding Puts Origins Of Dogs in Middle East. Here's the conclusion:
Dog domestication and human settlement occurred at the same time, some 15,000 years ago, raising the possibility that dogs may have had a complex impact on the structure of human society. Dogs could have been the sentries that let hunter gatherers settle without fear of surprise attack. They may also have been the first major item of inherited wealth, preceding…
edyong | March 17, 2010In Robert Louis Stevenson's classic story, Dr Henry Jekyll drinks a mysterious potion that transforms him from an upstanding citizen into the violent, murderous Edward Hyde. We might think that such an easy transformation would be confined to the pages of fiction, but a similar fate regularly befalls a common fungus called Fusarium oxysporum.
A team of scientists led by Li-Jun Ma and Charlotte van der Does have found that the fungus can swap four entire chromosomes form one individual to another. This package is the genetic equivalent of Stevenson's potion. It has everything a humble, Jekyll…
razib | March 16, 2010Dienekes has reposted some of the abstracts from the meeting of the American Association of Physical Anthropologists. This one caught my eye, Genetic analyses reveal a history of serial founder effects, admixture between long separated founding populations in Oceania, and interbreeding with archaic humans:
Genetic anthropologists continue to debate whether human neutral genetic variation primarily reflects a continuum of demes connected by local gene flow or colonization and serial founder effects. A second unresolved issue concerns the genetic contribution of archaic species to the modern…
pharyngula | March 16, 2010
First, you start with a lizard.
Really, I'm not joking. Snakes didn't just appear out of nowhere, nor was there simply some massive cosmic zot of a mutation in some primordial legged ancestor that turned their progeny into slithery limbless serpents. One of the tougher lessons to get across to people is that evolution is not about abrupt transmutations of one form into another, but the gradual accumulation of many changes at the genetic level which are typically buffered and have minimal effects on the phenotype, only rarely expanding into a lineage with a marked difference in morphology.…
razib | March 16, 2010Over the past week I've been asked via email and on message boards about about David Shenk's new book, The Genius in All of Us: Why Everything You've Been Told About Genetics, Talent, and IQ Is Wrong. Since I haven't read the book I can't really comment, but I did finally listen to Will Wilkinson's interview with Shenk on bloggingheads.tv. It seems to me that Will exhibited more clarity and precision in one sentence in relation to the term heritability than Shenk did in 10 minutes. It is true there are many people who don't understand that 80% heritable does not mean that a trait is "80%…